ID: 1167445544

View in Genome Browser
Species Human (GRCh38)
Location 19:49535038-49535060
Sequence TGTCCTCCACAGGGCTCCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 5, 3: 16, 4: 141}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167445531_1167445544 -2 Left 1167445531 19:49535017-49535039 CCCCAGCCTCCCCGTCCAGTCTG 0: 1
1: 0
2: 2
3: 47
4: 541
Right 1167445544 19:49535038-49535060 TGTCCTCCACAGGGCTCCGGGGG 0: 1
1: 0
2: 5
3: 16
4: 141
1167445530_1167445544 3 Left 1167445530 19:49535012-49535034 CCTGGCCCCAGCCTCCCCGTCCA 0: 1
1: 1
2: 6
3: 88
4: 842
Right 1167445544 19:49535038-49535060 TGTCCTCCACAGGGCTCCGGGGG 0: 1
1: 0
2: 5
3: 16
4: 141
1167445533_1167445544 -4 Left 1167445533 19:49535019-49535041 CCAGCCTCCCCGTCCAGTCTGTC 0: 1
1: 0
2: 1
3: 27
4: 250
Right 1167445544 19:49535038-49535060 TGTCCTCCACAGGGCTCCGGGGG 0: 1
1: 0
2: 5
3: 16
4: 141
1167445524_1167445544 22 Left 1167445524 19:49534993-49535015 CCCTCCTCTCCTCTCTGTCCCTG 0: 1
1: 1
2: 25
3: 262
4: 1943
Right 1167445544 19:49535038-49535060 TGTCCTCCACAGGGCTCCGGGGG 0: 1
1: 0
2: 5
3: 16
4: 141
1167445527_1167445544 18 Left 1167445527 19:49534997-49535019 CCTCTCCTCTCTGTCCCTGGCCC 0: 1
1: 0
2: 16
3: 132
4: 1340
Right 1167445544 19:49535038-49535060 TGTCCTCCACAGGGCTCCGGGGG 0: 1
1: 0
2: 5
3: 16
4: 141
1167445528_1167445544 13 Left 1167445528 19:49535002-49535024 CCTCTCTGTCCCTGGCCCCAGCC 0: 1
1: 1
2: 23
3: 146
4: 1084
Right 1167445544 19:49535038-49535060 TGTCCTCCACAGGGCTCCGGGGG 0: 1
1: 0
2: 5
3: 16
4: 141
1167445534_1167445544 -8 Left 1167445534 19:49535023-49535045 CCTCCCCGTCCAGTCTGTCCTCC 0: 1
1: 0
2: 2
3: 52
4: 408
Right 1167445544 19:49535038-49535060 TGTCCTCCACAGGGCTCCGGGGG 0: 1
1: 0
2: 5
3: 16
4: 141
1167445529_1167445544 4 Left 1167445529 19:49535011-49535033 CCCTGGCCCCAGCCTCCCCGTCC No data
Right 1167445544 19:49535038-49535060 TGTCCTCCACAGGGCTCCGGGGG 0: 1
1: 0
2: 5
3: 16
4: 141
1167445525_1167445544 21 Left 1167445525 19:49534994-49535016 CCTCCTCTCCTCTCTGTCCCTGG 0: 1
1: 0
2: 12
3: 155
4: 1212
Right 1167445544 19:49535038-49535060 TGTCCTCCACAGGGCTCCGGGGG 0: 1
1: 0
2: 5
3: 16
4: 141
1167445532_1167445544 -3 Left 1167445532 19:49535018-49535040 CCCAGCCTCCCCGTCCAGTCTGT 0: 1
1: 0
2: 0
3: 12
4: 219
Right 1167445544 19:49535038-49535060 TGTCCTCCACAGGGCTCCGGGGG 0: 1
1: 0
2: 5
3: 16
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167445544 Original CRISPR TGTCCTCCACAGGGCTCCGG GGG Intronic
901977223 1:13004747-13004769 TCTCTTCCACTGGGCTCCTGTGG + Intronic
902004863 1:13224187-13224209 TCTCTTCCACTGGGCTCCTGTGG - Intergenic
902024081 1:13369922-13369944 TCTCTTCCACTGGGCTCCTGTGG - Intronic
905295669 1:36952993-36953015 TGTCCTCCGAAGGGCTCTGCAGG + Intronic
905473243 1:38208327-38208349 TGTCCTCTCCCTGGCTCCGGCGG - Intergenic
