ID: 1167446213

View in Genome Browser
Species Human (GRCh38)
Location 19:49539105-49539127
Sequence CAGGGTTTCCTGGAGGAGAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 560
Summary {0: 1, 1: 1, 2: 3, 3: 72, 4: 483}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167446213_1167446221 3 Left 1167446213 19:49539105-49539127 CCTTTCTCCTCCAGGAAACCCTG 0: 1
1: 1
2: 3
3: 72
4: 483
Right 1167446221 19:49539131-49539153 GACCTGGACAGAAACAAAGATGG 0: 1
1: 0
2: 0
3: 23
4: 333
1167446213_1167446224 17 Left 1167446213 19:49539105-49539127 CCTTTCTCCTCCAGGAAACCCTG 0: 1
1: 1
2: 3
3: 72
4: 483
Right 1167446224 19:49539145-49539167 CAAAGATGGCTATGTCCAGGTGG 0: 1
1: 0
2: 0
3: 10
4: 157
1167446213_1167446225 20 Left 1167446213 19:49539105-49539127 CCTTTCTCCTCCAGGAAACCCTG 0: 1
1: 1
2: 3
3: 72
4: 483
Right 1167446225 19:49539148-49539170 AGATGGCTATGTCCAGGTGGAGG 0: 1
1: 0
2: 1
3: 15
4: 201
1167446213_1167446223 14 Left 1167446213 19:49539105-49539127 CCTTTCTCCTCCAGGAAACCCTG 0: 1
1: 1
2: 3
3: 72
4: 483
Right 1167446223 19:49539142-49539164 AAACAAAGATGGCTATGTCCAGG 0: 1
1: 0
2: 2
3: 11
4: 196
1167446213_1167446226 30 Left 1167446213 19:49539105-49539127 CCTTTCTCCTCCAGGAAACCCTG 0: 1
1: 1
2: 3
3: 72
4: 483
Right 1167446226 19:49539158-49539180 GTCCAGGTGGAGGAGTACATCGG 0: 1
1: 0
2: 0
3: 15
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167446213 Original CRISPR CAGGGTTTCCTGGAGGAGAA AGG (reversed) Exonic
900152221 1:1183669-1183691 GAGGGCTGCCTGGAGGAGGAGGG - Intronic
900383206 1:2395594-2395616 CAGGCTTCCCTGGAGAGGAAGGG - Intronic
900516357 1:3084108-3084130 GTGGGCTCCCTGGAGGAGAAAGG + Intronic
900618113 1:3574428-3574450 AAGGGCTTCCTGGAGGAGGTGGG - Intronic
900622434 1:3593530-3593552 CAGGGTTTACTGGGGGAGAGCGG - Intronic
900891520 1:5453149-5453171 CAGAGCTTCCTTGAGGAGAGGGG - Intergenic
900902431 1:5526313-5526335 CTGGGTTTCTTGGAGGCGAGCGG - Intergenic
901348364 1:8568028-8568050 CAGGTGTTCCTAGAGGAGACTGG + Intronic
901631709 1:10651294-10651316 CAGGGCCTCCTGGAGGAGAAGGG + Intronic
902155622 1:14483283-14483305 CAGGGTTGCATGGAGGAGGAGGG - Intergenic
902695117 1:18134925-18134947 CAGATTTTTCTGGAGGAAAAGGG + Intronic
902839340 1:19065346-19065368 CAGGGTAACCGGGAGGAGGACGG + Intergenic
903341247 1:22655860-22655882 AAAGGTTTCCTGGAGGAAGAAGG + Intronic
904463099 1:30692209-30692231 TGGGGTGTCCTGCAGGAGAATGG + Intergenic
904499252 1:30904776-30904798 GAAGGCTTCCTGGAGGAGGAGGG - Intronic
904834051 1:33323592-33323614 CAGGCATTCCTAGGGGAGAAAGG + Intergenic
904887420 1:33751328-33751350 GAGGGTTTCCAGAAGGAGGAAGG + Intronic
905232631 1:36524003-36524025 CTGGCTTTCCTGGAAGAGAATGG + Intergenic
905907848 1:41631488-41631510 CAGGGTGCCCAAGAGGAGAAAGG - Intronic
906156211 1:43615469-43615491 GAAGGCTTCCTGGAGGAGGAGGG - Intronic
906829949 1:49020593-49020615 GGGGGTGTCCTGGAGGAGGAGGG + Intronic
907257638 1:53191797-53191819 AAGGATTCCTTGGAGGAGAAGGG - Intergenic
910100168 1:83567344-83567366 CAGGCTTGCCTGGAGCAGAAAGG + Intergenic
910753398 1:90659149-90659171 AAGGGTTTCAAGTAGGAGAAAGG - Intergenic
911048417 1:93648811-93648833 GAGGGCTTCCTGGAGGAGGTTGG - Intronic
911100370 1:94091022-94091044 CAGGAATTCCAGGTGGAGAAAGG + Intronic
912694070 1:111827801-111827823 CAGGGTATCCTGGAGCAGGAGGG - Intronic
916354891 1:163893916-163893938 CAGAGTTTTCAGGAAGAGAAAGG + Intergenic
916427241 1:164692442-164692464 CAGGTTTTCGTGGAGGAAATGGG + Intronic
916587691 1:166162943-166162965 CAGGGTGTTCTAGAGGTGAATGG - Intronic
917529439 1:175821555-175821577 CATGGTGTCCTGGAAGATAAGGG - Intergenic
917871845 1:179249175-179249197 TACAGTTTCCTTGAGGAGAAGGG - Intergenic
918128355 1:181604033-181604055 CAGCGTTTCCAGGATGAGAATGG - Intronic
918851364 1:189694532-189694554 CTTGGTTTCCTGGAGCAGGAAGG - Intergenic
919584762 1:199422620-199422642 CACTGTTTCCTTGAAGAGAAGGG + Intergenic
920107397 1:203563632-203563654 CTGGTCTTCCAGGAGGAGAAGGG - Intergenic
920118235 1:203636405-203636427 CAGGGTTTCCAGGAGAAGAGAGG - Intronic
920254327 1:204644240-204644262 GAGAGCTTCATGGAGGAGAAGGG - Intronic
922080415 1:222290457-222290479 CATGGTCTCATGGAGTAGAATGG + Intergenic
922562915 1:226582080-226582102 CAGGGCTTCCAGGAGGAGGCTGG - Intronic
923326151 1:232882011-232882033 CAGGGTTTCCTTGAAGTGATGGG - Intergenic
923510679 1:234649702-234649724 CAGGGTGTCCTGGAGTCTAAAGG + Intergenic
924335718 1:242985232-242985254 CAAGGTTCCCTGGAGCAGAGAGG - Intergenic
924802141 1:247335349-247335371 AAGGGGTTAGTGGAGGAGAAGGG + Intergenic
1062768204 10:81049-81071 GAGGGCTTCCTGGAGGAGGAGGG - Intergenic
1063069868 10:2650491-2650513 CAAGGTGTCATAGAGGAGAAGGG - Intergenic
1063399080 10:5723756-5723778 CAGAATTACTTGGAGGAGAAAGG + Exonic
1063442352 10:6083192-6083214 CATGTTTTCCTGGGGGAGCAAGG + Intergenic
1064138782 10:12772733-12772755 CAGGTTGTCCTGGAGGAGGCTGG + Intronic
1064256116 10:13743975-13743997 CAGGGTTACATGGAGGAAAAAGG + Intronic
1064608970 10:17077180-17077202 CAGTGTTTCCTGGACGAATAAGG - Intronic
1067223670 10:44361819-44361841 CAGGCTTTCCTGGAGGAGAAGGG + Intergenic
