ID: 1167444272

View in Genome Browser
Species Human (GRCh38)
Location 19:49528223-49528245
Sequence GGGGGGTCCCAGACCTGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 244}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167444272_1167444281 13 Left 1167444272 19:49528223-49528245 CCCTGGCAGGTCTGGGACCCCCC 0: 1
1: 0
2: 3
3: 25
4: 244
Right 1167444281 19:49528259-49528281 GAAGATTCGGTCCTCCCCATAGG 0: 1
1: 0
2: 0
3: 3
4: 47
1167444272_1167444279 0 Left 1167444272 19:49528223-49528245 CCCTGGCAGGTCTGGGACCCCCC 0: 1
1: 0
2: 3
3: 25
4: 244
Right 1167444279 19:49528246-49528268 TGAGACTCCGTCAGAAGATTCGG 0: 1
1: 0
2: 0
3: 5
4: 68
1167444272_1167444282 16 Left 1167444272 19:49528223-49528245 CCCTGGCAGGTCTGGGACCCCCC 0: 1
1: 0
2: 3
3: 25
4: 244
Right 1167444282 19:49528262-49528284 GATTCGGTCCTCCCCATAGGTGG 0: 1
1: 0
2: 0
3: 4
4: 26

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167444272 Original CRISPR GGGGGGTCCCAGACCTGCCA GGG (reversed) Intronic
900129810 1:1082614-1082636 GGGGGGGCCCGGACCCCCCAAGG + Exonic
900319535 1:2075757-2075779 TGGGTGCCCCAGACCTTCCACGG + Intronic
900376590 1:2357528-2357550 GCCGGGGCCCAGAGCTGCCAAGG - Exonic
900411586 1:2514970-2514992 GAGGAGTCCCAGCCCTGCCCAGG - Intronic
900457943 1:2786404-2786426 TGGGGGTCCCACAGCGGCCAGGG + Intronic
900540781 1:3201650-3201672 CTGGGGTCCCCGACCTGCCAGGG - Intronic
900545500 1:3226772-3226794 GCGGGGACCCAGTCCTGCGAAGG - Intronic
900603167 1:3511827-3511849 AGGGGGTCCCAGACCCAACAAGG - Intronic
901208155 1:7509045-7509067 GGGGGGACCCACAGCAGCCAGGG - Intronic
901436802 1:9251513-9251535 GGAGGGTCCCTGTCCTGACATGG + Intronic
901703683 1:11058922-11058944 GGGGGCTCCCAGTCCTGCCAGGG - Intronic
901940443 1:12657749-12657771 TGGGTGTCCCAGAACTGCCATGG + Intronic
902394312 1:16124287-16124309 GTGGGGTCCCAGAGCTTCCTGGG - Intergenic
902627035 1:17682829-17682851 TGGGCCTCCCAGACCAGCCAAGG + Intronic
903127400 1:21257366-21257388 GGGGTGTCCCTCCCCTGCCAGGG + Intronic
903277054 1:22228987-22229009 GGGGGGTCACAAAGCTCCCATGG - Intergenic
903569288 1:24292492-24292514 GTGAGGTCCCTGTCCTGCCAGGG - Intergenic
903741918 1:25563212-25563234 GGGGGGTCCCACTCCTGCCTGGG + Intronic
904134147 1:28298100-28298122 GGGTGGTCACAGATCTGGCAGGG + Intergenic
904607673 1:31706813-31706835 GGGGGCTCCCGGACCTGTCCTGG - Intergenic
904664328 1:32108349-32108371 GGGGGGCTCCAGGCGTGCCAAGG - Intronic
905168730 1:36098211-36098233 AGGGGGAACCAGGCCTGCCAGGG - Exonic
905827766 1:41039400-41039422 GGGGGGTCCTAGTCCTGACAAGG + Intronic
906191765 1:43903556-43903578 GGGTGGTCCCAGCCCTGCAGGGG + Intronic
906286828 1:44593007-44593029 GGATGGGCCCAGAGCTGCCATGG + Intronic
906481912 1:46204592-46204614 GGGGGCTCTGAGACCAGCCAGGG + Intronic
910641802 1:89472238-89472260 TTGGGGTTCAAGACCTGCCAAGG + Intergenic
912416142 1:109509445-109509467 CGGAGCTCCCAGACCGGCCATGG - Exonic
