ID: 1167443577

View in Genome Browser
Species Human (GRCh38)
Location 19:49524511-49524533
Sequence GGGCCTTCAGGCGCATGGAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167443577_1167443582 -7 Left 1167443577 19:49524511-49524533 CCCCTCCATGCGCCTGAAGGCCC 0: 1
1: 0
2: 0
3: 17
4: 162
Right 1167443582 19:49524527-49524549 AAGGCCCGACCCAGCAGCCCTGG 0: 1
1: 0
2: 1
3: 19
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167443577 Original CRISPR GGGCCTTCAGGCGCATGGAG GGG (reversed) Exonic
900412234 1:2517840-2517862 GGGCCTTCTGGCGTGGGGAGAGG + Intronic
901833688 1:11909590-11909612 GGGCTTTGAGTCGCATGGCGGGG - Intergenic
903145474 1:21369289-21369311 GGGTCTGCAGGCCCATAGAGGGG + Intergenic
903284463 1:22268244-22268266 GGGCTTTCAAACGCCTGGAGTGG - Intergenic
903793008 1:25906936-25906958 GGCCCTGCAGGGGCGTGGAGTGG - Intronic
904029127 1:27523081-27523103 CAGCCTTCAGGCGCCAGGAGGGG - Intergenic
904381254 1:30112487-30112509 GGGCCTTTAGGAACATGCAGAGG - Intergenic
905665958 1:39763240-39763262 GGGCCCTGAGGCTCAGGGAGGGG - Intronic
907585640 1:55615482-55615504 GGGCCATCAGGAGCCAGGAGAGG + Intergenic
910667666 1:89742135-89742157 GCTCCTTCAGGCCCATGGATTGG + Intronic
911002383 1:93180074-93180096 AGGCCTTCAGGGGCATGGGCTGG + Exonic
914249077 1:145907103-145907125 GGGCCTTCAGGCGACCGGAGGGG - Exonic
915215079 1:154334899-154334921 AGGCCTTCATGGGGATGGAGAGG + Intronic
917719267 1:177770555-177770577 GGGCCTTCAGGAGGCAGGAGAGG + Intergenic
918046418 1:180944300-180944322 GGGCCCTCAGGTTCATGGTGGGG + Intronic
919071770 1:192764891-192764913 GTGCATTCAAGCTCATGGAGAGG - Intergenic
1063416696 10:5878863-5878885 GAGCATTCAGGCGTATGAAGAGG - Intronic
1063679490 10:8173305-8173327 GGGCCTACAGGCACATGGCTTGG + Intergenic
1066260909 10:33728901-33728923 TGGCCTTCAGGTACAGGGAGCGG + Intergenic
1066421087 10:35265607-35265629 GCACCTTCAGGCGCTTGGCGTGG - Intronic
1067689310 10:48491167-48491189 GGGCCTTCAGGCTCACTGCGAGG - Intronic
1069999273 10:72364326-72364348 GGGACCTGAGTCGCATGGAGTGG - Intergenic
1070827716 10:79400929-79400951 GGGACTTCAAGCACCTGGAGGGG - Intronic
1075102437 10:119515848-119515870 GTGGCTGCAGGCGCATGAAGGGG - Intronic
1077330364 11:1981491-1981513 GGGCCTTCAGGCACAGGGGAGGG + Intronic
1078679639 11:13463395-13463417 GGGATCTCAGGCGCGTGGAGAGG + Intergenic
1080646954 11:34194393-34194415 GGGGCTTCAGGAGGATGAAGTGG + Intronic
1081484425 11:43516588-43516610 CGGCCTTGAGGCCCAGGGAGAGG + Intergenic
1083322059 11:61853957-61853979 TGGCCTTGAGGTGCATGGAGAGG + Intronic
1085863206 11:80257936-80257958 GGGAGTGCAGGCGCATGGCGCGG + Intergenic