1067343739 10:45423453-45423475 CAGGGCTTCCTGGAGGAGGCAGG - Intronic
1067731363 10:48814042-48814064 CAGCATTTCCAGGAGGAGCAAGG - Exonic
1067915561 10:50394184-50394206 CAGGGATTCCTGGTGGCCAAAGG - Intronic
1068223033 10:54067138-54067160 AAGTATTTCCTGGAGGAAAACGG + Intronic
1068520050 10:58067752-58067774 AAAGGTTTCATGGAGGAGATTGG - Intergenic
1070149843 10:73798988-73799010 CAGGTTGTCCTGGAAGAGAGGGG - Exonic
1070314409 10:75296319-75296341 TAGGATTTGCTGGAGGAGACCGG + Intergenic
1071515038 10:86291557-86291579 GAGGGCTTCCTGGAGGTGGATGG - Intronic
1071821328 10:89284155-89284177 GAGGGGTTGCTGGAGGAGGAGGG + Intronic
1072008866 10:91286269-91286291 CAGGGTTTGCAGGAGGAGCAGGG - Intergenic
1072817070 10:98519831-98519853 CAGGCTTTCCTGGAGGGGTCTGG - Intronic
1072911794 10:99508662-99508684 CAGGGGCTCCTGGATGAGAAGGG + Intergenic
1072989714 10:100180624-100180646 TAGGCTTGCCTGGAGCAGAAGGG + Intronic
1073247883 10:102104548-102104570 CAGGGGTTCCTGGGGGCAAATGG + Intergenic
1073621656 10:105056067-105056089 AAAGGGTTCCTGGAGGAGATAGG + Intronic
1073693115 10:105833865-105833887 CTGGGTTTAGTGAAGGAGAAAGG + Intergenic
1074564392 10:114564152-114564174 CAGGGATGCCTGGAGGAGTTTGG - Intronic
1075394922 10:122120298-122120320 CAGGGTCTCCTGGCTGAGAAAGG - Intronic
1075733128 10:124648121-124648143 GAGGGTTTTCTGGAGGAGGCAGG - Intronic
1076621839 10:131793991-131794013 CAGGGCTTCCAGAAGGCGAATGG - Intergenic
1076632903 10:131862683-131862705 TAGAGATTCCTGGAGGACAAGGG - Intergenic
1077101219 11:823460-823482 CAGGGATTCCAGGGGCAGAACGG + Intronic
1077504449 11:2923643-2923665 GAGGGCTTCCTGGAGGAGGTTGG + Intronic
1077892851 11:6431795-6431817 CTGGGTGCCCTGGAGGACAAAGG + Exonic
1079082036 11:17420469-17420491 CTGGGTTTCCTGGAGGAGGCAGG - Intronic
1079338313 11:19590465-19590487 CTGGGTTTCCTGGAGCTTAAAGG - Intronic
1080665483 11:34332329-34332351 TAGGTCTTCATGGAGGAGAAGGG - Intronic
1081723092 11:45304354-45304376 CAGGGTTTCTTCCAGGAGAGAGG + Intergenic
1081840661 11:46199105-46199127 CAGGGTTTCCAGGAAGAGGTTGG - Intergenic
1083170821 11:60923193-60923215 CAGGGTACCCTGGTGGAGAGGGG - Exonic
1084701451 11:70788789-70788811 CAGGGTGTCCTATAGGAGACAGG + Intronic
1085232173 11:74981758-74981780 CATGGTTTTCTAGAAGAGAAAGG + Intergenic
1085232355 11:74983103-74983125 CATGGTTTTCTAGAAGAGAAAGG + Intergenic
1085802480 11:79603235-79603257 GAAGGCTTCCTGGAGGAGGAGGG - Intergenic
1088070952 11:105784491-105784513 CAGGGTTTCAAAGATGAGAAAGG - Intronic
1088494208 11:110417418-110417440 CAGGGATCCCTGGAGGAGAGAGG - Intergenic
1088973828 11:114797083-114797105 AAAGGTTTCCTGTAGGAGACTGG + Intergenic
1089220110 11:116863629-116863651 CAGGCATCCCTGGAGGAGCATGG - Intronic
1089325851 11:117656300-117656322 CAGGGTTACCTGGTGGAGCCAGG - Intronic
1090022054 11:123137060-123137082 TTTGGTTTCCTAGAGGAGAAGGG - Intronic
1090163191 11:124517239-124517261 CAGCTTTGCCTAGAGGAGAATGG - Intergenic
1090248713 11:125236349-125236371 CAGGCTTTCCTGGAACAGGATGG - Intronic
1090898499 11:131003502-131003524 CAGGGTCTCCTTGAGGACAAAGG - Intergenic
1091583003 12:1800146-1800168 GAGGGTGTCCTGGAGGAGAGGGG - Intronic
1092077188 12:5683805-5683827 GAGGGCTTCCTGGAGGAGGCAGG + Intronic
1092704522 12:11268077-11268099 CTGGCTTTCCTGGAGGAGGTGGG + Exonic
1092708303 12:11308433-11308455 GTGGCTTTCCTGGAGGAGATCGG + Exonic
1092708340 12:11308559-11308581 CTGGCTTTCCTGGAGGAGGTGGG + Exonic
1092708360 12:11308622-11308644 CTGGCTTTCCTGGAGGAGGTGGG + Exonic
1092708398 12:11308748-11308770 CTGGCTTTCCTGGAGGAGGTGGG + Exonic
1092708437 12:11308874-11308896 CTGGCTTTCCTGGAGGAGGTGGG + Exonic
1092712435 12:11353259-11353281 GTGGCTTTCCTGGAGGAGATCGG + Exonic
1092712489 12:11353445-11353467 GTGGCTTTCCTGGAGGAGATTGG + Intronic
1092712600 12:11353811-11353833 GTGGTTTTCCTGGAGGAGATCGG + Exonic
1092716171 12:11392979-11393001 GTGGCTTTCCTGGAGGAGATCGG + Exonic
1092716279 12:11393351-11393373 GTGGCTTTCCTGGAGGAGATCGG + Exonic
1092716383 12:11393723-11393745 GTGGCTTTCCTGGAGGAGATCGG + Exonic
1092716438 12:11393906-11393928 GTGGCTTTCCTGGAGGAGATGGG + Exonic
1092981612 12:13800089-13800111 CAGTGATTCCAGGAGGAAAATGG - Intronic
1093396023 12:18683587-18683609 CAGGTCTTCCTGAAGCAGAAGGG - Intronic
1093441522 12:19202997-19203019 CAGGTTTTGCTGGTAGAGAAAGG + Intronic
1093843296 12:23933216-23933238 CAGGGTTAGCTGGAGCAGGATGG - Intronic
1094697404 12:32834191-32834213 CTGGGTTTCGTGGAGGAAACTGG - Intronic
1095747097 12:45672197-45672219 CAGGGCTTCCTTTAGAAGAATGG + Intergenic
1095978430 12:47955771-47955793 CAGGATTTCTGGGAGGAAAAAGG + Intergenic
1096048606 12:48586516-48586538 CAGTGTCTCCTGGAGGGGGATGG - Intergenic
1096543585 12:52322143-52322165 CAGGGACTCATGGAGGAGAGTGG + Intergenic
1096718847 12:53506603-53506625 CTGGGTTTGGTGGAGGGGAAGGG + Intergenic
1096776121 12:53965462-53965484 CAGGTGTTCCTGGGGGAGAGGGG - Intergenic
1097718918 12:62999433-62999455 CAATGTTTCCAGGAGGAGAGTGG + Intergenic
1098190663 12:67945167-67945189 GAAGGCTTCCTGGAGGAGGAGGG + Intergenic
1099277856 12:80600992-80601014 AAGAGTGTCCAGGAGGAGAATGG - Intronic
1099758347 12:86885435-86885457 AAGGGTTTTCTGGAGCAGCAAGG - Intergenic
