ID: 1167448734

View in Genome Browser
Species Human (GRCh38)
Location 19:49554957-49554979
Sequence CCCCCACCTGTGGCAGCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167448734_1167448738 9 Left 1167448734 19:49554957-49554979 CCTCAGGCTGCCACAGGTGGGGG No data
Right 1167448738 19:49554989-49555011 CCTGACCGCCTTTCCTAGTCCGG No data
1167448734_1167448739 10 Left 1167448734 19:49554957-49554979 CCTCAGGCTGCCACAGGTGGGGG No data
Right 1167448739 19:49554990-49555012 CTGACCGCCTTTCCTAGTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167448734 Original CRISPR CCCCCACCTGTGGCAGCCTG AGG (reversed) Intergenic
No off target data available for this crispr