1088005347 11:104933048-104933070 GGGCCTTTTGGGGCATGAAGGGG + Intergenic
1090213209 11:124937675-124937697 GGGCCTTGAGGCTTATGGATGGG + Intergenic
1202813343 11_KI270721v1_random:36670-36692 GGGCCTTCAGGCACAGGGGAGGG + Intergenic
1097011572 12:55956987-55957009 GGACCTTCAGGCTCAGGGATAGG + Exonic
1101875104 12:108592287-108592309 TGGCCTTCAGGGGCACAGAGCGG + Exonic
1102556422 12:113729687-113729709 GAGGCTGCAGGCACATGGAGGGG - Intergenic
1103494632 12:121352170-121352192 GCGCCGTCAGCCTCATGGAGCGG - Exonic
1106468502 13:30033964-30033986 GGGCCTTCAAGAGGAAGGAGAGG + Intergenic
1112577102 13:100645524-100645546 GGGCAGTCAGGGACATGGAGAGG - Intronic
1112577113 13:100645571-100645593 GGGCAGTCAGGGACATGGAGAGG - Intronic
1113843243 13:113371797-113371819 GGGGCCTCAGGAGGATGGAGGGG - Intergenic
1113901769 13:113801796-113801818 GGGCCTTCAAGGACATGGTGAGG + Exonic
1119436960 14:74603796-74603818 GGGCCTGGAGGAACATGGAGAGG + Intronic
1124049313 15:26180248-26180270 GGATCTGCAAGCGCATGGAGTGG + Intergenic
1125406164 15:39354263-39354285 GGGCCTGCAGAAACATGGAGGGG + Intergenic
1125968018 15:43889794-43889816 GGGCCTCCAGTGACATGGAGAGG - Intronic
1127073732 15:55306796-55306818 GGTCCTACAGTGGCATGGAGAGG + Intronic
1128278021 15:66370488-66370510 GGGCCAGCAGGGGCATGGGGCGG + Intronic
1131019915 15:89088866-89088888 GGGTCTTCAGGGGCCTGGGGAGG + Intronic
1132318633 15:100909038-100909060 GGGTTTGCACGCGCATGGAGGGG - Intronic
1132512880 16:352826-352848 GGGGCTTCAGGCGCGGGGCGGGG + Intergenic
1132597488 16:760053-760075 GGGGTTTCAGGGGCAGGGAGGGG + Intronic
1132810532 16:1794661-1794683 GGGCCTGCAGGGACCTGGAGGGG - Intronic
1133424507 16:5676079-5676101 GGGCCTGCTGGGGCATTGAGGGG + Intergenic
1134071683 16:11264060-11264082 GAGCCTTCATGCACATGTAGGGG + Intronic
1134100581 16:11448919-11448941 CGGCCTACAGGCACCTGGAGTGG - Exonic
1134241205 16:12508323-12508345 TGGCCTTCAGAAGCATGGACCGG + Intronic
1135549587 16:23387910-23387932 GTGCGTTCAGGCCCAGGGAGTGG - Intergenic
1135864651 16:26090237-26090259 GGGACTGCAGGCAGATGGAGTGG - Intronic
1136394106 16:29983554-29983576 GGGGCTGCAGGCGGCTGGAGAGG - Exonic
1139557027 16:67718993-67719015 CTGCCTGCAGGCGCGTGGAGTGG - Intronic
1141464217 16:84195851-84195873 GGGCCTGCAGGCGCATGGGTGGG - Exonic
1142127978 16:88419610-88419632 TGGGCTTCAGGGGCAGGGAGTGG - Intergenic
1145244396 17:21258719-21258741 GGTCCTGCAGGCGGATTGAGGGG + Intergenic
1145958726 17:28873012-28873034 GGGCCTTCAGGCCTAGGGACTGG + Intergenic
1146449488 17:32961163-32961185 GAGCCTACTGGGGCATGGAGAGG - Intergenic
1146639147 17:34527066-34527088 GGGCATTCTGGGGCATGGAGAGG - Intergenic
