ID: 1167447794

View in Genome Browser
Species Human (GRCh38)
Location 19:49548737-49548759
Sequence GATCAGTGAGCTGAGATCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167447794_1167447797 26 Left 1167447794 19:49548737-49548759 CCACTGATCTCAGCTCACTGATC No data
Right 1167447797 19:49548786-49548808 CTTCAGCCTCCCTAGTAGCTGGG 0: 375
1: 17282
2: 225605
3: 281316
4: 182884
1167447794_1167447796 25 Left 1167447794 19:49548737-49548759 CCACTGATCTCAGCTCACTGATC No data
Right 1167447796 19:49548785-49548807 GCTTCAGCCTCCCTAGTAGCTGG 0: 280
1: 14260
2: 204825
3: 263475
4: 185241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167447794 Original CRISPR GATCAGTGAGCTGAGATCAG TGG (reversed) Intergenic
No off target data available for this crispr