905925929 1:41749790-41749812 TGTGCTCTACGGAGCTCCGGGGG + Intronic
906798758 1:48718289-48718311 TGCCCTCCACAGGGCCCAGGAGG - Intronic
907248613 1:53123319-53123341 TGCCCCGCACAGGGCTCAGGCGG + Intronic
911512502 1:98824984-98825006 TGGCCTCCACAGGGCTCATTAGG - Intergenic
912122502 1:106489683-106489705 TGCCCACCACAGGGCTGGGGTGG + Intergenic
913994733 1:143642916-143642938 TGTGCTCCACAGGACTTCCGAGG + Intergenic
915553656 1:156649248-156649270 AATCCTCCAGAGGGCTCCTGAGG - Intronic
915735550 1:158082546-158082568 TGTCCACCACTGGGCACCGTGGG + Intronic
917969264 1:180196776-180196798 TGACCTCCAAAGGGCCCCAGAGG - Exonic
919834189 1:201562507-201562529 TGTCCTGCCCAGGGCTCAGGAGG - Intergenic
922595372 1:226809056-226809078 GGGCTTCCACAGGGCTCCGAAGG + Intergenic
923460320 1:234204524-234204546 TGAGCTCCTCAGGGCTCCAGGGG - Intronic
1062941752 10:1427006-1427028 TGTACTCCGCTGGGCTCCAGGGG + Intronic
1064976818 10:21125731-21125753 TGTGCTCCACAGGGCACGGATGG + Intronic
1067057164 10:43058947-43058969 TGTCCTCAGCAGCGCTCTGGGGG - Intergenic
1069486517 10:68827412-68827434 TCTCCTCCAGAGCGCTCCGCCGG + Intergenic
1069899007 10:71696293-71696315 TGTCCCCCACAGGGCTGGGTGGG - Intronic
1073295021 10:102433678-102433700 TGTCCATGACAGGGCTCAGGTGG - Intergenic
1073476818 10:103759131-103759153 TCTTCTGCACAGGGCTCTGGGGG + Intronic
1075100810 10:119504852-119504874 TGTTCTCCACAAGACTCTGGTGG - Intronic
1075373708 10:121959941-121959963 TGTCCTCCTAAGGTCTCCTGTGG - Intronic
1076625031 10:131816436-131816458 TGTCAGCCCCAGAGCTCCGGGGG - Intergenic
1077330100 11:1980425-1980447 TGTGCTCCAGAGGGCTCCCGGGG - Intronic
1077369356 11:2174324-2174346 TCACCTCCACAGGGGTCCAGGGG - Intergenic
1077784941 11:5373676-5373698 TATCCTGCACATGGCTCCGAGGG + Intronic
1078823894 11:14907847-14907869 TCCCCTCCACAGGTCTCCCGTGG + Intronic
1083304169 11:61754112-61754134 TCTCCTCCACAGGACTCCACAGG - Intronic
1084555811 11:69875149-69875171 CGTCCTGCAGAGGGCTCCGGCGG + Intergenic
1086510542 11:87553150-87553172 TGTGCTCAACTGGGCTCAGGAGG - Intergenic
1091080915 11:132666805-132666827 TGTGTTCCACAGGGCTGCAGAGG + Intronic
1202813077 11_KI270721v1_random:35604-35626 TGTGCTCCAGAGGGCTCCCGGGG - Intergenic
1091837032 12:3593315-3593337 TGAACTCCCCAGGGCTCCCGTGG + Exonic
1096955199 12:55518664-55518686 TATCCTGCACATGGCTCCGAAGG + Intergenic
1099266550 12:80454163-80454185 TATCCTGCACATGGCTCAGGGGG - Intronic
1099267116 12:80462211-80462233 TATCCTGCACATGGCTCAGGGGG + Intronic
1101693743 12:107105515-107105537 TTCCCTCCACAGGGCTCAAGAGG + Intergenic
1101900333 12:108787261-108787283 TGACCAGCACAGGGGTCCGGTGG - Exonic
1104871916 12:132005635-132005657 TGACCTCCCCAAGGCTCCTGTGG - Intronic
1107349226 13:39496772-39496794 TGGCCACCACAGGGATCCAGGGG + Intronic