1146930275 17:36771955-36771977 GGGCCTTGAGGCCCAGGGCGGGG + Intergenic
1147218035 17:38912296-38912318 GGGCCTTACGCCGCATGGAGCGG + Intronic
1148764367 17:50028655-50028677 GGGCCAGGAGGCACATGGAGGGG - Intergenic
1149308239 17:55369896-55369918 TGCCCTTCAGGTCCATGGAGGGG - Intergenic
1150180637 17:63116474-63116496 AGGCCTTTAGAAGCATGGAGTGG + Intronic
1151546823 17:74798469-74798491 GGGTCGTCAGGCACAAGGAGTGG - Intronic
1151980474 17:77505453-77505475 CTGCCTTCAGGCCCATGGATGGG + Intergenic
1152906197 17:82972080-82972102 GGTCCTTCTGGCCCATGGTGTGG - Intronic
1152906225 17:82972192-82972214 GGTCCTTCTGGCCCATGGTGTGG - Intronic
1152906301 17:82972502-82972524 GGTCCTTCTGGCCCATGGTGTGG - Intronic
1152906329 17:82972614-82972636 GGTCCTTCTGGCCCATGGTGTGG - Intronic
1155868187 18:30992596-30992618 AGGCCTTCAAGGGCAAGGAGAGG - Exonic
1157524123 18:48365910-48365932 GGGCCTGCAGGTTCATGGAGGGG + Intronic
1158591080 18:58779415-58779437 GGGCTTTCAGGGCCTTGGAGAGG - Intergenic
1159638984 18:70841113-70841135 AGGATTTCAGGAGCATGGAGTGG - Intergenic
1159746357 18:72240884-72240906 GGGCCTGTAGGCGGGTGGAGTGG + Intergenic
1159795736 18:72841085-72841107 TGGTCTTCAGGGGAATGGAGAGG + Intronic
1161194324 19:2977679-2977701 GGGGCTGCAGGGGCGTGGAGGGG + Intronic
1161605866 19:5214615-5214637 GGGACTTCTGGCGTATGGTGTGG - Exonic
1162062279 19:8103469-8103491 GAGCCTTCAAGCCTATGGAGAGG - Intronic
1162768302 19:12933549-12933571 GAGCCTTCAGGCGCTGGGCGAGG - Exonic
1162829454 19:13275423-13275445 GGGCCTTCAGGCATAGGGAGGGG + Intronic
1163378213 19:16947270-16947292 GGGCCTCCAGGCACTGGGAGGGG - Intronic
1165135564 19:33666248-33666270 GGGCTTCCACGGGCATGGAGGGG - Intronic
1166111943 19:40627873-40627895 GGGCCAGCATGCGCAGGGAGAGG + Intronic
1167443577 19:49524511-49524533 GGGCCTTCAGGCGCATGGAGGGG - Exonic
1167666703 19:50826584-50826606 GGGCCATCAGGCGGAAGAAGAGG - Intronic
926056298 2:9775998-9776020 GGGCCTGCAGGGGGTTGGAGGGG + Intergenic
926058377 2:9789914-9789936 GGGCCTTCAGGAACAAGGACAGG - Intergenic
926107217 2:10160000-10160022 GGGCCTGGAGGGGCAGGGAGAGG - Intronic
928364838 2:30692483-30692505 TGGTCTTCAGGCACATGGAGAGG + Intergenic
929599825 2:43198145-43198167 TGGCCTTCAGGGGCACTGAGTGG - Intergenic
930024567 2:47022223-47022245 GGGCCTTGAGGCCCATGAAGAGG - Intronic
931706627 2:64951716-64951738 GGACCTTAAGGCCCATGGGGAGG + Intergenic
934579525 2:95427319-95427341 GGGCCTCCAGGCGCCAGGAGAGG - Intergenic
934599919 2:95649406-95649428 GGGCCTCCAGGCGCCAGGAGAGG + Intergenic
934943435 2:98519065-98519087 GGTCCTTCAGGCACAGGGTGTGG + Intronic
942044555 2:172092312-172092334 TGGCTTTCAGGAGCCTGGAGGGG + Intergenic