914358355 1:146908298-146908320 GGGAGGTCCCAGACCACCCTGGG + Intergenic
914495070 1:148188709-148188731 GGGAGGTCCCAGACCACCCTGGG - Intergenic
920172267 1:204079553-204079575 CGGGGGTTCGAGACCAGCCATGG - Intronic
922797961 1:228350943-228350965 GGTGGGGCCCAGGCCTGCCCGGG + Exonic
1064125681 10:12658332-12658354 GGGGTGTGCGAGACCTGCCGGGG + Intronic
1065390539 10:25176589-25176611 GGGGTGTCTCCGTCCTGCCAAGG - Intronic
1065474002 10:26114175-26114197 GGATGGTGCCAGATCTGCCAGGG + Intronic
1070664596 10:78334128-78334150 GGAGGTCCCCAGACCTGCCCTGG + Intergenic
1072231514 10:93417789-93417811 GGAGGATCCCAGTCCAGCCAGGG - Intronic
1072466646 10:95669568-95669590 GGGGTGTCTCAGACCTTCCATGG + Intronic
1072635554 10:97175691-97175713 GGTAGGTCCCAGACCTGGGAAGG - Intronic
1075783228 10:125030851-125030873 GGGGGGTCCTGCACCTGCCTGGG + Intronic
1076247943 10:128962143-128962165 GGGCAGCCCCAGACCTCCCAAGG + Intergenic
1076713947 10:132353913-132353935 GGTGGGTCCCACTCCTGCCTCGG + Intronic
1077109814 11:857235-857257 GGGGTTTCCCACACCTGGCATGG + Intronic
1077181815 11:1220300-1220322 TGAGGGTCCCAGCTCTGCCATGG + Intergenic
1077182286 11:1222217-1222239 GGGGGGTCCTGGACCTGCCCGGG - Intergenic
1077406993 11:2387124-2387146 GGGTGGTCCCTGCCCAGCCAGGG + Intronic
1080757353 11:35214878-35214900 GGGGGGTCCCATACCACTCATGG + Exonic
1081544394 11:44059764-44059786 GGTGGGTCCCAGACATACCCAGG - Intronic
1082997061 11:59263075-59263097 GGTGGCTCCCAGCCCTGCCAGGG + Intergenic
1083170084 11:60918692-60918714 GGGAGCTCCCAGTCCAGCCAAGG - Intronic
1083179733 11:60977411-60977433 TGGGGATCCCAGCCCTACCAGGG - Intronic
1083332832 11:61906956-61906978 GGGCGGTCCCAGAACTCTCATGG - Intronic
1083419548 11:62545460-62545482 GGGGGCGACCAGCCCTGCCAGGG + Intronic
1083441366 11:62678808-62678830 GGGGGGTCGCGGACCTGTCTCGG - Intronic
1083645137 11:64167765-64167787 CGAGGATCCCTGACCTGCCATGG + Intergenic
1083758020 11:64801818-64801840 GGGGGGCCCCAGTCCTGAGAGGG - Intronic
1084523901 11:69684217-69684239 CCGGGGACCCAGCCCTGCCATGG + Intergenic
1084890761 11:72235837-72235859 TGCGGCTCCCTGACCTGCCAGGG - Exonic
1084938031 11:72597556-72597578 TGGGCTTCTCAGACCTGCCAGGG - Exonic
1085023962 11:73225870-73225892 GGTGGGTACCAGATCAGCCAGGG + Intronic
1087073373 11:94104263-94104285 GAGGGCTCACAGACCTGCAAGGG + Intronic
1089298591 11:117484228-117484250 GGGGAGCCACAGAGCTGCCACGG + Intronic
1089314624 11:117583163-117583185 AGAGGGTCCCAGACCTGTCCAGG - Intronic
1089493504 11:118897524-118897546 TGGGGGTCTCAGCCCTGCTAGGG + Exonic
1089622572 11:119730031-119730053 GGAGAGTCCCTGCCCTGCCAGGG - Intergenic
1090399944 11:126442741-126442763 GGAGCGCACCAGACCTGCCAGGG - Intronic
1094828188 12:34287955-34287977 GGGGGGTCTGAGTCCTCCCACGG + Intergenic
1095746637 12:45666730-45666752 GGGGGTTTCCAGAACTGTCATGG + Intergenic
1100614364 12:96219676-96219698 GGTGGGTCCCAGAGCTGCCTGGG + Intronic
