ID: 1167452973

View in Genome Browser
Species Human (GRCh38)
Location 19:49583270-49583292
Sequence CCTCACTGGGTGAAGTATCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 87}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167452973_1167452979 2 Left 1167452973 19:49583270-49583292 CCTGGATACTTCACCCAGTGAGG 0: 1
1: 0
2: 1
3: 9
4: 87
Right 1167452979 19:49583295-49583317 ACAGACCAAGGTGAGTGTTTGGG 0: 1
1: 0
2: 2
3: 24
4: 159
1167452973_1167452980 3 Left 1167452973 19:49583270-49583292 CCTGGATACTTCACCCAGTGAGG 0: 1
1: 0
2: 1
3: 9
4: 87
Right 1167452980 19:49583296-49583318 CAGACCAAGGTGAGTGTTTGGGG 0: 1
1: 0
2: 0
3: 25
4: 175
1167452973_1167452981 4 Left 1167452973 19:49583270-49583292 CCTGGATACTTCACCCAGTGAGG 0: 1
1: 0
2: 1
3: 9
4: 87
Right 1167452981 19:49583297-49583319 AGACCAAGGTGAGTGTTTGGGGG 0: 1
1: 0
2: 2
3: 18
4: 231
1167452973_1167452978 1 Left 1167452973 19:49583270-49583292 CCTGGATACTTCACCCAGTGAGG 0: 1
1: 0
2: 1
3: 9
4: 87
Right 1167452978 19:49583294-49583316 GACAGACCAAGGTGAGTGTTTGG 0: 1
1: 0
2: 1
3: 12
4: 196
1167452973_1167452976 -10 Left 1167452973 19:49583270-49583292 CCTGGATACTTCACCCAGTGAGG 0: 1
1: 0
2: 1
3: 9
4: 87
Right 1167452976 19:49583283-49583305 CCCAGTGAGGAGACAGACCAAGG 0: 1
1: 0
2: 2
3: 37
4: 321
1167452973_1167452984 25 Left 1167452973 19:49583270-49583292 CCTGGATACTTCACCCAGTGAGG 0: 1
1: 0
2: 1
3: 9
4: 87
Right 1167452984 19:49583318-49583340 GGAAGTGGCATCCAGACACTTGG 0: 1
1: 0
2: 1
3: 12
4: 182
1167452973_1167452983 10 Left 1167452973 19:49583270-49583292 CCTGGATACTTCACCCAGTGAGG 0: 1
1: 0
2: 1
3: 9
4: 87
Right 1167452983 19:49583303-49583325 AGGTGAGTGTTTGGGGGAAGTGG 0: 1
1: 1
2: 4
3: 71
4: 693

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167452973 Original CRISPR CCTCACTGGGTGAAGTATCC AGG (reversed) Exonic
900516482 1:3084603-3084625 CCTCCCTGGCTCAAGTGTCCAGG - Intronic
903320955 1:22542935-22542957 CCTTAATGTGTGGAGTATCCTGG + Intergenic
903515971 1:23911297-23911319 AGTCACTGGGTGATATATCCTGG + Intronic
914092172 1:144511116-144511138 TCACACAGGGAGAAGTATCCCGG + Intergenic
914306362 1:146422749-146422771 TCACACAGGGAGAAGTATCCCGG - Intergenic
914595686 1:149150053-149150075 TCACACAGGGAGAAGTATCCCGG + Intergenic
916841295 1:168603821-168603843 CTTCACTTGGTGAAGAATCTTGG - Intergenic
918366496 1:183813282-183813304 TCTCACTGGGTGAAATGTACTGG + Intronic
924669770 1:246111777-246111799 CCTCACATGGTGAAGTAGTCTGG - Intronic
1071516930 10:86304211-86304233 GCTCACTGTGTGATGTCTCCTGG + Intronic
1076342696 10:129760324-129760346 CATCACTGGGTGAATATTCCAGG - Intronic
1077367136 11:2165835-2165857 CCTCCCTGGGGGTGGTATCCTGG - Intronic
1079426150 11:20343495-20343517 CCTCACTGAGTGACATCTCCAGG + Intergenic
1083192903 11:61065357-61065379 CCACACTGGGAGAATTATCTTGG + Intergenic
1089861872 11:121597158-121597180 CCTTACTGGGTGAACTATTTAGG - Intronic
