ID: 1167450116

View in Genome Browser
Species Human (GRCh38)
Location 19:49562441-49562463
Sequence CTGGCTCTAAATCATTTTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 203}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167450116_1167450125 16 Left 1167450116 19:49562441-49562463 CCCTTAAAATGATTTAGAGCCAG 0: 1
1: 0
2: 0
3: 17
4: 203
Right 1167450125 19:49562480-49562502 TGTAATCCCAAAACTTTGGGAGG 0: 489
1: 28405
2: 332287
3: 259316
4: 132713
1167450116_1167450128 29 Left 1167450116 19:49562441-49562463 CCCTTAAAATGATTTAGAGCCAG 0: 1
1: 0
2: 0
3: 17
4: 203
Right 1167450128 19:49562493-49562515 CTTTGGGAGGCTGAAGCAAGAGG 0: 87
1: 2811
2: 33916
3: 92220
4: 171296
1167450116_1167450123 13 Left 1167450116 19:49562441-49562463 CCCTTAAAATGATTTAGAGCCAG 0: 1
1: 0
2: 0
3: 17
4: 203
Right 1167450123 19:49562477-49562499 GCCTGTAATCCCAAAACTTTGGG 0: 377
1: 22173
2: 255506
3: 275977
4: 168836
1167450116_1167450122 12 Left 1167450116 19:49562441-49562463 CCCTTAAAATGATTTAGAGCCAG 0: 1
1: 0
2: 0
3: 17
4: 203
Right 1167450122 19:49562476-49562498 CGCCTGTAATCCCAAAACTTTGG 0: 204
1: 12251
2: 154938
3: 291395
4: 213822

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167450116 Original CRISPR CTGGCTCTAAATCATTTTAA GGG (reversed) Intronic
901576652 1:10206456-10206478 CTGTCTCTAAATCAATTAATCGG + Intergenic
908917305 1:69143710-69143732 TTAGCTATAAATCATTTTAGTGG - Intergenic
909566095 1:77054976-77054998 CTGACTCAAAGTCATTTGAATGG + Intronic
910278599 1:85474162-85474184 GTGGATTTGAATCATTTTAAGGG - Intronic
915023342 1:152802923-152802945 CTGTCTATCAATAATTTTAAAGG + Intronic
916330291 1:163608541-163608563 CTGGCTCTGAAACATTTACAAGG - Intergenic
916400379 1:164441285-164441307 ATGGCTTTAACACATTTTAATGG - Intergenic
918871505 1:189980960-189980982 CTGTCTCTACATCCTTTTTATGG + Intergenic
919288040 1:195590761-195590783 CTGGATCTCATTCATTTTTATGG - Intergenic
1069777247 10:70934331-70934353 CTGGCACTAAAGCGTTTTCAGGG + Intergenic
1072661392 10:97365725-97365747 CTGCCTCTAAATCATCTTCAGGG + Intronic
1073672075 10:105602472-105602494 CTGGCTGTAAGTCTTTATAAGGG - Intergenic
1074776510 10:116771525-116771547 CTGGGTCTGAATCATTTCCAGGG + Intergenic
1074936935 10:118190961-118190983 CTTGCTCTACACCATCTTAATGG - Intergenic
1075933910 10:126323442-126323464 CAGCCTCCAAATGATTTTAAAGG + Intronic
1079069617 11:17332715-17332737 CTGTCTCTAAAAAATTTAAAAGG - Intronic
1080186216 11:29490230-29490252 CTGTCTCTACATCATTTTAGAGG + Intergenic
1081319226 11:41669869-41669891 CTTTCTCTACATCCTTTTAAAGG - Intergenic
1082099839 11:48163428-48163450 CTGGATCTAAATCATTTTCTGGG + Intronic
1082709033 11:56530409-56530431 CTTGCTCTACATCAGTTGAAGGG - Intergenic
1082986625 11:59174830-59174852 CTTGCCCTGAATCATTTTAAAGG + Intronic