1103998803 12:124847283-124847305 GGCTGTTCCCAGAGCTGCCAAGG + Intronic
1105642764 13:22283120-22283142 GGAGGATCCCAGACCAGCCTGGG - Intergenic
1105738186 13:23294043-23294065 AGAGGGTCCCCGACTTGCCATGG - Intronic
1106556231 13:30810668-30810690 GGCAGGCCCCAGACATGCCATGG - Intergenic
1107064814 13:36201676-36201698 CGGGAGTTCCAGACCTGCCTGGG - Intronic
1107917807 13:45170234-45170256 GGGGGGTCTGAGACCAGCCTGGG - Intronic
1112698062 13:101972715-101972737 GGGGAGTTCGAGACCTGCCTGGG - Intronic
1113487093 13:110662268-110662290 GGGGGGTCGGAGCCCGGCCACGG - Intronic
1116974580 14:51101514-51101536 GGGGAGTCCCACACGTGCCCCGG + Intergenic
1119723077 14:76904536-76904558 GGAGCCTCCCACACCTGCCACGG - Intergenic
1122888039 14:104719256-104719278 GAGGGGACCCTGGCCTGCCATGG - Exonic
1122896517 14:104760245-104760267 GGCGGGTCCCAGCCCCTCCAGGG + Intronic
1123132553 14:106000040-106000062 GGGGGCACTCAGAACTGCCAGGG - Intergenic
1123582766 15:21731178-21731200 GGGGGCGCTCAGAACTGCCAGGG - Intergenic
1123619416 15:22173774-22173796 GGGGGCGCTCAGAACTGCCAGGG - Intergenic
1123758772 15:23416938-23416960 GAGGGGTCCCGGACCTGCTGTGG + Intergenic
1124322454 15:28725400-28725422 TGGGAGTTCCAGACCTGCCTGGG + Intronic
1128649121 15:69397635-69397657 GGGGGGTCACAGCACTGCAATGG + Intronic
1128963471 15:72033057-72033079 CAGGGGTTCCAGACCAGCCAGGG - Intronic
1129166453 15:73780944-73780966 AGAGGGTCCCAAGCCTGCCAAGG + Intergenic
1129188992 15:73926871-73926893 GCGGGGTCCGAGCCCTGCCCGGG - Exonic
1129597370 15:76975256-76975278 GGGGGGTCCTAGTGCTGCCCAGG - Intergenic
1129675787 15:77632029-77632051 CGGGTGTCCCAGACCTGCTCTGG - Intronic
1130104630 15:80920189-80920211 GGAGGGTTCCAGACTTGACAAGG - Exonic
1131371016 15:91881912-91881934 GAGGGGACCCAGACCTGGCCAGG - Intronic
1131542759 15:93288688-93288710 GGGGTTTCCCAGGCCTGCCTGGG + Intergenic
1132299048 15:100765271-100765293 GGGAGCTCTCAGGCCTGCCAGGG + Intergenic
1132630640 16:915642-915664 GGAGGGTCCCAGGCCAGCCTAGG + Intronic
1133927184 16:10202779-10202801 GGCCTGCCCCAGACCTGCCATGG + Intergenic
1134754531 16:16655144-16655166 GAGAGGTCCCTGTCCTGCCAAGG + Intergenic
1134991530 16:18703898-18703920 GAGAGGTCCCTGTCCTGCCAAGG - Intergenic
1136081769 16:27856909-27856931 GGGGATTCCCAGGCCTGTCAGGG - Intronic
1137001847 16:35235811-35235833 GCTGGGTCCTAGAGCTGCCAGGG - Intergenic
1141652127 16:85398321-85398343 GAGGGGTCGCAGAGCTCCCAGGG + Intergenic
1142153136 16:88521455-88521477 GGGGGGTCCCTGACCCACGATGG - Intronic
1142352987 16:89588328-89588350 GGGGGGACCCAGACCAGGCTTGG + Intronic
1142362830 16:89635424-89635446 TGGGGGTCCCAGGCCCCCCAAGG + Intronic
1143373637 17:6455151-6455173 GGGGGCTCCCTGAGCTGCGACGG - Exonic
1143764687 17:9129823-9129845 TGGTGGTCCCAGACCTGGCAAGG + Intronic
1144576679 17:16434029-16434051 GGGGGGACACAGAGCAGCCAGGG - Intronic
1146321507 17:31850377-31850399 AGTGGATCCCAGACCTGCCAAGG + Intergenic