1090574511 11:128086416-128086438 GCTCTCTGGGTGATGTTTCCTGG + Intergenic
1092972888 12:13715175-13715197 CCTGACAGGGTGAATTATTCTGG + Intronic
1093389673 12:18602741-18602763 GCTCACTGGGTGAATGAACCCGG + Intronic
1108529119 13:51312393-51312415 ATTCACTGGGGGAAGTATCTGGG - Intergenic
1112150148 13:96750395-96750417 CCTCACTGGGTGAAGGAGACAGG + Intronic
1113480566 13:110616784-110616806 ACTCACTGGCTGGAGAATCCTGG - Intronic
1121323934 14:93008896-93008918 CCCCACTGGGTGCAGTTTCTGGG - Intronic
1122132502 14:99612967-99612989 CCTCACTGCATGAAATATTCAGG - Intergenic
1127673787 15:61221011-61221033 TTTCACTGGGTGAAGTATTTTGG - Intronic
1129544601 15:76381900-76381922 CCTCACTTTGTTTAGTATCCTGG + Intronic
1129906541 15:79191650-79191672 CTTTACTGGGGGAAGTATCCTGG - Intergenic
1130380002 15:83363407-83363429 CCTAACAGGGTGAAGTTCCCTGG - Intergenic
1131615195 15:94008800-94008822 AGTCACTGGGTGAAGAACCCAGG - Intergenic
1132167774 15:99612759-99612781 CCTCACTGTCAAAAGTATCCAGG - Intronic
1133589413 16:7228072-7228094 CCTCTGTGGGTGAATTTTCCTGG + Intronic
1133728285 16:8557139-8557161 CCTCCCTGGGAGAAGTATCAAGG - Intergenic
1138898832 16:61244137-61244159 CCACAGTGGGTGCAGAATCCAGG - Intergenic
1139519403 16:67471992-67472014 CCTCACTGGGTGAAGAAAAGGGG - Intronic
1140974804 16:80049312-80049334 CCTCACTGGGTCACATACCCAGG + Intergenic
1146535598 17:33647909-33647931 CCTCCCTGGGAGAAGGGTCCTGG + Intronic
1151819713 17:76490942-76490964 GCTCACTGGGTGCAGGATCCTGG - Intronic
1153698067 18:7664215-7664237 CCTCACTGTGTGGAGGAGCCAGG + Intronic
1160047168 18:75397597-75397619 CCACACTGGCTGAAGAATCTAGG - Intergenic
1162454031 19:10771719-10771741 CCTCTCTGGGTGATGTATCCTGG + Intronic
1163216282 19:15879731-15879753 CCTCACGGGGAGGAGTCTCCTGG - Intronic
1164311048 19:24046784-24046806 CAGCACTGGGTGAAGCCTCCAGG - Intronic
1167193366 19:48007800-48007822 CCTCCCTGGGTGACCAATCCAGG + Intronic
1167452973 19:49583270-49583292 CCTCACTGGGTGAAGTATCCAGG - Exonic
1168692155 19:58383688-58383710 CCCCAGTGGCTGAAGCATCCTGG + Intergenic
925380274 2:3420014-3420036 CATAACTGGGTGAAATATCCAGG - Intronic
932701368 2:73994334-73994356 CCTCACTGGAGGGAGTATGCAGG + Intronic
944747322 2:202671435-202671457 CTTCACTGGTTGAAGTTTCTGGG + Intronic
948882101 2:240864381-240864403 CCTCCCTGGGCAAACTATCCAGG + Intergenic
1168824198 20:798324-798346 CATCACTGGGGGAAGACTCCTGG - Intergenic
1172057301 20:32163484-32163506 CTTCACTGGCTGACGTATCATGG - Intronic
1172891602 20:38269851-38269873 CCTCCCTGGGTGAAGCTCCCTGG - Intronic
1174451929 20:50625900-50625922 GCTCACTTGGGGAAGTAACCTGG - Intronic
1179513231 21:41888936-41888958 CCTCTCTGGGAGAAGCCTCCTGG + Exonic
953381756 3:42477563-42477585 CTTCCCCGGGTGATGTATCCAGG - Intergenic
956386476 3:68725059-68725081 CCTCACTGGGAGGGGTGTCCTGG - Intergenic
976169551 4:82288750-82288772 CCTCTCTTGGTGAAGCATACAGG + Intergenic
976708259 4:88041516-88041538 CCTCACTGGGAGAGGGCTCCTGG - Intronic