1107609599 13:42099845-42099867 TGTACTCCACAGAACTCTGGGGG + Intronic
1108104022 13:46989189-46989211 TCTCCTCCACAGGCCTCAGAAGG + Intergenic
1110722994 13:78786598-78786620 TTTCCTGCACAGGGCTGAGGAGG + Intergenic
1113865131 13:113516967-113516989 TGGCCTCCAGAGGCCTCCGTGGG + Intronic
1113877224 13:113601955-113601977 TGTCCGCTACAGGGCTACAGAGG - Intronic
1114495489 14:23128735-23128757 TATCCTCTTCAGGGCTCCAGGGG + Intronic
1117951039 14:61082827-61082849 TCCCTTCCACAGGGCTCCAGTGG - Intronic
1118594747 14:67426953-67426975 AGTCCTCCCCAGGCCTCCGCAGG + Intergenic
1120841952 14:89094045-89094067 TGTCCTGCACATGTCTACGGGGG - Intergenic
1120916046 14:89711304-89711326 TGCCCTCCTCAGGGCTCCTGTGG + Intergenic
1121113594 14:91328884-91328906 TGTGCTCCTCAGGGGTCAGGAGG - Intronic
1122234616 14:100324652-100324674 AGGCCTCCTCATGGCTCCGGAGG - Intronic
1122441360 14:101734458-101734480 TGCCCTCCACAGGTCACAGGTGG + Intergenic
1122647077 14:103201967-103201989 TGTACTCTACAGGACTACGGAGG + Intergenic
1122819204 14:104332822-104332844 AGTCCTCCACAGGGCCCCCGGGG - Intergenic
1125679902 15:41524037-41524059 GCTCCTCCACAGGGCTGGGGTGG - Intronic
1125921622 15:43528713-43528735 TGTCCTGCAGGGGGCTCCGGGGG + Exonic
1126784310 15:52163976-52163998 TCTCCTCCACAGGGCTGCTGCGG - Intronic
1127665630 15:61144107-61144129 TGTCCTCTACTGGGCTCCCTGGG + Intronic
1128227557 15:66012809-66012831 TGGCCTCCCCAGGGCTCCTAGGG - Intronic
1129248607 15:74295645-74295667 TCTCCTCCTCATGGCTCAGGAGG - Intronic
1129894271 15:79091802-79091824 TTTCCTTCACAGGGCTGCGCGGG - Intergenic
1130140373 15:81221280-81221302 TCTCCTCCAGAGGATTCCGGGGG - Intronic
1133515283 16:6502706-6502728 AGTCCTACATAGGGGTCCGGTGG - Intronic
1136136214 16:28258424-28258446 TGTGCTGCACTGGGCTCCCGGGG - Intergenic
1138215011 16:55196767-55196789 TGTCCTGCACAGGTCTGCTGAGG - Intergenic
1141133413 16:81450109-81450131 TGTCCTGGGCAGGGCTCAGGGGG + Intronic
1141677449 16:85525112-85525134 TGGCCTCCACAGGGAACCTGAGG + Intergenic
1142186890 16:88698916-88698938 TGTCCCCCACAGGCCTCCCCTGG + Intronic
1142673351 17:1497817-1497839 TGGCCTCCACAGGTCTCCCCTGG + Intronic
1146739923 17:35274708-35274730 TATCCTGCACATGGCTCCGAGGG + Intergenic
1154254239 18:12768700-12768722 TGTCCACCACAGAGCTCCCCAGG - Intergenic
1156570659 18:38249087-38249109 TGCCCTCCACAGGGCTCAGGGGG - Intergenic
1157514103 18:48298699-48298721 TATACCCCAGAGGGCTCCGGTGG - Intronic
1158395699 18:57077209-57077231 TGTCCTCTGCAGGGCTCCCATGG + Intergenic
1160520958 18:79507662-79507684 TGTCCTTTCTAGGGCTCCGGGGG - Intronic
1161459623 19:4389073-4389095 TGTCCTCCACAGGGCCCCTGTGG - Intronic
1163509693 19:17727313-17727335 TGCCCTCTGCGGGGCTCCGGTGG - Exonic
1163808626 19:19416226-19416248 GGTCCTGCACTGGGCTCCAGTGG + Intronic