1086071941 11:82809464-82809486 CTGGCTATAAAGCATATTATTGG + Intergenic
1088072586 11:105808494-105808516 CTTGATCTAAAATATTTTAATGG + Intronic
1090532714 11:127607809-127607831 CTGCCTCTAAATCATGGCAAAGG - Intergenic
1091480633 12:826629-826651 CTACCTCTTAATCATTTAAATGG + Intronic
1093120299 12:15262792-15262814 CTGGATATAAATAATTTGAAAGG + Intronic
1093818611 12:23582869-23582891 CTGGCCCTTAATTAATTTAAAGG + Intronic
1096044057 12:48546302-48546324 CTGGATCTCAGTCTTTTTAATGG - Intergenic
1097000994 12:55876522-55876544 CTGGCTTTAAAGGATTTAAAGGG - Intergenic
1097132036 12:56818839-56818861 CTTGCTGAAAATCATTTTCAAGG + Intergenic
1097576986 12:61406905-61406927 CTGGTTCTGAAGCATTTTATAGG + Intergenic
1100782783 12:98047169-98047191 CTAGCCCTAAATCATTGCAAGGG + Intergenic
1101006729 12:100408225-100408247 TTTGCTTTAAATGATTTTAATGG - Intronic
1101134065 12:101721376-101721398 CTTGCTCCAAATGACTTTAAAGG - Intronic
1101569562 12:105940667-105940689 CTGCCTTTAAACCAATTTAAAGG + Intergenic
1103514640 12:121499645-121499667 CTGTCTCTAAATAATAATAATGG + Intronic
1103768389 12:123299955-123299977 CTGGTTCTAAATCACATTAGTGG + Intronic
1104252085 12:127104788-127104810 CTGGCTCAAGGTCATTTTTATGG - Intergenic
1104335880 12:127894508-127894530 GTGGCACAAAATCAGTTTAATGG + Intergenic
1106412525 13:29520505-29520527 CAGGTTTTAATTCATTTTAAAGG - Intronic
1107538988 13:41367844-41367866 ATGGTTCTAAATTACTTTAATGG + Intronic
1107703039 13:43068252-43068274 CAGGTTCTAAATTATTTTGAGGG - Intronic
1107872084 13:44756561-44756583 CTGGCTATAAATTATATTACAGG + Intergenic
1108317471 13:49250890-49250912 CTGGCTCTACATGTTATTAACGG + Intronic
1110078033 13:71274760-71274782 CTGACTCTAAATCATGTAAGTGG + Intergenic
1110482549 13:75997052-75997074 CTGGTTCAAAAACATCTTAAGGG - Intergenic
1113748689 13:112763994-112764016 ATGGCTCTCAATCAATTTAGGGG - Intronic
1117917963 14:60698490-60698512 CTGTCTCTAACTTTTTTTAAAGG - Intergenic
1120319974 14:82947102-82947124 ATGACTATACATCATTTTAAAGG - Intergenic
1126032639 15:44514899-44514921 CTGATTCTATTTCATTTTAATGG + Intronic
1129151067 15:73688055-73688077 CTGGCTCTGACTCATTCTAGTGG - Intronic
1129182065 15:73883879-73883901 CTGGCTCTACATCTTAATAACGG - Intronic
1131818989 15:96252402-96252424 CTGCCTCCTAATCATTTCAATGG - Intergenic
1132919434 16:2377752-2377774 CCGGCCCTATATCATTTTTAAGG - Intergenic
1133620484 16:7521376-7521398 CTGGCTTAAACTCTTTTTAATGG - Intronic
1136097596 16:27968545-27968567 CCGGCCCTAAAACATTTTCATGG + Intronic
1137927937 16:52559058-52559080 CAGACTCAAAATCATCTTAAAGG + Intergenic
1139787814 16:69408065-69408087 CAGGCTCTAAATCAATTGAGGGG - Intronic
1143718515 17:8793746-8793768 ATGGATCTAAAAGATTTTAAGGG - Intergenic
1144112922 17:12055538-12055560 CTAGCTCAAAATTATTTTTATGG - Intronic
1147195500 17:38763835-38763857 CTGGCCCTGAATCATTTTCTGGG + Intronic