948705999 2:239792801-239792823 GGGCCCTCAGGGACAGGGAGGGG + Intronic
948912468 2:241011310-241011332 GGGTCTCCTGGCACATGGAGTGG + Intronic
1170534517 20:17326834-17326856 GGGACTGGAGGTGCATGGAGAGG + Intronic
1171794446 20:29555718-29555740 GGGGCTTCAGAGACATGGAGTGG + Intergenic
1172271096 20:33656322-33656344 GGGCGTTCAGGAACATGGAAAGG + Intergenic
1175263044 20:57686685-57686707 GGGCCTTGAGGCCCAGAGAGGGG - Intronic
1175914230 20:62418355-62418377 GGGGCTTCAGGGGGATGAAGTGG + Intronic
1176168125 20:63685212-63685234 GGGCCCTCAGGGGCACAGAGAGG + Intronic
1176622214 21:9067987-9068009 GGGCCTGGAGGTGCAGGGAGAGG + Intergenic
1180933228 22:19607460-19607482 GTGCCTCCAGGAGCAGGGAGAGG + Intergenic
1184669669 22:46006163-46006185 GGGGCTTCAGGCTCTAGGAGGGG - Intergenic
1184843712 22:47067839-47067861 AGGCCTTCAGGCACCTGAAGAGG - Intronic
1184851674 22:47124741-47124763 GGGCCTTCAGGAGCAGTGAGGGG + Intronic
1184925042 22:47630789-47630811 GGGCCTTGGGACACATGGAGGGG + Intergenic
1185077363 22:48690547-48690569 GGGCCTGCAGGAGGATGCAGGGG - Intronic
1185411338 22:50684542-50684564 AGGCCTTGAGGAGCAGGGAGGGG - Intergenic
950116354 3:10452631-10452653 GGTCCTTCAGGCCAATGCAGTGG + Intronic
950494179 3:13323950-13323972 GGGCCTTCAGCTGCAGGAAGTGG - Intronic
950503282 3:13377673-13377695 GGGCCTGCAGGTGGGTGGAGTGG - Intronic
950503305 3:13377739-13377761 GGGCCTGCAGGTGGGTGGAGTGG - Intronic
950503320 3:13377783-13377805 GGGCCTGCAGGTGGGTGGAGTGG - Intronic
953877505 3:46674717-46674739 GGACCTCCAGGTGCATGGATTGG - Exonic
954634531 3:52064465-52064487 GGACCTTCAGGTCCATGAAGAGG - Intergenic
956745454 3:72307411-72307433 GGGCCTTCAGGGGCTGAGAGAGG + Intergenic
961781941 3:129325534-129325556 GGGCCTACAGGTGGGTGGAGTGG - Intergenic
968494241 4:906725-906747 TGGCCTTCAGGGGTGTGGAGTGG - Intronic
969478448 4:7434335-7434357 GCTCCTTCAGGCGCCTGGCGGGG + Exonic
982137257 4:152283426-152283448 GGGCCTGCAGGTGCAGGGGGAGG - Intergenic
990043472 5:51399516-51399538 GCGCCCTCAGGCCCCTGGAGAGG + Intergenic
992230314 5:74657211-74657233 GGGCCTTGTGGCTCATGGAAAGG - Intronic
992813063 5:80408353-80408375 GGCCCTTCAGGCTCCAGGAGGGG - Intronic
995304710 5:110631521-110631543 GGGCCTGCAGAGGTATGGAGAGG - Intronic
998103608 5:139454718-139454740 GGACCCTCCGGCTCATGGAGTGG + Intronic
1001143089 5:169161488-169161510 AGGCCTTCAGGCTGAAGGAGTGG - Intronic
1002526244 5:179817411-179817433 GGGCCCTCAGGGGCACTGAGGGG - Intronic
1005386255 6:25288061-25288083 GGGGCTTCAGGAGCACGGAGAGG + Intronic
1006870634 6:37247923-37247945 GAGCCTTCAGGCACATGAAGAGG + Intronic
1009279528 6:61729325-61729347 TGGCCTTCAGGAGGAGGGAGAGG + Intronic
