ID: 1167443759

View in Genome Browser
Species Human (GRCh38)
Location 19:49525462-49525484
Sequence ACGAGCACGGAGGACTTGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 63}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167443759_1167443767 12 Left 1167443759 19:49525462-49525484 CCAGCCAAGTCCTCCGTGCTCGT 0: 1
1: 0
2: 0
3: 8
4: 63
Right 1167443767 19:49525497-49525519 CATCGGTGTCTTGCTACTCACGG 0: 1
1: 0
2: 0
3: 2
4: 56
1167443759_1167443766 -5 Left 1167443759 19:49525462-49525484 CCAGCCAAGTCCTCCGTGCTCGT 0: 1
1: 0
2: 0
3: 8
4: 63
Right 1167443766 19:49525480-49525502 CTCGTGGTGGGAATCGTCATCGG 0: 1
1: 0
2: 0
3: 3
4: 38
1167443759_1167443770 28 Left 1167443759 19:49525462-49525484 CCAGCCAAGTCCTCCGTGCTCGT 0: 1
1: 0
2: 0
3: 8
4: 63
Right 1167443770 19:49525513-49525535 CTCACGGCAGCGGCTGTAGGAGG 0: 1
1: 0
2: 0
3: 3
4: 92
1167443759_1167443769 25 Left 1167443759 19:49525462-49525484 CCAGCCAAGTCCTCCGTGCTCGT 0: 1
1: 0
2: 0
3: 8
4: 63
Right 1167443769 19:49525510-49525532 CTACTCACGGCAGCGGCTGTAGG 0: 1
1: 0
2: 0
3: 3
4: 62
1167443759_1167443768 18 Left 1167443759 19:49525462-49525484 CCAGCCAAGTCCTCCGTGCTCGT 0: 1
1: 0
2: 0
3: 8
4: 63
Right 1167443768 19:49525503-49525525 TGTCTTGCTACTCACGGCAGCGG 0: 1
1: 0
2: 1
3: 1
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167443759 Original CRISPR ACGAGCACGGAGGACTTGGC TGG (reversed) Exonic
900331404 1:2136506-2136528 AGGAGCACCGAGGATGTGGCAGG + Intronic
900922936 1:5685155-5685177 GGGAGCAGGGAGCACTTGGCAGG + Intergenic
901157746 1:7151704-7151726 TCGAGGACGGAGGACATGGCAGG + Intronic
907491810 1:54813426-54813448 AGGAGCACAGAGGATTTGGACGG - Intronic
907714867 1:56917187-56917209 GTGAGCACAGAGGTCTTGGCTGG + Intronic
912443699 1:109717368-109717390 AAGACCTCGGAGGAATTGGCTGG - Exonic
1065046896 10:21753395-21753417 AGGCCCACGGAGGACGTGGCGGG + Intergenic
1070189980 10:74103162-74103184 AAGAGCACAGAGGAGTCGGCCGG - Intronic
1074762122 10:116675019-116675041 ACCAGCTGGGAGGGCTTGGCCGG + Exonic
1076675892 10:132147583-132147605 AGGAGCACGGGGGCCTTAGCGGG - Intronic
1090203032 11:124869441-124869463 ATCATCACGGAGGACTGGGCGGG - Exonic
1096814358 12:54192405-54192427 ACAAGCACGGAGGACAAGACTGG + Intergenic
1102028186 12:109725392-109725414 AAGAGCAAGCAGGACTTGGCTGG - Intronic
1105213387 13:18271035-18271057 ACAAGCAGGGAGGATTTGGGAGG - Intergenic
1108340818 13:49496522-49496544 ACGTTCACGGAGGACGTGACTGG + Intronic
1121994449 14:98591382-98591404 AGCACCGCGGAGGACTTGGCAGG + Intergenic
1122470861 14:101965002-101965024 GCGACCCCGGAGGACCTGGCAGG - Intronic
1124484635 15:30103728-30103750 AGGGGCACCGAGGACTTGGCGGG - Intergenic
1124518946 15:30393510-30393532 AGGGGCACCGAGGACTTGGCGGG + Exonic
1124539710 15:30572736-30572758 AGGGGCACCGAGGACTTGGCGGG - Intergenic
1124758942 15:32434846-32434868 AGGGGCACCGAGGACTTGGCGGG + Intergenic
1124973782 15:34514923-34514945 AAGGGCACGGAGGCCTTGGCGGG + Intergenic
1128149741 15:65355511-65355533 GCGAGCCCGGAGGACGCGGCGGG + Intronic
1132021768 15:98368627-98368649 ACGAGCACAGAGAATTTTGCAGG - Intergenic
1143538164 17:7554043-7554065 AGGAGCACGGAGGGCTTGCCTGG - Intronic
1145988425 17:29062972-29062994 ATGAACACGGAAGAGTTGGCCGG + Intergenic