1149224262 17:54450468-54450490 CTAGCTTTAAATCAGTTTCAGGG - Intergenic
1150361314 17:64536944-64536966 CAGGCTTAAAATCATTTTAATGG - Intronic
1150707767 17:67503091-67503113 CAGGCTCTATTTCTTTTTAAAGG + Intronic
1152477569 17:80528129-80528151 CTGGCTCAGATTCATTCTAAAGG + Intergenic
1153358723 18:4168878-4168900 CTGGCTCTCATTTCTTTTAAAGG + Intronic
1153426220 18:4967451-4967473 CAGGATCTCAATCATTTTTATGG - Intergenic
1153486965 18:5608620-5608642 CTGGCTCATAATCAATTTAAAGG + Intronic
1156732942 18:40217225-40217247 CTTGCTCTAATTTTTTTTAAAGG + Intergenic
1158016069 18:52785635-52785657 ATTGCTCTCAATCATTCTAATGG + Intronic
1159394284 18:67836080-67836102 CTGGATCTCATTCTTTTTAATGG + Intergenic
1159818770 18:73113185-73113207 TTGGTTCTAAATTATTTTAGAGG - Intergenic
1160060000 18:75521306-75521328 CTTGCTTTAAAGCATTGTAATGG - Intergenic
1161621787 19:5301610-5301632 CTGGCTGTAAATGCATTTAATGG + Intronic
1163456128 19:17406643-17406665 CTGGCTCTAAGTGGCTTTAATGG - Intronic
1167324004 19:48813020-48813042 CTGGCTGCAAATCGTTTTTATGG + Exonic
1167450116 19:49562441-49562463 CTGGCTCTAAATCATTTTAAGGG - Intronic
1167978101 19:53248668-53248690 TTGGCTCTTAATCTTTTTGAGGG + Intronic
925814015 2:7729515-7729537 CTGGCTTTAATTTATTTAAATGG - Intergenic
926861700 2:17316984-17317006 CTGGCTCTTATACTTTTTAATGG - Intergenic
929747212 2:44671425-44671447 CTGGCTCTAAATAAATTACAAGG - Intronic
930589282 2:53307936-53307958 CTGCCTGTTGATCATTTTAATGG - Intergenic
931217419 2:60259514-60259536 CTGGCTCTTCAACATATTAAGGG + Intergenic
933585249 2:84173180-84173202 CTGGCTCTATTTCTTTTTTAGGG + Intergenic
936103342 2:109602855-109602877 CAGGCTTTAAGTCCTTTTAATGG - Intronic
936748822 2:115615030-115615052 TTGGCTTGTAATCATTTTAAAGG - Intronic
937156919 2:119726345-119726367 CTGGGTCAAAAGCATTTTTAGGG - Intergenic
940249555 2:151659595-151659617 CTGGCCCAAAAAAATTTTAATGG + Intronic
941803277 2:169684950-169684972 CTGGCCCTAATTCCTTTTTATGG + Intronic
942740316 2:179168971-179168993 ATGTCTCTTAATTATTTTAATGG - Intronic
943189251 2:184654798-184654820 CTGGTTCTAAAGCATATTACAGG - Intronic
943490146 2:188542938-188542960 CTGACTCTGAAACATTTCAAAGG - Intronic
945125413 2:206504376-206504398 CTGGCTCTAACACATTAAAAAGG - Intronic
946640220 2:221775848-221775870 CTGGCACATAATGATTTTAATGG - Intergenic
948297336 2:236871492-236871514 CTAGCTCTACATCATTCTCAAGG + Intergenic
1169799146 20:9497271-9497293 CTGTCTGTAAATTATTTTTAAGG + Intergenic
1170822343 20:19765313-19765335 CTGGCTCTAATTCAATGTCATGG - Intergenic
1172804908 20:37604838-37604860 CCCGATCTAAATGATTTTAAAGG - Intergenic
1173347963 20:42218176-42218198 ATGGCCCTCCATCATTTTAATGG - Intronic
1173683364 20:44903716-44903738 TTAGCTCTGCATCATTTTAAAGG + Intronic
1174619713 20:51864731-51864753 CTGGCCTGAACTCATTTTAAAGG - Intergenic