1147403398 17:40194194-40194216 TGGGGGTCCCAGCCCTGACCAGG - Exonic
1148201345 17:45752048-45752070 GAGGGCTCCAAGGCCTGCCATGG + Intergenic
1148811460 17:50295089-50295111 AGGATGTCCCAGACATGCCATGG - Intergenic
1150596471 17:66610277-66610299 GGAGGGGCCCAGAGCTTCCATGG + Intronic
1152947090 17:83203785-83203807 GTGGGGTCCCAGCCCTGCAAGGG - Intergenic
1157596841 18:48869417-48869439 CGGGGCTCCCACAGCTGCCAGGG + Intergenic
1157614804 18:48979961-48979983 GGGGGCTCCCACAGCTGCCAGGG - Intergenic
1157616648 18:48991313-48991335 GGAGGGTCCCAGGCTTGGCAGGG - Intergenic
1159011668 18:63063923-63063945 TGGGGGTTCCAGACCAGCCTGGG - Intergenic
1159045837 18:63367571-63367593 GCGGGTTTCCAGGCCTGCCACGG + Intergenic
1159511439 18:69401460-69401482 GTGGGGGCCCACACCTGCCGGGG + Intronic
1160318773 18:77871059-77871081 GGGGGCTCCCAGTGCTCCCATGG - Intergenic
1161346450 19:3770873-3770895 GGGGAGTCTCGGAGCTGCCACGG + Exonic
1161567643 19:5012496-5012518 GAGGGATCCCAGGACTGCCACGG - Intronic
1161800673 19:6415492-6415514 GGGGGGCTCCAGCCCTGCCGGGG - Intronic
1162332579 19:10039224-10039246 TCGGGCTCCCAGACCTGACAAGG - Intergenic
1162791216 19:13064058-13064080 GGGGGGTCCCATCCCAGCAAGGG - Intronic
1162953461 19:14085489-14085511 ATGGGTTCCCAGGCCTGCCAGGG + Exonic
1163298553 19:16428748-16428770 CTGAGGTCCCAGACCTGCAAGGG + Exonic
1163414988 19:17180967-17180989 CGGGGGTCCTCGCCCTGCCAGGG - Exonic
1163439026 19:17312286-17312308 GGGAGGTACCAGTCCAGCCAGGG + Intronic
1163667555 19:18610428-18610450 GGGGAGTTGCAGACCTGCCTAGG + Intronic
1166676106 19:44742072-44742094 AGGAGCTCCCAGAGCTGCCAAGG + Intergenic
1166985798 19:46659583-46659605 GGGGGGTCCCACTCCTGAGAGGG + Intronic
1167444272 19:49528223-49528245 GGGGGGTCCCAGACCTGCCAGGG - Intronic
1167678894 19:50907055-50907077 GGGGGGCCCCTGATCTGCAACGG - Exonic
1168059326 19:53882493-53882515 GCCGGGGCCCAGACCAGCCATGG - Exonic
1168705634 19:58468792-58468814 GAGGGGTCCCAGACATGTGAGGG + Intronic
1202653139 1_KI270707v1_random:24610-24632 TGTGGATCCCACACCTGCCAAGG - Intergenic
925237175 2:2289996-2290018 TGGGGATCCCAGCCCTGCTATGG - Intronic
927199320 2:20568595-20568617 GGAGGCTCCCAGGCCTGCCATGG + Intronic
927896590 2:26786436-26786458 GGGCGGTGCCAGCCCTGCGAGGG + Intronic
931198801 2:60077362-60077384 GGAGGGTCCCAGACAGGCCAGGG + Intergenic
932614510 2:73223401-73223423 GGGGGGTCCCAGGCAGCCCATGG - Intronic
935647478 2:105351995-105352017 GGGAGGTTCCAGACATGCAAGGG - Intergenic
937529303 2:122808962-122808984 TGGGGGTCCTAGAACTCCCAAGG - Intergenic
937859500 2:126696828-126696850 GGCGGCTCCCAAGCCTGCCAAGG + Intergenic
937905221 2:127049771-127049793 GGAGGGTCCCAGACCTAGGAGGG + Intronic
938086409 2:128405021-128405043 CGGGGGCCCCTGACCAGCCAGGG - Intergenic
938180528 2:129178481-129178503 CCCGGGTCCCAGGCCTGCCAAGG + Intergenic