1011492476 6:87906622-87906644 GGGGCTGCAGGCACAGGGAGAGG + Intergenic
1013193031 6:107820085-107820107 CTGCCTTCAGGCGGATGGGGTGG - Intronic
1019499797 7:1359137-1359159 GTGCCTGCAGGCTCAGGGAGGGG - Intergenic
1019928841 7:4210263-4210285 GAGCCTTCTGGCGCCTGAAGTGG + Intronic
1020182104 7:5930679-5930701 GGGCCTTCAGTGGCCTGGGGAGG + Intronic
1020300830 7:6794257-6794279 GGGCCTTCAGTGGCCTGGGGAGG - Intronic
1023304221 7:38806916-38806938 GGTCCTTCATGGTCATGGAGTGG - Intronic
1024043668 7:45573880-45573902 GGTCCCTCATGCGCATGGAAGGG + Intergenic
1024966586 7:55027323-55027345 GGGCCTCCAGGCACAGGGACAGG + Intronic
1032429527 7:131849541-131849563 GGGTGTTCAGGCTCAAGGAGGGG + Intergenic
1038680097 8:29658792-29658814 TGCCCTTCAGGTTCATGGAGGGG - Intergenic
1039717052 8:40120807-40120829 GGGCCTTCAGGCGGGGGGAGGGG + Intergenic
1040111211 8:43567919-43567941 AGGCCTTCAGGAGGATGTAGAGG - Intergenic
1040725261 8:50375257-50375279 TGGCCTTCAGGCACATGGTTGGG + Intronic
1043997537 8:86836919-86836941 GGTCCTTCAGGACCATGGAGAGG - Intergenic
1046657141 8:116907062-116907084 GGGCTTTCACAGGCATGGAGAGG + Intergenic
1048871428 8:138802696-138802718 AGGCCTCCATGCCCATGGAGAGG + Intronic
1052758529 9:32566569-32566591 GGAGCTTCTGGCACATGGAGCGG + Intronic
1053791826 9:41691954-41691976 GGGGCTTCAGAGACATGGAGTGG - Intergenic
1054153327 9:61622811-61622833 GGGGCTTCAGAGACATGGAGTGG + Intergenic
1054180231 9:61903973-61903995 GGGGCTTCAGAGACATGGAGTGG - Intergenic
1054473124 9:65554015-65554037 GGGGCTTCAGAGACATGGAGTGG + Intergenic
1054657361 9:67677169-67677191 GGGGCTTCAGAGACATGGAGTGG + Intergenic
1061838830 9:133346179-133346201 GGGCCTCCAGGCAGGTGGAGCGG - Intronic
1062239018 9:135526075-135526097 GGGCTCTCAGGGGCATGGTGTGG - Intronic
1188002601 X:24996205-24996227 GGGTCTTCAGGAGCTTGGGGAGG - Exonic
1188615493 X:32153834-32153856 GGGCTTTCAGGAAGATGGAGTGG - Intronic
1189377136 X:40474879-40474901 GGGCCTACAGGGGCAGGAAGAGG + Intergenic
1190119078 X:47645639-47645661 GGGCCTTCAGGCGGAGCGAACGG + Intronic
1192194430 X:69018928-69018950 GGCAATTCAGGGGCATGGAGAGG - Intergenic
1193035249 X:76943155-76943177 GGGCCTACCTGAGCATGGAGGGG - Intergenic
1195591644 X:106635066-106635088 GGGGCTTCAGGCCCAAGAAGGGG + Intronic
1199643545 X:149884314-149884336 AGGCCTTCAGGCCCAAGGAGAGG + Exonic
1199948060 X:152683068-152683090 AGGCCTTGAGGCCCAAGGAGAGG + Intergenic
1199955160 X:152736203-152736225 AGGCCTTGAGGCCCAAGGAGAGG + Exonic
1199961619 X:152785386-152785408 AGGCCTTGAGGCCCAAGGAGAGG - Intergenic
1201259296 Y:12142666-12142688 GGGCCTGTTGGGGCATGGAGGGG + Intergenic