1174986545 20:55460569-55460591 TTTCCTCTAAATCATTTTAGTGG + Intergenic
1175681117 20:60989637-60989659 CTGTGTTTAAATCATCTTAAAGG + Intergenic
1177041029 21:16111721-16111743 CTGGCCCGAAATAATTTTGAAGG - Intergenic
1177815571 21:25972696-25972718 CAGTCTCTAAGACATTTTAAAGG + Intronic
1181845155 22:25700958-25700980 TTAGCTCTACATCATTTTCATGG - Intronic
1182060968 22:27397098-27397120 CTGAATGAAAATCATTTTAAGGG + Intergenic
949848390 3:8395591-8395613 ATGGCTCTATAGGATTTTAATGG + Intergenic
952594797 3:35003744-35003766 CTGGCAATAAAACATATTAATGG + Intergenic
952788391 3:37177349-37177371 CTGTCTCTAAAGCCTTCTAAGGG + Intronic
953047705 3:39310140-39310162 CTGGCTGTAAAATAATTTAATGG + Intergenic
954944886 3:54413678-54413700 CAGTCACTAAATGATTTTAATGG - Intronic
955775799 3:62431655-62431677 CTGGTTCAAAATAAATTTAAGGG + Intronic
957123404 3:76126113-76126135 CTGCATCAAAATAATTTTAAAGG + Intronic
957734218 3:84186038-84186060 CTGGATTTAAAGCTTTTTAATGG + Intergenic
958542776 3:95501038-95501060 CTGGATTTCAGTCATTTTAATGG - Intergenic
960206920 3:114913260-114913282 TTGGATGTAAGTCATTTTAACGG + Intronic
960394784 3:117123256-117123278 TTGGCTCTCATGCATTTTAAAGG - Intronic
960933693 3:122881438-122881460 CTGGCTTTGAATCATCTTCAAGG - Intergenic
962605338 3:137028136-137028158 CAGGCTCTCACTCATTTTTATGG - Intergenic
965324423 3:167285187-167285209 GTGACTTTAAATCATATTAATGG + Intronic
966176769 3:177146968-177146990 CTGAATCTGAATCATTTTAATGG - Intronic
966192263 3:177281887-177281909 ACTGCTCTAAATGATTTTAAAGG + Intergenic
966579042 3:181538460-181538482 GTGGCTATAAAGCATTTGAAAGG + Intergenic
967306956 3:188068589-188068611 ATGGCTCTCAGTTATTTTAATGG - Intergenic
970357871 4:15275577-15275599 CAGGATCTCATTCATTTTAATGG - Intergenic
970434087 4:16016117-16016139 CTGATTTTATATCATTTTAAAGG - Intronic
971275887 4:25196138-25196160 CTAGCACTAAATCTTTTTAGTGG - Intronic
971523186 4:27581430-27581452 CTGGATCTCATTCATTTTTATGG + Intergenic
973028033 4:45298810-45298832 GTGGTTCTAAATGAATTTAAAGG - Intergenic
973056582 4:45666820-45666842 CTGGGTCAAAATCATCTTTAGGG + Intergenic
973119762 4:46507233-46507255 CTGGGTCTAAATAATACTAATGG - Intergenic
974470103 4:62308608-62308630 CTGGATCTTACTCATTTTTAGGG - Intergenic
974757746 4:66233419-66233441 CAGGCCTTAATTCATTTTAATGG + Intergenic
975471939 4:74779788-74779810 CTTACTCTAACTCATTTAAAGGG - Intronic
975863014 4:78697788-78697810 CTGGCTCAAAAAACTTTTAAAGG + Intergenic
978032942 4:103958271-103958293 CTGGCTCTCATTCCTTTTAATGG - Intergenic
978284862 4:107064384-107064406 CTCTCTGTAAATCCTTTTAATGG - Intronic
978383850 4:108160366-108160388 CTGGCTCTAAAATATTTAACAGG + Intronic
984964072 4:185126141-185126163 CTGGCCCCACCTCATTTTAATGG - Intergenic
986183960 5:5419249-5419271 CTGGCTTCAAATCACTTTGAGGG + Intergenic