1163822222 19:19502532-19502554 TGACCTCCACAGGGCTCCCCAGG + Intronic
1164821978 19:31257524-31257546 GGTCCTCCAGAGGGGTCCTGGGG - Intergenic
1167445544 19:49535038-49535060 TGTCCTCCACAGGGCTCCGGGGG + Intronic
1167506558 19:49873948-49873970 TGTCCTGCACAAGGCCCAGGGGG + Intronic
1168257941 19:55177129-55177151 TGTCCTACACAGGGTTCCAGAGG + Intronic
925412912 2:3650312-3650334 TGGCATCCACAGGGCTCTCGGGG + Intergenic
925889233 2:8420356-8420378 TGTCCTCCAGAGAGCTCCAAGGG - Intergenic
926017757 2:9469536-9469558 TGCCCTCCCCACGGCTCCTGAGG - Intronic
932469477 2:71944499-71944521 TGTCTTCCACAGGACACCGCAGG - Intergenic
932485847 2:72083925-72083947 TCCCCACCCCAGGGCTCCGGAGG - Intergenic
933974637 2:87498456-87498478 TGACCTCCACAGGACTCTGGGGG - Intergenic
936319187 2:111452358-111452380 TGACCTCCACAGGACTCTGGGGG + Intergenic
937212571 2:120285091-120285113 TTTCTTCCACAGGGCTGGGGAGG + Intronic
937311919 2:120908025-120908047 TGTCCACACCAGGGCTCCTGAGG - Intronic
941136309 2:161722438-161722460 TCTCTTCCACAGGGCTGCTGTGG + Intronic
944420487 2:199524868-199524890 TGTCCCCCACAGTGCACCAGTGG - Intergenic
948685827 2:239669337-239669359 TGGCGTCCCCAGGGCTCCAGAGG - Intergenic
1169765102 20:9140390-9140412 TGTCTTCCTCAGGGCTGCAGTGG + Intronic
1171358289 20:24567428-24567450 TGTCCTTCAGAGGGCTCCCCTGG - Intronic
1176922714 21:14707703-14707725 TTTCCTCCACATGGCTGAGGAGG + Intergenic
1178409343 21:32350712-32350734 AGTTCTCCACAGTGCTCCGCAGG + Exonic
1180037461 21:45257108-45257130 TGCCCTGCACAGATCTCCGGAGG + Intergenic
1180136514 21:45865825-45865847 TGTCCTGCAGAGGCCTCAGGCGG + Intronic
1180902544 22:19385292-19385314 TGACCTCCTCTGGGCTCCTGGGG + Intronic
1181132134 22:20738214-20738236 TGTCCTCCTGTGGGCTCAGGAGG - Intronic
1181541091 22:23573734-23573756 TGCTCTCCAGAGGGCTCCAGTGG - Intronic
1181797291 22:25319596-25319618 TGCTCTCCAGAGGGCTCCAGTGG + Intergenic
1185058950 22:48595537-48595559 TGGCCTCCACAGAGCCCCAGTGG - Intronic
1185240063 22:49737553-49737575 TGTCCTCCCCAGGGCTCTGCCGG - Intergenic
1185408669 22:50671822-50671844 TGACGTCCTCTGGGCTCCGGGGG - Intergenic
950040562 3:9916871-9916893 TGTCCTCCTTAGGGCTCCGGGGG + Intergenic
950087488 3:10270590-10270612 TGTCCTCCACAAGGACGCGGAGG - Exonic
961195500 3:124998165-124998187 TGTCTTCCAAAGGACTGCGGAGG + Intronic
961393496 3:126570405-126570427 TGGCCTGCAGAGGGCACCGGGGG + Intergenic
963200232 3:142578789-142578811 TGGCCTCCACACGGCTCCGTCGG - Exonic
965493790 3:169372871-169372893 AGTCCTCCTCAGGGGTCCTGTGG - Intronic
967106260 3:186257142-186257164 TGTCCTCCCCAGTGCTCCCCCGG + Intronic
967824271 3:193866322-193866344 TGTCCTTCAAGGGGCTACGGGGG + Intergenic
969219845 4:5752452-5752474 TGGCCCCCACAGGGCTGTGGAGG - Intronic
985628713 5:1004067-1004089 AGACGTCCCCAGGGCTCCGGTGG + Intergenic