941020960 2:160407632-160407654 GGGAGTTCCCAGAGCTGCCGCGG - Intronic
944432167 2:199645157-199645179 GGGGACTCACAGAGCTGCCATGG + Intergenic
946256768 2:218448049-218448071 CAGGGGTTCCAGACCTGCCTGGG + Intronic
947612629 2:231533243-231533265 GTGGGGTCCCAGCCTGGCCATGG + Intergenic
947742157 2:232489590-232489612 GGGGGGTCCCAGAGCTGACCCGG - Intergenic
948061106 2:235043876-235043898 GGGGGGCCCCAGACAACCCAAGG + Intronic
948942854 2:241204688-241204710 GGGCCGTGCCAGAGCTGCCAGGG + Intronic
949028636 2:241777866-241777888 GGGGGGCCCCAGGGCAGCCAGGG - Intronic
1169781066 20:9311170-9311192 GGGAAGGCCCTGACCTGCCAGGG - Intronic
1171493796 20:25539944-25539966 GGGGGCTCCCAGGCCTGCGCAGG + Intronic
1174111681 20:48201823-48201845 GGGGGAGCCCAGAGCTGCCTGGG - Intergenic
1174169459 20:48607009-48607031 GGGGGAGCCCAGAGCTGCCTGGG + Intergenic
1174413819 20:50353725-50353747 GGGAGGTCCCAGACCAGGCAGGG + Intergenic
1175382085 20:58570330-58570352 GTGGGCTCACCGACCTGCCATGG + Intergenic
1175929977 20:62489303-62489325 GGGAGGAGCCAGGCCTGCCAGGG - Intergenic
1175999611 20:62826013-62826035 TGGGGGTCCCACCTCTGCCAAGG + Intronic
1176095811 20:63343859-63343881 CGGGGGTCACAGCCCTGGCAAGG + Intronic
1176599012 21:8775041-8775063 TGTGGATCCCACACCTGCCAAGG + Intergenic
1178294904 21:31401533-31401555 GGGTGGTCTCAGACTTGCCCAGG - Intronic
1179809695 21:43862940-43862962 CGGGGGTTCCAGACCAGCCATGG - Intergenic
1179960943 21:44766723-44766745 CGGGGGCACCAGACCTGCCTCGG + Intergenic
1180419419 22:12799860-12799882 TGTGGATCCCACACCTGCCAAGG - Intergenic
1180786416 22:18550154-18550176 GGGGGACCCCAGAACTGCCACGG + Intergenic
1181131696 22:20735873-20735895 GGGGGACCCCAGAACTGCCATGG + Intronic
1181150890 22:20882492-20882514 GGTGGGTTCCAGAGCTTCCATGG - Intronic
1181243337 22:21489707-21489729 GGGGGACCCCAGAACTGCCACGG + Intergenic
1181902336 22:26166992-26167014 GGGGGGTCCCAACCCAGCCAAGG - Intergenic
1182429278 22:30290558-30290580 GGGGGGTCTTAGACCTGTGAAGG - Intronic
1184949988 22:47834330-47834352 GGGGGGTCTCAGGCCTGATAGGG - Intergenic
1185162395 22:49237839-49237861 GGGGGGTCCCAGGGCCCCCACGG + Intergenic
1185375831 22:50482233-50482255 GGGTGGTCACAGGCCGGCCAGGG - Intronic
949145090 3:690614-690636 TGGGGGCCCCACATCTGCCATGG + Intergenic
958677954 3:97291948-97291970 CGTGGATCCCATACCTGCCAAGG + Intronic
961152571 3:124651844-124651866 TAGGAGTCCCAGACCAGCCAGGG - Intronic
961311531 3:126004906-126004928 CTGGGATCCCACACCTGCCAAGG - Intergenic
961442341 3:126960500-126960522 GGGGAGTCCCTGGCCTGGCAGGG + Intergenic
961518021 3:127450576-127450598 GGGGTGACCCAGGCCTGCCCAGG + Intergenic
961777883 3:129302802-129302824 GAGGAGTTCCAGACCTGCCTGGG + Intronic
965073860 3:163952673-163952695 CCAGGATCCCAGACCTGCCAAGG + Intergenic
966754786 3:183358831-183358853 GAGGGGTTCAAGACCTGCCTGGG - Intronic
968599797 4:1503570-1503592 GGGTGGTCCCCGCCCTGCCCGGG - Intergenic