988577486 5:32441642-32441664 CTGGCTGGAAATAATTATAATGG - Intronic
988939858 5:36133217-36133239 CTGGATCTCATTCTTTTTAATGG - Intronic
989217583 5:38921256-38921278 ATGGTTCTAAGACATTTTAAGGG - Intronic
990750278 5:59007476-59007498 CTGCCTCTAAAATATTTTTAAGG - Intronic
993847899 5:92968078-92968100 CCTGCTCTAGAACATTTTAATGG + Intergenic
994203293 5:97003222-97003244 CTGTCTTAAAATTATTTTAAAGG - Intronic
994893121 5:105664944-105664966 CTGGATCTCATTCTTTTTAATGG + Intergenic
995648467 5:114340495-114340517 CTGGCTGTTGATAATTTTAATGG - Intergenic
996549525 5:124715468-124715490 CTAGCTAGAAATTATTTTAATGG - Intronic
999039927 5:148397597-148397619 TTTGATTTAAATCATTTTAAAGG + Intronic
999911330 5:156203649-156203671 CTGTCTATAAATTATTTTGAGGG - Intronic
1000976243 5:167767707-167767729 CAGGATTTAAAACATTTTAAAGG + Intronic
1003710197 6:8580989-8581011 CTGGCTCTATATTTTTTTAAAGG - Intergenic
1005006975 6:21297228-21297250 CTGGCCCAAAAACATTTTTAAGG - Intergenic
1009038410 6:58146488-58146510 CTGGCTGTAAATCACTTATATGG - Intergenic
1009246038 6:61238861-61238883 CTGGATCTCATTCATTTTTATGG - Intergenic
1009830038 6:68918597-68918619 CTAGCTCTAAATTATGTTAAAGG - Intronic
1010153536 6:72764945-72764967 CTGGATCTCATTCATTTTTATGG + Intronic
1010336676 6:74692665-74692687 TTGGATATAAGTCATTTTAACGG + Intergenic
1011221467 6:85058671-85058693 CTGCCACTAAATCTGTTTAATGG + Intergenic
1012006305 6:93716873-93716895 CTTGCTCTCAATCATTTTTTTGG + Intergenic
1012091771 6:94906691-94906713 CTGGATCTTATTCATTTTTATGG - Intergenic
1012394224 6:98777456-98777478 CAGTCTCTAAATCATTTTCATGG + Intergenic
1014839772 6:126204981-126205003 ATGCCTCTAAATATTTTTAAAGG - Intergenic
1015555353 6:134455471-134455493 CTGGCCATGAATCATCTTAAAGG + Intergenic
1015959957 6:138638026-138638048 CAGGATCTAATTCTTTTTAATGG - Intronic
1016409183 6:143764203-143764225 CTGGTTCTAAATAATGTGAATGG - Intronic
1017354606 6:153488625-153488647 CACTCTCTTAATCATTTTAAAGG + Intergenic
1017936303 6:159008397-159008419 ATGGCTTTAAAACATTTTAAAGG + Intergenic
1018317439 6:162570636-162570658 CTGGCTCTCACTCTTTTTTATGG - Intronic
1018648677 6:165972527-165972549 CTGGATTGAAAACATTTTAAGGG - Intronic
1019264911 7:109583-109605 CTGAATCTCAATAATTTTAATGG - Intergenic
1020664043 7:11017074-11017096 CTGGCTCTCATTCTTTTTTATGG + Intronic
1020918266 7:14226387-14226409 CTGACTCTAAGACTTTTTAAAGG + Intronic
1021382242 7:19982384-19982406 CTTTCTCTACATCCTTTTAAAGG + Intergenic
1022287063 7:28963546-28963568 CTGACTCAATTTCATTTTAAGGG - Intergenic
1023166832 7:37351121-37351143 CTGTCTCTAAATTTTTATAAAGG - Intronic
1023486259 7:40690514-40690536 CTTGCTGTAAGTCATATTAATGG + Intronic
1024389373 7:48789854-48789876 CTTTCTTAAAATCATTTTAAGGG + Intergenic
1025078075 7:55960467-55960489 CCGTCTCTAAAATATTTTAAAGG + Intronic