1100055248 12:90501230-90501252 CAGCTTTTCCAGGAGGAGGAAGG + Intergenic
1100363570 12:93899253-93899275 CAGGGTTTGCAGTGGGAGAAAGG - Intergenic
1100726328 12:97412865-97412887 CAAGGTCACCTGGAGAAGAATGG - Intergenic
1100800202 12:98222841-98222863 CAGTGTTTTCTGGAGAAGAGTGG - Intergenic
1101303457 12:103504328-103504350 CAGGGCTTCCTGTCGGAGAAGGG + Intergenic
1101889540 12:108700449-108700471 CAGGCTTTCTGGGAGGATAAAGG + Intronic
1102488393 12:113273588-113273610 CAGGGGTTCCGGGAGTAGGAGGG - Exonic
1102628332 12:114254531-114254553 CAGGTTTTCCTCAAGGGGAAGGG - Intergenic
1103345036 12:120243725-120243747 GAGGGCTTCCTGGAGGAAATGGG - Intronic
1103736972 12:123066727-123066749 TAAGGTGTCCTGGAGGAGAAAGG - Intronic
1104604951 12:130180905-130180927 TTGGGTTTCCTGCAGGAGACGGG - Intergenic
1104655743 12:130572725-130572747 CAGGGTTTCTCGGTGGAGAAGGG + Intronic
1104657999 12:130588166-130588188 AAGGGCTTCCTGGAGGAGGCAGG - Intronic
1104726418 12:131078281-131078303 CAGTGTTTGCTGGAGGTGACAGG - Intronic
1104955340 12:132462138-132462160 CAGCGTTTCCCAGAGGAAAATGG + Intergenic
1105238168 13:18581575-18581597 CTTGGTTGGCTGGAGGAGAAAGG + Intergenic
1105358399 13:19681655-19681677 CAGGGTTTCCTTTCGGAGAAAGG + Intronic
1105746642 13:23383356-23383378 AAGGGTTGATTGGAGGAGAAAGG - Intronic
1105923506 13:24986092-24986114 CAGGGGTCCCTGGAGGCCAAGGG - Intergenic
1106460155 13:29961281-29961303 AGTGCTTTCCTGGAGGAGAAAGG + Intergenic
1106483715 13:30155245-30155267 CGGGGTGTCCTTGAGGAGGAGGG - Intergenic
1106958117 13:34965736-34965758 CAAGGTCTCCTGGATGACAAGGG + Intronic
1107006351 13:35615927-35615949 CAGGGTTTCCTGGCAGTGAAAGG - Intronic
1107109434 13:36680157-36680179 CAGTTTTGCCTTGAGGAGAATGG - Intronic
1109554234 13:63950347-63950369 CAGGGTTTCTTGGGGGAGGGAGG + Intergenic
1109726591 13:66349186-66349208 CAGTGTTTCCTGGAGGAGGGAGG + Intronic
1109797583 13:67337014-67337036 CAGAATTTACTGGAGGACAAAGG - Intergenic
1111991626 13:95122706-95122728 AAGAGTTTCATGGAGGAGAAAGG - Intronic
1112504843 13:99969577-99969599 CAGGCCTTCCGGGAGGGGAAGGG - Intronic
1113697375 13:112355650-112355672 CAGGGGTTCCAGGAGGGCAAGGG - Intergenic
1113782215 13:112983156-112983178 CAGGGTTTGTTGGAGGTGAGGGG + Intronic
1113798054 13:113070159-113070181 CAGGGCTTCCGGGAGGTGAGTGG + Exonic
1114214441 14:20645553-20645575 CTGGGTGTCATGCAGGAGAAGGG - Intergenic
1114215290 14:20653591-20653613 GAAGGGTTGCTGGAGGAGAAAGG + Intergenic
1114460204 14:22881790-22881812 CAGGGTTTGAGGGAGCAGAAAGG - Intergenic
1116723060 14:48525666-48525688 CAGAGATTCCTGGAGCAGAGTGG - Intergenic
1117533079 14:56677532-56677554 CAGTCTGTCCAGGAGGAGAAAGG - Intronic
1117581882 14:57159391-57159413 CAGGATTTGCTGGAGTAGAAAGG + Intergenic
1119108131 14:71943636-71943658 CTCTGTTTCCTGGAGGCGAAAGG + Intronic
1120045421 14:79800270-79800292 CACTGTTTCCTGGAGGAGCGTGG + Intronic
1120286100 14:82504005-82504027 CAGGAGTTCCAGGAGGTGAAAGG - Intergenic
1120389957 14:83893838-83893860 CAGGGTGACCTTGAAGAGAATGG - Intergenic
1120453028 14:84695303-84695325 CATGCTTTCCTGGTGGAGAGTGG + Intergenic
1121111132 14:91313882-91313904 CAGCGACTCCAGGAGGAGAACGG - Exonic
1121850580 14:97218570-97218592 CCTGGTTTCCTGGGGGAGGAGGG + Intergenic
1121931947 14:97980173-97980195 CATGCTTTCCTGGAGCAAAAAGG + Intergenic
1121963060 14:98278924-98278946 CTGGGTTTGCTGAAGCAGAAAGG + Intergenic
1123201955 14:106674593-106674615 GAGGGATTCCTGGACCAGAACGG - Intergenic
1123432639 15:20231629-20231651 CAAGGGTTCCTGGAGGAGAGAGG - Intergenic
1124904910 15:33859134-33859156 CAGGGATTCCTGCAGCAGGAAGG - Intronic
1127860240 15:62988068-62988090 CTGGGGTTCCTGGATCAGAAAGG - Intergenic
1127940108 15:63686441-63686463 CAGTGTTGCCTAGTGGAGAATGG - Exonic
1128177934 15:65573143-65573165 CAGGTTTTCCATGAGGAGCAGGG - Intronic
1128729913 15:70014128-70014150 GAGGCCTTCCTGGAGGAGGACGG - Intergenic
1129000321 15:72327850-72327872 CAGGATTTCCTGAAGAGGAAAGG - Intronic
1129168829 15:73795643-73795665 GAGGGCTTCCTGGAGGAGGAAGG + Intergenic
1129168920 15:73796146-73796168 GAGCGCTTCCTGGAGGAGGAAGG - Intergenic
1129323306 15:74786743-74786765 CAGGGTTGCCAGGAGGAGACTGG - Intronic
1129761130 15:78130000-78130022 TAGGGCTTCTAGGAGGAGAAGGG + Intronic
1130423700 15:83774540-83774562 CAGGCCTTCCTGGAGCAGACCGG - Intronic
1130771786 15:86931412-86931434 CAGGTTTTGCAGCAGGAGAAAGG - Intronic
1131478989 15:92766259-92766281 CAGATTTTCCTGTAGGAAAAAGG - Intronic
1131721616 15:95174681-95174703 CAATGTGACCTGGAGGAGAAGGG - Intergenic
1132457104 16:30025-30047 GAGGGCTTCCTGGAGGAGGAGGG - Intergenic
1132605721 16:792952-792974 CAGGGAGACCTGGTGGAGAAGGG - Exonic
1133097610 16:3458118-3458140 CAGCGCATCCTGGAGGCGAAGGG - Intronic
1133328862 16:4958838-4958860 CAGGGTGTCTGGGAGGAAAATGG + Intronic
1133984816 16:10660409-10660431 CAGGGTGTCCTGGAGGTAAAAGG + Intronic
1134135491 16:11674027-11674049 CAGGTTTGCCTGAAGGACAAAGG - Intronic
1134812458 16:17179223-17179245 CAGGGTCTCCTTGAGGAGGCAGG + Intronic
1135116980 16:19732175-19732197 AAGGGTTTTCTGGAAGAGACTGG - Intronic
