ID: 1167447797

View in Genome Browser
Species Human (GRCh38)
Location 19:49548786-49548808
Sequence CTTCAGCCTCCCTAGTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 707462
Summary {0: 375, 1: 17282, 2: 225605, 3: 281316, 4: 182884}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167447795_1167447797 -1 Left 1167447795 19:49548764-49548786 CCAGCTGCAAGCGATTCTCGTGC No data
Right 1167447797 19:49548786-49548808 CTTCAGCCTCCCTAGTAGCTGGG 0: 375
1: 17282
2: 225605
3: 281316
4: 182884
1167447794_1167447797 26 Left 1167447794 19:49548737-49548759 CCACTGATCTCAGCTCACTGATC No data
Right 1167447797 19:49548786-49548808 CTTCAGCCTCCCTAGTAGCTGGG 0: 375
1: 17282
2: 225605
3: 281316
4: 182884

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167447797 Original CRISPR CTTCAGCCTCCCTAGTAGCT GGG Intergenic
Too many off-targets to display for this crispr