1025212082 7:57025588-57025610 CCGGCCCTAAATGGTTTTAAGGG + Intergenic
1025659872 7:63551240-63551262 CCGGCCCTAAATGGTTTTAAGGG - Intergenic
1027515284 7:79135029-79135051 ATGTCTCTAAATTATATTAAAGG - Intronic
1027986609 7:85299738-85299760 CTGGATCTCATTCATTTTTATGG - Intergenic
1029675268 7:102064343-102064365 CCGGCTCTAAATGGTTTTAAGGG + Intronic
1030524078 7:110632664-110632686 ATGGCTAAGAATCATTTTAAAGG + Intergenic
1030949504 7:115771963-115771985 GTGGCTTTAAATTTTTTTAATGG - Intergenic
1031103276 7:117508082-117508104 ATGGCTCTAAATCACTCTAAAGG - Intronic
1031807347 7:126324403-126324425 CTGGTTATAAATTATTTAAATGG - Intergenic
1032977955 7:137247333-137247355 CTGAATCTCATTCATTTTAATGG - Intronic
1032984528 7:137322847-137322869 CTGGCAGTAACTCACTTTAATGG - Intronic
1034381917 7:150704159-150704181 GTGACTCTATATCATTTTATTGG - Intergenic
1034582699 7:152059396-152059418 CTGGCTATAAATGTTCTTAATGG + Intronic
1034588401 7:152117239-152117261 TGGGCTGTAAATCATTTAAATGG + Exonic
1038336748 8:26651728-26651750 CTAGCCCTCAATCATTTTATCGG + Intronic
1042099569 8:65260260-65260282 CTGGCTCTCATTCATTTTTATGG + Intergenic
1042896244 8:73671724-73671746 CTGGCACAAAATGATTTTGATGG - Intronic
1044471465 8:92574013-92574035 CTGTTTCCAATTCATTTTAAAGG + Intergenic
1044732495 8:95240649-95240671 CTGGGTCTCATTCATTTTTATGG + Intergenic
1046772444 8:118129538-118129560 CTGGCTGGAACTCATTTTCAAGG + Intergenic
1046930863 8:119840613-119840635 CCGGCCTTAAATCAGTTTAATGG - Intronic
1047638387 8:126791980-126792002 CTGGATATAGAACATTTTAAAGG - Intergenic
1055094234 9:72394749-72394771 CTGACTTCAATTCATTTTAAAGG + Intergenic
1056339432 9:85610783-85610805 CTAGCAATAATTCATTTTAAGGG - Intronic
1056738742 9:89234551-89234573 CTGGGTCTTTGTCATTTTAATGG + Intergenic
1057131918 9:92660027-92660049 CTGGCTAAGGATCATTTTAATGG + Intronic
1057949929 9:99361660-99361682 CTGGATCTTAATCATGTAAAGGG + Intergenic
1061354352 9:130092913-130092935 CTGGCCCTAAATATTTTTAATGG + Intronic
1186555863 X:10557630-10557652 CTGGCTCTAAAACATTATTTTGG + Intronic
1187637072 X:21240932-21240954 CTGGATCTCATTCATTTTTATGG - Intergenic
1188633939 X:32404770-32404792 ATGGCTCTTAATCATTTTAGGGG - Intronic
1188636572 X:32439496-32439518 ATGGATATAAATAATTTTAATGG + Intronic
1191054870 X:56231644-56231666 CTCTCTCTAGCTCATTTTAATGG - Intergenic
1193282468 X:79669948-79669970 CTGGATCTCATTCATTTTTATGG + Intergenic
1196284758 X:113866269-113866291 CTGGTTATAAATCATTTGTATGG - Intergenic
1196332508 X:114489036-114489058 CTGGATCTCATTCATTTTTATGG + Intergenic
1197796458 X:130304160-130304182 CTGGATCTCAATCCTTTTTATGG + Intergenic
1198318255 X:135491478-135491500 CTGGCTTAATATAATTTTAAAGG + Intergenic
1199356873 X:146872888-146872910 ATTTCTCTAAATCATATTAAAGG - Intergenic
1201252904 Y:12078458-12078480 GTGGCTGTAAATCATCTAAATGG + Intergenic