1135588611 16:23689941-23689963 CTGAGTCTCCTGGAGGAGTACGG + Exonic
1135872971 16:26169257-26169279 AAGGGTTTTCAGGAAGAGAAGGG + Intergenic
1136156813 16:28388620-28388642 CAGCGCTACCTGGAGGAGAAGGG - Exonic
1136206273 16:28726661-28726683 CAGCGCTACCTGGAGGAGAAGGG + Exonic
1136366590 16:29811955-29811977 CCGGGATTCCTGGAAGAGACGGG - Intronic
1136851997 16:33619527-33619549 CAAGGGTGCCTGGAGGAGAGAGG + Intergenic
1137529222 16:49266540-49266562 CAGTGTGTCTTGCAGGAGAAAGG - Intergenic
1137551832 16:49442813-49442835 TGTGATTTCCTGGAGGAGAAGGG - Intergenic
1137701667 16:50502213-50502235 CAGGCTGACCTGGAGGAGAAGGG + Intergenic
1137724984 16:50650993-50651015 GAGGGCTTCCTGGAGGAGCGGGG - Intergenic
1137789234 16:51160944-51160966 CACGGTTGCCTGGAGTGGAAGGG + Intergenic
1139361084 16:66400694-66400716 GAGGGCTTCCTGGAGGAGCCAGG + Intronic
1139532273 16:67548199-67548221 CAGGGGTCCCTGGAGGAGGCCGG + Intergenic
1139589558 16:67926021-67926043 CAGGGGTTCCTCAAGGTGAAGGG + Intronic
1139773615 16:69298855-69298877 AAAGGTTTCCTGGAGGAGATGGG - Intronic
1140867639 16:79077944-79077966 CAGAGTTTCCTGGAGAAGAAGGG - Intronic
1141288338 16:82693552-82693574 CAGGGTTTAATGTAGGAAAATGG - Intronic
1141633836 16:85303428-85303450 GAGGGCTTCCTGCAGGAGGAGGG - Intergenic
1141656305 16:85418481-85418503 GAGGGCTTCCTGGAGGAGGCGGG - Intergenic
1203113596 16_KI270728v1_random:1467995-1468017 CAAGGGTGCCTGGAGGAGAGAGG + Intergenic
1142596955 17:1034563-1034585 GAAGGCTTCCTGGAGGAGAGGGG + Intronic
1142688294 17:1590593-1590615 CAGGGTTTCCTGGTCCAGGAGGG - Intronic
1142709629 17:1716021-1716043 CAGCCCTTCCGGGAGGAGAAGGG - Intergenic
1143383097 17:6508530-6508552 TAGTGCTTCCTGGAGGAGGAAGG + Intronic
1143604818 17:7976757-7976779 CAGGGACTCCTGCAGGAGGAAGG + Intergenic
1143915212 17:10286594-10286616 CAGGGTTCAGTGGAGGAAAAGGG - Intergenic
1143940332 17:10534237-10534259 CAGGGTTTCCTGGAGGCAGAGGG - Intronic
1144194008 17:12873326-12873348 AAAGGCTTCCTGGAGGAGGAGGG - Intronic
1144266875 17:13578255-13578277 CAGGGTTTCCAGGCCGGGAATGG + Intronic
1144415462 17:15042319-15042341 CAGGGGTTCCTGGAGGATCATGG - Intergenic
1144771075 17:17759970-17759992 GAGGGCTTCCTGGAGGAGATGGG + Intronic
1145272360 17:21411502-21411524 CAGGGTCGCCGGGAGGGGAATGG - Intronic
1145310566 17:21698967-21698989 CAGGGTCGCCGGGAGGGGAATGG - Intronic
1146185195 17:30720071-30720093 GAGGGCTTCCTGGAGGAGGTGGG + Intergenic
1146520994 17:33525450-33525472 GAGGGTTTCCTGCAGAAGATAGG - Intronic
1146839597 17:36141394-36141416 GAGGGTGGCCTGGAGGAGTAGGG + Intergenic
1147760518 17:42795011-42795033 TCGGGTGTGCTGGAGGAGAATGG - Exonic
1147867591 17:43563446-43563468 AAGGTTTTCCTGGAGGGCAAGGG + Intronic
1147906007 17:43823492-43823514 CAAGGCTTCCTGGTGCAGAAGGG - Intronic
1148155553 17:45423490-45423512 GAGTGCTTCCTGGAGGAGGAAGG - Intronic
1148220884 17:45860977-45860999 CATGGGTTCCTGGAGAAGAGGGG - Intergenic
1148443049 17:47721614-47721636 CTGGGTTTCTTCGAGAAGAAGGG + Intergenic
1148606166 17:48930604-48930626 CAGGTGTTCCTGGAGGGAAAAGG + Exonic
1148823616 17:50376157-50376179 CAGTGTCACTTGGAGGAGAAGGG + Exonic
1148891746 17:50812544-50812566 CAGGGTTTCCTGGAGGGTGATGG + Intergenic
1149687081 17:58542185-58542207 CTGGGATTCCAGGAGGGGAAAGG - Intronic
1150127694 17:62648999-62649021 CTGGGTTTCTGGGAGGACAAAGG - Intronic
1150387240 17:64772147-64772169 GAGTGCTTCCTGGAGGAGGAAGG - Intergenic
1151147478 17:72054508-72054530 CAGTGCTTGCTGGAAGAGAAAGG - Intergenic
1151452030 17:74203800-74203822 GAGGGTGTCGGGGAGGAGAAGGG + Intronic
1151727746 17:75894439-75894461 CAGGGGTGCCAGGAAGAGAACGG - Intronic
1151943520 17:77306975-77306997 CAGGGTTACCTGGGGGAGTAGGG + Intronic
1152188090 17:78871064-78871086 CAGGGTGTTCTGGATGGGAACGG - Intronic
1152290727 17:79438601-79438623 CAGGCTTTCCTAGAGGGGAGAGG - Intronic
1152292200 17:79446318-79446340 CATTGCTGCCTGGAGGAGAAAGG - Intronic
1152348609 17:79770233-79770255 TAGGATGCCCTGGAGGAGAAGGG - Intergenic
1152928382 17:83098240-83098262 CAGGGCTTCCCGGAGGGAAAAGG - Intergenic
1152961093 18:80546-80568 GAGGGCTTCCTGGAGGAGGAGGG - Intergenic
1153232393 18:2951348-2951370 AAGCTTTTCCTTGAGGAGAATGG + Exonic
1154323774 18:13375289-13375311 AATGGCTTCCTGGAGGAAAAGGG - Intronic
1154399231 18:14019600-14019622 CAGGGCTTCCTTGAGTGGAAGGG + Intergenic
1154511559 18:15109414-15109436 CTTGGTTGGCTGGAGGAGAAAGG + Intergenic
1155791275 18:29973591-29973613 AAGGGACTCCTCGAGGAGAAGGG - Intergenic
1156460073 18:37316658-37316680 AAGGGCTTCCTGGAGGAGGTGGG - Intronic
1156638938 18:39066461-39066483 CAGGGTTTATTGCAGGAGATAGG + Intergenic
1156898564 18:42274248-42274270 CAGGAATTCCTTGGGGAGAAGGG - Intergenic
1157158245 18:45288473-45288495 CAGGGGTACCTGTAGGGGAAGGG - Intronic
1157294790 18:46434810-46434832 GAGGCCTTCCTGGAGGAGGAAGG + Intronic
1157295311 18:46437924-46437946 CAAGGTTGCCCGGAGGGGAAAGG - Intronic
1157426311 18:47587390-47587412 CAGGGTCTCATGCAGGAGACAGG + Intergenic
1160374092 18:78397900-78397922 CAGGGATTCCTGAAGAAGAGAGG + Intergenic
1160710299 19:548359-548381 GAGGGCTTCCTGGAGGAGGTGGG + Intronic
1162762352 19:12896269-12896291 CGGGGCTTCCTGCTGGAGAAGGG + Exonic