968648929 4:1752842-1752864 GGGGGTTCCCAGAAATGCCGAGG - Intergenic
968704700 4:2072527-2072549 GGAGGTTCCCCCACCTGCCAGGG + Intronic
968829908 4:2927899-2927921 GGGGGGACCCAGGCCTGGGACGG + Intronic
969712256 4:8850945-8850967 GGGGGAGCCCAGTCCGGCCAAGG - Intronic
973362367 4:49177413-49177435 TGTGGATCCCACACCTGCCAAGG + Intergenic
973398732 4:49619448-49619470 TGTGGATCCCACACCTGCCAAGG - Intergenic
976635360 4:87281807-87281829 GGGTGTTCCCAGAACTGTCATGG - Intergenic
976831682 4:89322179-89322201 TGGGGGTTCCAGACCAGCCTGGG + Intergenic
977645793 4:99410268-99410290 TCTGGGTCCCACACCTGCCAAGG + Intergenic
977693056 4:99937515-99937537 AGGGAGTTCCAGACCTGCCTGGG + Intronic
982665092 4:158251674-158251696 GGGTGGTCCCAGAACTGTCATGG - Intronic
983784199 4:171711834-171711856 AGGGGGCCCCAGAGCTCCCATGG + Intergenic
984980557 4:185276783-185276805 GGTGGATCCTGGACCTGCCAGGG - Intronic
985569752 5:638567-638589 GGGGGGTCCCAGAGCTGGGTGGG + Intronic
985678086 5:1242595-1242617 GGAGGGGCCCAGCCCTCCCAGGG + Intronic
988488045 5:31683102-31683124 GGGGAGCCACAGAGCTGCCAAGG - Intronic
996530788 5:124524823-124524845 GGGCAGTGCCAGACCTGCAAAGG - Intergenic
997476062 5:134143224-134143246 GGAGGGTCCAAGGCCTCCCATGG + Intronic
998140042 5:139694601-139694623 GGAGGGTCCCAGAAATGGCAAGG - Intergenic
999171083 5:149595996-149596018 GGGGGGTCCCAGTTCTGTGAAGG + Intronic
999374237 5:151075849-151075871 GGGCAGTCCCATACCTGCCCTGG + Intronic
1001095184 5:168770488-168770510 ATGGGGTTCCAGACCTGCCTTGG - Intronic
1001553461 5:172620680-172620702 GGGGGCCCACAGCCCTGCCATGG - Intergenic
1001695929 5:173669737-173669759 GGGGGGCCTCAGACCTGTCTTGG - Intergenic
1002613002 5:180433580-180433602 GGGAGGCCCCACACCTGCCCAGG + Intergenic
1004722189 6:18277369-18277391 GAGGGGTCCGAGACGCGCCAAGG + Intergenic
1007265077 6:40589679-40589701 GGGGGTTCCCAGAGCTGGAAAGG - Intergenic
1015096081 6:129416766-129416788 GCTGGATCCCACACCTGCCAAGG + Intronic
1016923278 6:149317253-149317275 AGGGGGTCCCAGCCCTCCCCGGG + Intronic
1017048221 6:150366769-150366791 AGGAGGTCCCAGGCCTGCCTCGG - Intergenic
1018659842 6:166076096-166076118 CCTGGGTCCCACACCTGCCAAGG + Intergenic
1019270345 7:143627-143649 AGGGGGTCCCAGCCCTGCCAGGG + Intergenic
1019972201 7:4550122-4550144 TTGGTGTCCCAGACATGCCATGG - Intergenic
1021365326 7:19772193-19772215 GGGGGGTGTCACACCTGTCAAGG - Intronic
1025256717 7:57388846-57388868 GGGAGGTCCCAGACCAGGCAGGG - Intergenic
1025941006 7:66076144-66076166 TGGGGGCGCCAGACCTGCCTCGG + Intronic
1026771972 7:73207904-73207926 GTGAGGTCACAGACTTGCCAAGG + Intergenic
1027012840 7:74761300-74761322 GTGAGGTCACAGACTTGCCAAGG + Intergenic
1027075200 7:75184753-75184775 GTGAGGTCACAGACTTGCCAAGG - Intergenic
1028540808 7:91940742-91940764 GGCAGGTCCCAGGCCTGGCAAGG + Intergenic
1029344525 7:99968752-99968774 CAGGGGTTCCAGACCAGCCAGGG + Intronic