985721459 5:1491618-1491640 TTCCCTCCTCAGGGCTCCCGGGG - Intronic
989973146 5:50548546-50548568 AGTCTTCCACAGGTCTCCAGTGG + Intergenic
992641772 5:78773941-78773963 TCTCCTCCACGGGCCTCAGGAGG - Intergenic
992891428 5:81207830-81207852 TGTTCTCCCCAGCGCTCAGGAGG - Intronic
999060813 5:148633032-148633054 TTTCCTCCTCAAGGCTCCGGAGG - Intronic
1001448671 5:171807185-171807207 TGTCGCCCGCAGGGCTCCTGCGG + Intergenic
1001945302 5:175773243-175773265 TGACCTCGACAGGGCTCTGAAGG - Intergenic
1002050796 5:176569633-176569655 TCTCCACCCCAGGGCTCCAGAGG + Intronic
1002683990 5:180992747-180992769 AGTCCTTCTCAGGGCTCTGGTGG - Intronic
1002846231 6:947658-947680 ATTCCTTCACAGGGCTCCTGGGG - Intergenic
1012504729 6:99931631-99931653 TATCCTGCACATGGCTCAGGGGG - Intronic
1012776251 6:103496834-103496856 TATCCAGCACATGGCTCCGGGGG - Intergenic
1017978103 6:159375485-159375507 TGTCCTCCCCACGACTCTGGAGG - Intergenic
1019631887 7:2053848-2053870 TGGCTTCCACAGTGCTCCAGGGG + Intronic
1023614454 7:42005824-42005846 TGTCCTCCAGAGGACTCCAAGGG - Intronic
1026387087 7:69860779-69860801 TGTCCTTCACAGGGTTCTGAGGG + Intronic
1028621779 7:92834853-92834875 TGTTGTGCAGAGGGCTCCGGGGG - Intronic
1029437975 7:100573289-100573311 TGTCCTACCTGGGGCTCCGGGGG + Exonic
1029747654 7:102525389-102525411 GGTCCTGCACAGGGTTCTGGAGG - Intergenic
1029765605 7:102624479-102624501 GGTCCTGCACAGGGTTCTGGAGG - Intronic
1035076138 7:156178886-156178908 AGTCCTCCTCAGGGCCACGGAGG + Intergenic
1035401860 7:158570794-158570816 TGAGCTCCACAGGGTTCCTGAGG - Intronic
1042092674 8:65176055-65176077 TGGACTCCACAGGACTCCTGTGG + Intergenic
1048999299 8:139814465-139814487 TGTCCTCCTCAGGGGCCCCGGGG - Intronic
1049861458 8:144901779-144901801 TGTCCTCCACAGGGCGACGGCGG - Intronic
1053392557 9:37746198-37746220 TTTCCTCGACAGGGGTGCGGTGG - Exonic
1055428060 9:76216120-76216142 TGTCCTCTACATGACTCCGCAGG + Intronic
1059218087 9:112585516-112585538 TGTCCTCCACGGGGCTCAGGGGG + Intronic
1060473997 9:123971456-123971478 TGTCTTCCACAGGGCTGGGATGG + Intergenic
1061056443 9:128225301-128225323 TCTCCTCCACAGGGGTTTGGTGG - Intronic
1062204237 9:135326964-135326986 TGTACACCACAGGGCTGCTGTGG + Intergenic
1062250652 9:135592101-135592123 TGTTCTCCCCAGGGCTCCCCTGG + Intergenic
1062536494 9:137023384-137023406 TGTCCTCCCCTGGGCTCTGTAGG - Intronic
1062540786 9:137040834-137040856 TGCCCTCCCCGGGGCTCCAGGGG + Exonic
1062675116 9:137738360-137738382 TGTCCTCAACAGGTGTACGGTGG - Intronic
1186346992 X:8703885-8703907 TGTCCTGCACAGGGCTTCTCAGG - Intronic
1195954803 X:110317839-110317861 TCTCCCCCCCAGGGCTGCGGCGG - Exonic
1198749071 X:139920803-139920825 TGTCTTCCACACAGCTCCAGGGG - Intronic
1199985462 X:152946960-152946982 GGTCCTCCACAGGGCAATGGAGG - Intronic
1201419910 Y:13787111-13787133 TGTCCTGCACAGGGCTTCTCAGG + Intergenic