1163187594 19:15649899-15649921 CTGGGCTTCCTGCAGGATAAGGG - Exonic
1163189609 19:15666957-15666979 CTGGGCTTCCTGAAGGATAAGGG - Intergenic
1163217203 19:15889685-15889707 CTGGGTTTCCTGCAGGATAAGGG + Exonic
1164143450 19:22494569-22494591 CAGGGTGGCCTGGATGAGCAGGG - Intronic
1164397745 19:27880672-27880694 GAGGGTTTGCGGGAGGGGAAAGG - Intergenic
1164567651 19:29339406-29339428 GAGGGTTGCCTTGATGAGAAAGG + Intergenic
1164691332 19:30212940-30212962 AGGGCTTTCCTGGGGGAGAAAGG - Intergenic
1165028886 19:32983019-32983041 CAAGGGTGCCTGGAGGAGAGAGG - Intronic
1165169912 19:33884614-33884636 CAGGGTTTTTTGGAGGCAAACGG - Intergenic
1165232008 19:34393176-34393198 CAGGGTTTCCGGCAGGAGGTGGG + Intronic
1165385361 19:35507418-35507440 CAGGGTTGGCTTTAGGAGAAGGG - Intronic
1166151114 19:40876568-40876590 CAGCATTTCCTGGATGACAAGGG - Exonic
1166154722 19:40902330-40902352 CAAGGTTCCCTGGAGGTGACAGG - Intergenic
1166717034 19:44975153-44975175 GAGGGCTTCCTGGAGGAGGTTGG - Intronic
1166763780 19:45240500-45240522 CAGGGTTTCCTTTTGGGGAAAGG + Intronic
1166804801 19:45479583-45479605 GAGAGTTTCATGCAGGAGAATGG - Intergenic
1166891778 19:45998486-45998508 GAGGGCTTCCTGCAGGAGAGGGG + Intronic
1167446213 19:49539105-49539127 CAGGGTTTCCTGGAGGAGAAAGG - Exonic
1168253573 19:55155001-55155023 CTGGGTTTGAGGGAGGAGAAGGG + Intronic
1168383251 19:55941983-55942005 CTGTGTTTCCTGGTAGAGAAGGG + Intergenic
1168487232 19:56774200-56774222 AGGGTTTTCCTGGAGGTGAAGGG + Intergenic
924985266 2:264485-264507 GAGGGGTACCTGGAGGAGGAAGG - Intronic
925162301 2:1694477-1694499 CAAGTTCTCCTGGAGGAGAAGGG + Intronic
926073362 2:9919738-9919760 CAGGGAGTCCTGAAAGAGAAAGG + Exonic
926223383 2:10950929-10950951 AAGGGTTTCCTGGAAGAGGATGG - Intergenic
926688622 2:15717543-15717565 GCAGGTTTCCTGGAGGAAAAGGG + Intronic
927146908 2:20172291-20172313 AAGTGTTTCTTGGAGGAGGAAGG + Intergenic
927203996 2:20595494-20595516 GAGGGCTTCCTGGAGGAGGGAGG + Intronic
927847627 2:26479645-26479667 CATAGTTGCCTGGAGCAGAATGG + Exonic
928194752 2:29207139-29207161 CAGGGATACCTGGAGGATGATGG + Intronic
928936457 2:36683938-36683960 CAGGAGTTCATGGAGGGGAAGGG + Intergenic
929324477 2:40591533-40591555 CAGGGTTTCCAGGTGAGGAAGGG + Intronic
929688952 2:44058877-44058899 GAAAGTTTCCTGGAGGAGACAGG + Intergenic
930028987 2:47046993-47047015 CAGGGTCTCCAGCAGGAGACAGG - Intronic
932192411 2:69752063-69752085 GAAGGCTTCCTGGAGGAGGAAGG + Intronic
933391459 2:81674131-81674153 CTGTGTTTCCTAGAGGAAAAAGG - Intergenic
933878683 2:86646080-86646102 AAGGCTGTCCTGCAGGAGAATGG - Intronic
934897104 2:98128624-98128646 CAGGGTCTCCTGGACCAGCAAGG - Intronic
935217856 2:100988812-100988834 CAGGGGGACCTGGAGGAGCAGGG - Intronic
935217897 2:100988923-100988945 CAGGGAGGCCTGGAGGAGCAGGG - Intronic
935217910 2:100988960-100988982 CAGGGGGGCCTGGAGGAGCAGGG - Intronic
935324269 2:101921772-101921794 CAGAGTTTCCTTGAGCAAAAAGG - Intergenic
935743370 2:106170308-106170330 CAGTGTCTCCTGGAGCAGGAGGG - Intronic
936656547 2:114494757-114494779 CAGGGTTTTCTGCAAGAGTAAGG + Intronic
938511131 2:131946132-131946154 CTTGGTTGGCTGGAGGAGAAAGG + Intergenic
938741607 2:134237549-134237571 CAGAGTTTCCTGGATGAAATGGG + Intronic
940341799 2:152589227-152589249 CAGGCTTGCGTGGAGCAGAAGGG - Intronic
940377871 2:152977184-152977206 CAAGATTCTCTGGAGGAGAAGGG - Intergenic
944169698 2:196760961-196760983 CAAGGTTTTCAGCAGGAGAAAGG - Intronic
945142156 2:206698472-206698494 GAGGGTTCCCGGAAGGAGAAGGG - Intronic
945631916 2:212288630-212288652 CAGGGTTTATTGGATGAAAAGGG - Intronic
945915586 2:215700810-215700832 GAGGCATTCCTGGAGAAGAAGGG + Intergenic
948317138 2:237036881-237036903 CACTGTTTCCTGGAGGGGACTGG - Intergenic
948866162 2:240775852-240775874 CAGGTTTTCCCGGAGGAGCCAGG + Exonic
1169109305 20:3021776-3021798 CAGGGTTGCCTGGAGGGCCAGGG - Intronic
1169974815 20:11312597-11312619 CAAGGTTTCCTGGAGGAAATAGG - Intergenic
1170704532 20:18733314-18733336 CAGGGTGTCCTTAAGCAGAAAGG + Intronic
1170898147 20:20435151-20435173 CAGGGCCTCCTTGAGGAAAAGGG - Intronic
1171983754 20:31645114-31645136 GAGGGCTTCCTGGAGGAGTGGGG + Intergenic
1172641514 20:36443067-36443089 CAGGCTTTCTGGGAGGAGAGAGG - Intronic
1172671258 20:36635769-36635791 CAGGGCTTCCAGGAGGGGAAGGG - Intronic
1172801101 20:37576804-37576826 CATGGTTTCCAGGAGGACACGGG - Intergenic
1172987126 20:39000688-39000710 CTGGGTTTCCTGGAGCAGGATGG + Intronic
1173052886 20:39581857-39581879 CAGGCTTGCCTGGAGTAGAGAGG + Intergenic
1173223912 20:41150669-41150691 CAGAGTATCATGGATGAGAAGGG - Intronic
1173723968 20:45284015-45284037 CAGAGGTTCTTGGAGGAGAGAGG - Intergenic
1173795746 20:45858037-45858059 GAGGGCTGCCTGGAGGAGGAGGG + Intronic
1175249593 20:57601205-57601227 GAAGGCTTCCTGGAGGAGGAGGG - Intergenic
1175320188 20:58080052-58080074 CTGGCTTTGCAGGAGGAGAAAGG - Intergenic
1175486917 20:59353442-59353464 TGGGGTGTCCTGGAGGAGAGGGG + Intergenic
1175489657 20:59371332-59371354 CAGGGTCTCCTCCAGGACAAGGG - Intergenic
1175810943 20:61856959-61856981 GAGGATCTCTTGGAGGAGAAAGG - Intronic
1175998252 20:62820883-62820905 GAGGGCTTCCTGGTGGAGACAGG + Intronic