1151378773 17:73710408-73710430 ACGGCCAGGGAGGCCTTGGCGGG + Intergenic
1157271724 18:46281386-46281408 AGGAGAACGGAGGACTTGCTTGG + Intergenic
1157620980 18:49017404-49017426 ATGAGCACTGAGGTCATGGCTGG - Intergenic
1161160242 19:2757652-2757674 AAGAGGACGGAGGACGTGGGCGG - Intronic
1163509474 19:17726516-17726538 AAGAGCACGGTGGGTTTGGCTGG - Exonic
1166217223 19:41343602-41343624 ACCAGCAGGGAGGACAAGGCTGG - Intronic
1167443759 19:49525462-49525484 ACGAGCACGGAGGACTTGGCTGG - Exonic
926249216 2:11144110-11144132 AGGAGCAAGGAGGGCTGGGCTGG + Exonic
927930128 2:27038536-27038558 AGGAGCTGGGAGGACGTGGCAGG + Intronic
934728213 2:96638554-96638576 GCGAGGGCGGAGGACTAGGCTGG + Intronic
935617765 2:105103314-105103336 ATCAGCACGGAGGATTGGGCAGG + Intergenic
937853091 2:126653218-126653240 ACTAGCACTGAGGATTTGGAAGG + Intergenic
1168853506 20:992942-992964 ATGAGCACTGGGGGCTTGGCAGG - Intronic
1169478176 20:5950846-5950868 AAGAGAACTGCGGACTTGGCAGG + Exonic
1169533844 20:6515249-6515271 ACTAGTACTGTGGACTTGGCAGG + Intergenic
1171346785 20:24471168-24471190 CCTAGCACGGAGAAGTTGGCCGG - Intronic
1173723543 20:45280639-45280661 AGGAGCAGGGAGGAAATGGCAGG - Intergenic
1181636455 22:24176947-24176969 ACGAGCTGGGAGGACCCGGCTGG - Intronic
1183214170 22:36468323-36468345 ACTAGCAAGGGGGCCTTGGCCGG + Intronic
1184677974 22:46053848-46053870 CGGAGCACGGAGGACGGGGCCGG + Exonic
1184787980 22:46680954-46680976 CCCAGCACCAAGGACTTGGCTGG - Intergenic
950468810 3:13172190-13172212 CTGTGCCCGGAGGACTTGGCTGG - Intergenic
955356391 3:58236495-58236517 ACCAGCGTGGAGGCCTTGGCAGG + Intergenic
957277206 3:78106036-78106058 GTGATCCCGGAGGACTTGGCCGG - Intergenic
964324935 3:155535311-155535333 AGGAGCACAGAGGCCATGGCAGG + Intronic
969658907 4:8514925-8514947 ACGTGCACTGGGCACTTGGCGGG + Intergenic
969860598 4:10032665-10032687 GTGTGCATGGAGGACTTGGCAGG - Intronic
970411732 4:15815099-15815121 AAGAGAACGGAGACCTTGGCCGG - Intronic
971299868 4:25433215-25433237 ACAAGCAGGGAGGAACTGGCTGG + Intergenic
978419334 4:108513310-108513332 ACAAGCAGGGAGGACTGGACCGG - Intergenic
996025241 5:118638419-118638441 ACTAGCACAGAAGCCTTGGCAGG + Intergenic
1017919465 6:158858575-158858597 ACCAGCACGGAGGACATGATTGG + Intergenic
1019742655 7:2682487-2682509 ACGGGCACGGAGCCCATGGCAGG + Intronic
1030300539 7:107970024-107970046 CCCAGCACGGTGGACCTGGCAGG - Intronic
1030380899 7:108810866-108810888 ATGATCACGGAAGGCTTGGCTGG + Intergenic
1032686089 7:134235208-134235230 AAGATCATGGAGGACTTTGCAGG - Intronic
1034383658 7:150720458-150720480 ACCAGGAAGGAGGACCTGGCCGG + Exonic
1039839145 8:41281133-41281155 ACGAGGTAGGAGCACTTGGCAGG - Intronic
1045041529 8:98228827-98228849 ATGAGCAGGAAGGAATTGGCTGG + Intronic
1046901810 8:119531644-119531666 AGGAGCATGGGGAACTTGGCTGG - Intergenic
1049377151 8:142294683-142294705 AGGAGCTCGGAGGGCCTGGCTGG + Intronic
1060108784 9:120891746-120891768 ACAAGCACGGAAGACTGGGTGGG - Intronic
1061594853 9:131622125-131622147 CGGAGCACGGAGGACTTTTCGGG + Intronic
1062149611 9:135010935-135010957 AGGAGCATGGAGGAGGTGGCTGG - Intergenic
1062628464 9:137453423-137453445 AGGCGCCCGGCGGACTTGGCTGG - Intronic
1197800525 X:130342993-130343015 AGGAACAGGGAGGACATGGCAGG - Intronic