1029382369 7:100222213-100222235 GGGGAGACACAGACCTGCCCTGG - Intronic
1029899457 7:104023337-104023359 CCTGGGTCCCACACCTGCCAAGG - Intergenic
1031088365 7:117324488-117324510 GGGAGGGGCCGGACCTGCCAGGG - Intergenic
1032489065 7:132310395-132310417 TGGTGTTCCCAGAGCTGCCAGGG - Intronic
1034036607 7:147830236-147830258 GGGAAGTCCAAGACCTGCCAAGG + Intronic
1034326398 7:150237735-150237757 GCAAGGTCCCACACCTGCCAGGG - Intergenic
1034766816 7:153731521-153731543 GCAAGGTCCCACACCTGCCAGGG + Intergenic
1034823069 7:154234892-154234914 CGGGGATCCCAGGCCTCCCAGGG - Intronic
1039180839 8:34864279-34864301 GGGTGTTCCCAGAACTGTCATGG + Intergenic
1039345292 8:36696985-36697007 CAGGTGTCCCAGACCAGCCAAGG - Intergenic
1041298511 8:56387357-56387379 GAGGTCTCCCAAACCTGCCAAGG - Intergenic
1041357129 8:57013369-57013391 CCTGGGTCCCACACCTGCCAAGG + Intergenic
1041402461 8:57460090-57460112 GTTGGGTCCCAGCCATGCCATGG - Intergenic
1044333053 8:90943958-90943980 TGGGGGTTCAAGACCAGCCAGGG - Intronic
1044524841 8:93240710-93240732 GCTGGGTCCCATGCCTGCCAAGG + Intergenic
1048912482 8:139149156-139149178 GGGCTGTCCCAGGCCTGCCTAGG + Intergenic
1049245019 8:141557787-141557809 GGCGGGTGCCAGGCCTGCCGGGG + Intergenic
1049466385 8:142752877-142752899 GGGGGGTCCCTGGGCTGCCTGGG - Intergenic
1049651256 8:143771074-143771096 GGGGGGCCCCAGGCCTGGGAGGG - Intergenic
1051488615 9:17635972-17635994 TGTGGGCCCAAGACCTGCCAAGG + Intronic
1053456356 9:38235938-38235960 GGGTGGTGCCAGCCATGCCAAGG - Intergenic
1056535531 9:87524336-87524358 AGGGGGTCCCAGACCCAGCATGG - Intronic
1057171304 9:92964865-92964887 GGGTGGTCCCAGACGTGTCCTGG + Intronic
1059332036 9:113541728-113541750 GGTGGCTCCCGGACCTGCCTTGG + Intronic
1061059147 9:128242081-128242103 GGTGGGGGCCAGACCTGCCTTGG - Intronic
1061480455 9:130895501-130895523 GCTGGGTCCCAGCCCTGGCAGGG + Intergenic
1061645331 9:131996319-131996341 TGAGGGGCTCAGACCTGCCAGGG + Intronic
1062282635 9:135758869-135758891 GGGGGTGCCCAGAGCTGCGAGGG + Intronic
1062318099 9:135978079-135978101 GGGGTGTCCCAGAGCTGCTGAGG - Intergenic
1062595284 9:137296416-137296438 GGAGGTTCCCAGACCTTCCACGG + Intergenic
1062699476 9:137891438-137891460 GGGGGGTCCCAGGCCTGTGGCGG + Intronic
1186295181 X:8141462-8141484 GGGTGTTCCCAGATCTGTCATGG + Intergenic
1186485580 X:9932279-9932301 GGGGAGCCCCAGAGCTGCCCCGG + Exonic
1190321979 X:49184948-49184970 GGGGGGTCCGAGGCCAGCCTAGG - Intronic
1193224124 X:78961474-78961496 AGCGGGTCACAGAACTGCCATGG - Exonic
1198109211 X:133487850-133487872 TGGGGGTCCCAGACATGCCATGG + Intergenic
1199974321 X:152884037-152884059 GGAGGGTCTCAGAGCAGCCAGGG - Intergenic
1200207414 X:154327127-154327149 TGTGGGTCCCAGCCCTGCCCTGG + Intronic
1202038957 Y:20663178-20663200 ATGGGGTCCCAGCCATGCCATGG - Intergenic
1202069134 Y:20972439-20972461 GTGGGGTCCTAGCCATGCCATGG - Intergenic
1202081613 Y:21089544-21089566 GTTGGGTCCCAGCCATGCCATGG + Intergenic