1176702143 21:10067426-10067448 CAAGGTTTCTTGGAGGGGAGTGG - Intergenic
1176782153 21:13209852-13209874 CTTGGTTGGCTGGAGGAGAAAGG + Intergenic
1177972429 21:27807293-27807315 TGAGGTTTCCTGGAGGAGAAGGG + Intergenic
1177980336 21:27905790-27905812 CTTGGTTGGCTGGAGGAGAAAGG - Intergenic
1179086475 21:38222725-38222747 CAGGGATTCCTGGAGGAAAGAGG + Intronic
1180015050 21:45076167-45076189 GAGGGTTTCCCAGAGGGGAAAGG + Intronic
1180600495 22:17012293-17012315 GAGGGCTTCTTGGAGGAGGAGGG + Intergenic
1180710719 22:17837621-17837643 CAGGGTCTCCTCCAGGAGACAGG + Intronic
1182331752 22:29555887-29555909 CGGGGTTGCCTGAGGGAGAAGGG + Exonic
1182854645 22:33506404-33506426 AAGGGTTTCCTCGAGGACACAGG - Intronic
1183059746 22:35328776-35328798 CAGCGTTGCCTCCAGGAGAAAGG + Intronic
1183518875 22:38284727-38284749 CAGGGTTTCCTAAGGGAGAATGG - Intergenic
1184072923 22:42157209-42157231 CTGGGTATCCTGGAGGGGATTGG + Intergenic
1184311765 22:43650137-43650159 CAGGACCTCCTGGAGGGGAAGGG + Intronic
1184450490 22:44579677-44579699 CAGGGCTTCCTGGAGGAGGTGGG - Intergenic
1184489734 22:44801656-44801678 CAGGGTGGCCTGGGGGACAATGG - Intronic
1184684800 22:46091415-46091437 GAGGGCTTCCTGGAGGAAGAGGG - Intronic
1184684836 22:46091559-46091581 GAGGGCTTCCTGGAGGAAGAGGG - Intronic
1184684845 22:46091595-46091617 GAGGGCTTCCTGGAGGAAGAGGG - Intronic
1184744587 22:46448932-46448954 CAGGGTTTCTAAGAGGAAAAGGG + Intronic
1184849304 22:47110871-47110893 CTGGGTTTCCGGGATGAGTAAGG + Intronic
949460303 3:4284526-4284548 CAGGGTCACCTGTAGCAGAATGG - Intronic
949495713 3:4629806-4629828 GAGGGCTTCCTGGAGGAAGAAGG + Intronic
949516841 3:4815039-4815061 CAGGGGTTCCTGGAAAAGAGAGG - Exonic
950579578 3:13853578-13853600 GTGGGCTTCCTGGAGGAGACAGG - Intronic
952440175 3:33318950-33318972 GTGTGTTTCCTGAAGGAGAAGGG + Intronic
952499155 3:33943385-33943407 CAGGAATTCCTGGTGTAGAATGG + Intergenic
953293119 3:41686340-41686362 CAGGGTTTCTTGGAAGAGGAAGG + Intronic
954647012 3:52137808-52137830 CAGGGTTTCCTGGAGGCCCTCGG - Intronic
954671134 3:52291931-52291953 CAAGGTTGCCTGGGGAAGAAGGG - Intronic
955095132 3:55789690-55789712 CATGGTATGCTGGAAGAGAAAGG + Intronic
955117220 3:56017664-56017686 CAGGGAGTGCTGGAGTAGAATGG - Intronic
955328243 3:58026153-58026175 CAGGGCTTCTTGGAGGAGGGTGG + Intronic
955904975 3:63797368-63797390 CAGAGTTTTCTGCAGGACAAAGG - Intergenic
955945862 3:64192942-64192964 CAGAGTTTCATGGAGCAGCAAGG + Intronic
955950192 3:64235961-64235983 CAGGGGTACCTGGAGAAGAGAGG + Intronic
958167013 3:89889243-89889265 CAGGGATTGCTGGAGGAGATGGG - Intergenic
958476208 3:94586321-94586343 AAGGGTACACTGGAGGAGAATGG - Intergenic
959147733 3:102569745-102569767 CAGTGATTCCTGGAGTGGAATGG - Intergenic
959791714 3:110369311-110369333 CATGGTTTTCTGGAAAAGAAAGG - Intergenic
961317490 3:126050550-126050572 GAGGGTTCCATGGAGGAGACAGG - Intronic
961501123 3:127336838-127336860 CAGGGTTCCATGGAGGACAGTGG + Intergenic
962614244 3:137108994-137109016 CAGGGGTTCGTGGGGGAGAAAGG - Intergenic
962644262 3:137420386-137420408 CAGTGTGTCCAGGAGGAGAAGGG - Intergenic
964060652 3:152518311-152518333 CAGAGTTGCCAGGAGGAGCAGGG - Intergenic
964099930 3:152976949-152976971 CAGGGTTTCATGGAGAAAATTGG + Intergenic
964419539 3:156486688-156486710 CAGGGCCTCCTGGAGGATGAAGG + Intronic
965076712 3:163988716-163988738 CAGGGTTTATTGGAGGGGAAAGG - Intergenic
965604455 3:170484845-170484867 CAGGGTGGGCTGGAGGAGAGTGG + Intronic
967194846 3:187017256-187017278 GAGGGTTTCCTTGGGCAGAATGG - Intronic
967362201 3:188644128-188644150 AAGAAATTCCTGGAGGAGAAGGG + Intronic
968422468 4:497278-497300 CAGGGATCCCTGGAGGAACAAGG + Intronic
968709095 4:2099611-2099633 GAGGGGGTCCTGGAGCAGAAAGG + Intronic
968717079 4:2168257-2168279 CATGGATTCATGGAGGAAAAGGG + Intronic
968872128 4:3247475-3247497 CAGGGCTTCCTAGAGGAGGTAGG + Exonic
969370943 4:6731310-6731332 TAGGGTTGCCTAGAGGAGGAAGG + Intergenic
969600286 4:8172006-8172028 CAGGGAGTCCTTGAAGAGAAAGG + Intergenic
969731621 4:8960922-8960944 CAGGGTTCACCGGAGGAGATGGG - Intergenic
970225158 4:13850080-13850102 CAAGGTTTGCAGCAGGAGAAAGG - Intergenic
970608533 4:17704771-17704793 CAGGGTCTTTTGGAGGAGATGGG - Intronic
970838940 4:20443885-20443907 CAGAGATTCAAGGAGGAGAAAGG + Intronic
970929946 4:21498019-21498041 CAGGGCTTTCTGAAGGAGTATGG - Intronic
971378390 4:26073969-26073991 CAGGGTTTCCTGGTGGCCCATGG - Intergenic
971384745 4:26132618-26132640 AGGGGTTTCCTGGAAGAAAAGGG - Intergenic
972050583 4:34727767-34727789 GATGTTTTCCTGGAGGAGGAGGG + Intergenic
972775943 4:42240587-42240609 CAAGAATTTCTGGAGGAGAAAGG - Intergenic
976758541 4:88523798-88523820 CAGCGTTTCCTGGAGGACCAGGG - Exonic
978198588 4:105998442-105998464 CTGGGATTTCTGGAGGAAAAGGG + Intronic
979241405 4:118450049-118450071 CAAGGTTCCCTGGAGCAGAGAGG + Intergenic
979866811 4:125766149-125766171 CAGGGTTTCATGGAGGAGATAGG + Intergenic
980566686 4:134551568-134551590 CATGGCTTTCTGGAAGAGAATGG - Intergenic
982173930 4:152687639-152687661 CAGTGGTTCCTGCAGGAGAAGGG - Intergenic
983810015 4:172050196-172050218 CAAGGTTTGCAGCAGGAGAAAGG + Intronic