978503421 4:109433421-109433443 CCTCAGTGGGTGAAGGGACCGGG - Intergenic
983365503 4:166781908-166781930 TTTCACTGGGTAAAGTATACTGG - Intronic
983550600 4:169013547-169013569 CATCACTGCCTGAAGAATCCTGG - Intergenic
992085620 5:73275607-73275629 CCTCACTGGGTGAGCCATCTGGG - Intergenic
997365877 5:133324915-133324937 CCCCACTGGGTGAGGTATGGAGG - Intronic
999323654 5:150630054-150630076 CCTCACTGGGTCTAGGGTCCGGG + Intronic
1001244934 5:170098904-170098926 CCGCTCTGGGTGAAGAATGCTGG - Intergenic
1003619777 6:7689457-7689479 CATCACTGGGTGAAGTACCAAGG - Intergenic
1003745204 6:8993358-8993380 ACTCGCTGGGTGAAGTATCAGGG + Intergenic
1005782249 6:29204065-29204087 CCTGGCTGTGTGCAGTATCCAGG - Intergenic
1010295734 6:74194151-74194173 CCTCACTGGGTGGGTTCTCCTGG - Intergenic
1012872031 6:104683861-104683883 CTTCACAGTGTGAAGAATCCAGG + Intergenic
1017463358 6:154672112-154672134 TCTCTCTGGGTGAAGTACCTAGG + Intergenic
1018950107 6:168373514-168373536 CCTCTCTGGCTGAAGTCACCAGG + Intergenic
1019303256 7:319858-319880 CCTCTCTGGCTGAAGTTACCTGG - Intergenic
1021928948 7:25560809-25560831 CCTCACTGGGTGCAGTAGGGGGG + Intergenic
1024455086 7:49596737-49596759 CCTCACAAGGTGCAGTATCATGG + Intergenic
1029597991 7:101547644-101547666 CCTCATTGGGGGAAGAATGCAGG + Intronic
1029988738 7:104944065-104944087 TCTCAATGGGAGAACTATCCGGG + Intergenic
1031254283 7:119428262-119428284 CCTCACTGGGTGAAAACTTCCGG + Intergenic
1031629207 7:124026088-124026110 CATCACCTGGTGAAGTTTCCTGG - Intergenic
1036215588 8:6877400-6877422 CGTCACTGGGTGCAGCCTCCTGG - Intronic
1039331555 8:36543091-36543113 CCTCCCTGGGTGAAGTCTCAGGG - Intergenic
1040549836 8:48429443-48429465 CCTCACAGGGTCAAATATGCTGG - Intergenic
1045594305 8:103635400-103635422 CCTCACTGGGTGGGTCATCCAGG - Intronic
1046708929 8:117487478-117487500 CCTCACTGAGTGACATTTCCAGG + Intergenic
1049052768 8:140211790-140211812 CCTCACTGTCTGGAATATCCGGG + Intronic
1055502029 9:76910731-76910753 TCTCACTGGGAGAAGTATCAAGG - Intergenic
1056978712 9:91286319-91286341 CCTCCCTGGGTGAGGGATCTGGG - Intronic
1058163686 9:101596551-101596573 ACTCTCTGGGGGAAATATCCAGG + Intronic
1062122373 9:134840777-134840799 CCTCACAGGGTGGAGTCTCTCGG + Intronic
1186947444 X:14584634-14584656 GGTCACTGGGGGAAGTTTCCTGG - Intronic
1188791592 X:34413233-34413255 CCTCACAGGGTGGAGTCTGCTGG + Intergenic
1192564846 X:72155083-72155105 CATCACAGGTTGAAGTACCCAGG + Intergenic
1193949404 X:87779111-87779133 CCTGACTGGGAGATGTCTCCTGG + Intergenic
1195105368 X:101598183-101598205 CCTCATTGGGTGAAAGTTCCAGG + Intergenic
1195107514 X:101615584-101615606 CCTCATTGGGTGAAAGTTCCAGG - Exonic
1200904895 Y:8471940-8471962 CCTTACTGAGAGAAGGATCCAGG - Intergenic
1202262396 Y:22983438-22983460 CATCACTGGATGCAGTAACCAGG + Intronic
1202415386 Y:24617179-24617201 CATCACTGGATGCAGTAACCAGG + Intronic
1202455401 Y:25052907-25052929 CATCACTGGATGCAGTAACCAGG - Intronic