985102940 4:186475966-186475988 CACGGCTTCCTGGAGGCAAAAGG - Intronic
985197507 4:187448154-187448176 GATGGTTTTATGGAGGAGAATGG - Intergenic
985882912 5:2654031-2654053 CAGGTTTTCCTGGAAGACGAGGG - Intergenic
986019492 5:3787890-3787912 CAAGGTCAACTGGAGGAGAAAGG + Intergenic
986071053 5:4283574-4283596 CACGTCTTCCTTGAGGAGAAAGG - Intergenic
986388331 5:7261302-7261324 CAGGGATTCCTGCAGGAGTGGGG + Intergenic
986805257 5:11302892-11302914 CGAGGTTTCTTGGAGGAGAAAGG - Intronic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
988952882 5:36282771-36282793 GGGGGTTCCCTAGAGGAGAATGG - Intronic
991419152 5:66423422-66423444 TAGGGTTTCCAGAAGAAGAAGGG + Intergenic
993116192 5:83722358-83722380 CAGGGCGTCCTGGAGGTGCAAGG + Intergenic
994403478 5:99313937-99313959 GAGAGTTTCCTGGAGGAAATTGG + Intergenic
996013356 5:118504843-118504865 TAGGGTTTCCTGGAGGAAGGAGG - Intergenic
997302095 5:132813679-132813701 CTGGGCTTCCTGCAGGAGCACGG + Exonic
997423511 5:133787476-133787498 CATGTCTTCCTGGAGGAGCACGG + Intergenic
997436629 5:133880387-133880409 GAGGGCTTCCTGGAGGAGGCAGG - Intergenic
999538159 5:152541483-152541505 GAGGGTTTTATGAAGGAGAAGGG + Intergenic
999553897 5:152720471-152720493 GAGGGGATCCCGGAGGAGAATGG - Intergenic
999629096 5:153551732-153551754 CAGGGGTTCAGGGAGGAGGATGG - Intronic
1000101897 5:158024335-158024357 TTGGGATTCCTGGAGCAGAAAGG + Intergenic
1000961157 5:167602890-167602912 GAGGGCTTCCTGGAAGAGAATGG + Intronic
1001510200 5:172315270-172315292 CAGGGTTGTCTGGGAGAGAAGGG - Intergenic
1001892716 5:175352593-175352615 CAGGGTCTCCTGGTCCAGAAGGG + Intergenic
1002051956 5:176576291-176576313 CAGGGTGTGATGGCGGAGAATGG + Intronic
1002310399 5:178310407-178310429 CAGGGAGTCCTGGAGGAAAAGGG - Intronic
1002342456 5:178526094-178526116 GAGGGCTTCCTGAAGGAGAGAGG + Intronic
1002806214 6:576874-576896 CTGGGTTACCTGGGGAAGAAAGG + Exonic
1002855036 6:1028839-1028861 TAGCTTTTCCTGGAGGTGAAGGG + Intergenic
1002895772 6:1379295-1379317 CAGGGTATTCTGGAGCAGGAGGG + Intergenic
1003400392 6:5785864-5785886 CAGGGATCCCTGGAGGCCAAGGG - Intergenic
1004251155 6:14024236-14024258 CAGAGCTTCAGGGAGGAGAAAGG - Intergenic
1004713753 6:18196881-18196903 CCTGGTTTCCAGGAGGAGATTGG - Intronic
1005015990 6:21375984-21376006 CAGGCTTTCCAGGAGCAGCATGG + Intergenic
1005044583 6:21629558-21629580 AATGGTGGCCTGGAGGAGAATGG - Intergenic
1005882116 6:30069821-30069843 AAGGGTTAGCAGGAGGAGAAGGG - Exonic
1006515877 6:34545298-34545320 CAGGCTTTCCAGGAGGAGCCAGG + Intronic
1006645105 6:35510364-35510386 GAAGGTTTCCTGGAGGACATGGG - Intronic
1006986545 6:38179400-38179422 CAGGGTTCCCTGGAAGGGACGGG + Intronic
1007221614 6:40283302-40283324 AAAGGTTTTCTGGAGGTGAAAGG - Intergenic
1007478342 6:42133999-42134021 CAGGTTCTCCTGAGGGAGAAGGG - Intronic
1009418941 6:63443750-63443772 CAGGGTTTCCTGGTGGAATGAGG + Intergenic
1009571427 6:65390412-65390434 TAGGGTTTTCAGAAGGAGAAGGG + Intronic
1011559062 6:88596872-88596894 CTGGGTTTCCTGGAAGGGCACGG - Intergenic
1011922437 6:92596436-92596458 TAGTGTTTGCTGGAGGATAATGG + Intergenic
1012258912 6:97065000-97065022 CAGGGTTCCCTGCAGGAGCCGGG + Intronic
1014026519 6:116653430-116653452 AAGGGTTTCCTAGAAGAAAATGG + Intronic
1014145008 6:117987503-117987525 CTGGGTGTCCTGGAGGAAGAGGG - Intronic
1014250332 6:119109082-119109104 AAGGGTTTCATGGAGGAGATAGG - Intronic
1018628917 6:165805502-165805524 CAGGGGCTCTTGGTGGAGAAAGG - Intronic
1019761582 7:2816666-2816688 CAGGGTTTCCTCGGTGGGAAGGG + Intronic
1019777251 7:2919192-2919214 AAGGGCTTCCTGGAGGAGGAGGG + Intronic
1019907084 7:4072954-4072976 CAGAGTTTACTGAAGGAGAGTGG - Intronic
1021863714 7:24933027-24933049 CACGGTTCACAGGAGGAGAATGG + Intronic
1022314843 7:29236149-29236171 TAAGCTTCCCTGGAGGAGAAAGG + Intronic
1022981674 7:35610470-35610492 CCCTGTTTCCTGGAGGAGGAAGG - Intergenic
1023913309 7:44570278-44570300 CAGGGTTTCCTGGGGCAGCCTGG + Intronic
1024691588 7:51808928-51808950 CAGGGTTCCCAGGAAGAAAAAGG - Intergenic
1025088768 7:56045135-56045157 CAGTCATTCATGGAGGAGAAGGG + Intronic
1026604385 7:71803445-71803467 CAGGGTTTCCTGGAGCAGTCAGG + Intronic
1027151008 7:75733636-75733658 CAAGGCTTCCTGGAGGAGGCTGG + Intronic
1027229600 7:76264555-76264577 CAGGACTTCCAGGAGGAGGAAGG + Intronic
1027249469 7:76389989-76390011 GAGGGCTTCCTGGAGGAGGAAGG + Exonic
1027508196 7:79045224-79045246 GAGGTTTTCCTGTAGCAGAAGGG + Intronic
1029111487 7:98214971-98214993 CAGTGTTTCGAGGAGGAGAGGGG + Exonic
1029365156 7:100111991-100112013 CAGGGCTTCCTGTGGGAGGAGGG + Exonic
1033229196 7:139583446-139583468 CAGGGCTTCCTGGCAGAGAGTGG + Intronic
1034107190 7:148500538-148500560 AGAGTTTTCCTGGAGGAGAAGGG - Intergenic
1034971833 7:155424105-155424127 GAGGGTGTCCTGGAGGGGAACGG - Intergenic
1035037580 7:155905410-155905432 CAGGGGCTCCTGGAGGAGTGTGG - Intergenic
1035786818 8:2267868-2267890 CAGGGTTATCTGCAGGAGACAGG - Intergenic
1035805989 8:2453848-2453870 CAGGGTTATCTGCAGGAGACAGG + Intergenic
1036155114 8:6334585-6334607 TATGATTTCCAGGAGGAGAAGGG - Intergenic
1037627299 8:20619222-20619244 CTGGGAATCCTGGGGGAGAATGG + Intergenic
1037779101 8:21855643-21855665 GAAGGCTTCCTGGAGGAGATGGG - Intergenic
1037781734 8:21874085-21874107 CATGTGCTCCTGGAGGAGAAAGG + Intergenic
1037909818 8:22737670-22737692 CAGGCTGCCCTGCAGGAGAATGG - Intronic
1038035444 8:23682785-23682807 CAGGATGTCCTGGATGAGGAAGG + Exonic
1040550286 8:48432187-48432209 ATGGGCTTCCTGGAGGAGGAGGG + Intergenic
1041189225 8:55336692-55336714 AATGGTTGCCTGGGGGAGAAAGG + Intronic
1042024602 8:64409574-64409596 CATGGTTTTCAGGAGGACAAAGG + Intergenic
1043141814 8:76599774-76599796 GAGAGCTTCCTGGAGGATAAAGG - Intergenic
1043529633 8:81135203-81135225 GAGGGTTTTCTGCAGGAGAGTGG - Intergenic
1045242073 8:100411312-100411334 TAGGGTTTCCTGTATAAGAAAGG + Intergenic
1045268750 8:100643954-100643976 GAGGACTTCCTGGAGGAGATGGG + Intronic
1045898649 8:107247811-107247833 CATCTTTTTCTGGAGGAGAATGG + Intergenic
1047190775 8:122677348-122677370 CAGGGGTTGGTGGGGGAGAAAGG + Intergenic
1048550879 8:135432823-135432845 CAGGGTATCCTGGATGAGGCAGG + Intergenic
1048965393 8:139611033-139611055 CAGGGCTTCATGGAGGAAATGGG - Intronic
1048986790 8:139739082-139739104 CAGGGTTGCCCAGAGGAGCACGG - Intronic
1049199707 8:141334087-141334109 AAGGACTTCCTGGAGGAGGAGGG + Intergenic
1049251957 8:141593983-141594005 CAGGGGTCCCAGGAGCAGAACGG + Intergenic
1049352197 8:142170343-142170365 GAGGGCTTCCTGGAGGAGGAGGG + Intergenic
1049571309 8:143371470-143371492 CAGGGGATCCTGGGGGAGAGTGG + Intronic
1050602624 9:7267954-7267976 TAAGGCTTCCTGGAGGAGATGGG - Intergenic
1051105727 9:13577878-13577900 CAGCGTTGACTGGAAGAGAATGG + Intergenic
1051471767 9:17451692-17451714 CAGGGTTTCTTGGAGGCCCATGG - Intronic
1051705851 9:19878874-19878896 GGGGGTTTTCTGGGGGAGAAGGG - Intergenic
1052017542 9:23486657-23486679 CAGGGGATTCTGGAGAAGAAAGG + Intergenic
1052049394 9:23827697-23827719 TAGGGTGTCATGGAGGGGAATGG + Intergenic
1052816559 9:33106646-33106668 CAGGGCTTCCTGGAGCATCACGG - Intronic
1053298854 9:36934660-36934682 GAGGGCTTCCTGGAAGAGGAAGG - Intronic
1053639289 9:40053836-40053858 CAAGGTTTCTTGGAGGGGAGTGG - Intergenic
1053766789 9:41411268-41411290 CAAGGTTTCTTGGAGGGGAGTGG + Intergenic
1054320092 9:63650500-63650522 CAAGGTTTCTTGGAGGGGAGTGG - Intergenic
1054545456 9:66322782-66322804 CAAGGTTTCTTGGAGGGGAGTGG + Intergenic
1055042236 9:71886709-71886731 CAGGGTTTCATGGATGAAACGGG + Intronic
1055950053 9:81722084-81722106 CTTGGTCTCCTGGAGGAGAAAGG + Intergenic
1056032373 9:82566507-82566529 GAGGGTTTCATGGAGAAGATAGG - Intergenic
1056724936 9:89106502-89106524 CAGGGCAGCCTGGAGGAGCAGGG + Intronic
1057179581 9:93022487-93022509 CAGGGCCTCCTGGAGGCGGAGGG + Intronic
1057279048 9:93697490-93697512 GAGGGATTCCTAGGGGAGAAGGG - Intergenic
1057732090 9:97618840-97618862 GAAGGTTTCATGGAGGAGCATGG - Intronic
1058702098 9:107609675-107609697 CAGGGCTTCCAGGATGAGAAAGG - Intergenic
1059275797 9:113096077-113096099 AAGTGTGTCCTGGAGGAGAATGG - Intergenic
1060000362 9:119952990-119953012 TAGGGTTGTCTGTAGGAGAAGGG - Intergenic
1060027784 9:120187573-120187595 CTGGGAATCCTGGAGGAGCAGGG - Intergenic
1060557469 9:124516029-124516051 CAGAGGTGCCGGGAGGAGAAGGG - Intergenic
1060736130 9:126067526-126067548 GAGGCCTTCCTGGAGGAGGAGGG - Intergenic
1060886225 9:127154291-127154313 CAGGGTGTCCTGGAGAAGGGTGG + Intronic
1060948620 9:127586409-127586431 CAGGGTTTCCCTGAGGACAGAGG - Intergenic
1061913148 9:133735366-133735388 GAGGGTTTCCTGAAGGAGGAGGG - Intronic
1062277616 9:135738164-135738186 GAGGGCTTCCTGGAGGAGGTGGG - Intronic
1062374745 9:136256833-136256855 GAGGGTCTCCTGGAGGGCAAAGG + Intergenic
1062737068 9:138143440-138143462 GAGGGCTTCCTGGAGGAGGAGGG + Intergenic
1202787160 9_KI270719v1_random:37511-37533 CAAGGTTTCTTGGAGGGGAGTGG - Intergenic
1188422152 X:30003283-30003305 AAGGGGTTTGTGGAGGAGAAAGG - Intergenic
1189800405 X:44686757-44686779 AAGGGTTTTGTGGAAGAGAAAGG + Intergenic
1190289250 X:48981426-48981448 CAGAGGATCCTGGAGAAGAAGGG - Exonic
1190399281 X:50015350-50015372 CAGGATGTCCTGGAAGATAAAGG - Intronic
1191674926 X:63784335-63784357 CAAGGTCTCCAGGTGGAGAAGGG + Intronic
1193176617 X:78401805-78401827 TTGGGTTTCCTGAAGGAGATGGG + Intergenic
1194444384 X:93969632-93969654 CAATGTTTCCTGGGGAAGAAAGG + Intergenic
1194708002 X:97199662-97199684 CAGGGCTTGGTGGAGGAGTAGGG + Intronic
1196030072 X:111087173-111087195 CAGGGTTTGCTGTGGGAGAGAGG + Intronic
1197049739 X:122043996-122044018 CTGGTGTTCCTGAAGGAGAAGGG - Intergenic
1198154495 X:133945515-133945537 TAGAGGTTCCTGGAGGAGACTGG - Intronic
1199976955 X:152899761-152899783 GAAGGCTTCCTGGAGGCGAAGGG + Intergenic
1200033208 X:153312651-153312673 GGGGCTTTCCAGGAGGAGAATGG + Intergenic
1200093101 X:153644826-153644848 GAGGGTTCCCTGGAGGTGAGAGG - Intronic
1200392478 X:155957895-155957917 CAGTGTTTCCTGAAAAAGAAAGG - Intergenic
1200399255 X:156009701-156009723 GAGGGCTTCCTGGAGGAGGAGGG + Intronic
1200921555 Y:8617965-8617987 CAGGTCTTGCTGGAGGAGGATGG - Intergenic
1200937272 Y:8749195-8749217 CATGTTTTGCTGGAGGAGGAGGG + Intergenic
1202389118 Y:24351878-24351900 CAAGGTTCCCTGGAGCAGAGAGG + Intergenic
1202481669 Y:25318246-25318268 CAAGGTTCCCTGGAGCAGAGAGG - Intergenic