ID: 1167453155

View in Genome Browser
Species Human (GRCh38)
Location 19:49584065-49584087
Sequence AATTCTGTGCTCTCTGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 289}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167453148_1167453155 9 Left 1167453148 19:49584033-49584055 CCCAAATTAGGTACAAGAATCGT 0: 1
1: 0
2: 0
3: 9
4: 90
Right 1167453155 19:49584065-49584087 AATTCTGTGCTCTCTGAAGCTGG 0: 1
1: 0
2: 1
3: 32
4: 289
1167453145_1167453155 16 Left 1167453145 19:49584026-49584048 CCTCCACCCCAAATTAGGTACAA 0: 1
1: 0
2: 1
3: 14
4: 205
Right 1167453155 19:49584065-49584087 AATTCTGTGCTCTCTGAAGCTGG 0: 1
1: 0
2: 1
3: 32
4: 289
1167453142_1167453155 28 Left 1167453142 19:49584014-49584036 CCAAACCAACGTCCTCCACCCCA 0: 1
1: 0
2: 1
3: 16
4: 240
Right 1167453155 19:49584065-49584087 AATTCTGTGCTCTCTGAAGCTGG 0: 1
1: 0
2: 1
3: 32
4: 289
1167453143_1167453155 23 Left 1167453143 19:49584019-49584041 CCAACGTCCTCCACCCCAAATTA 0: 1
1: 0
2: 2
3: 14
4: 147
Right 1167453155 19:49584065-49584087 AATTCTGTGCTCTCTGAAGCTGG 0: 1
1: 0
2: 1
3: 32
4: 289
1167453149_1167453155 8 Left 1167453149 19:49584034-49584056 CCAAATTAGGTACAAGAATCGTC 0: 1
1: 0
2: 0
3: 4
4: 35
Right 1167453155 19:49584065-49584087 AATTCTGTGCTCTCTGAAGCTGG 0: 1
1: 0
2: 1
3: 32
4: 289
1167453147_1167453155 10 Left 1167453147 19:49584032-49584054 CCCCAAATTAGGTACAAGAATCG 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1167453155 19:49584065-49584087 AATTCTGTGCTCTCTGAAGCTGG 0: 1
1: 0
2: 1
3: 32
4: 289
1167453146_1167453155 13 Left 1167453146 19:49584029-49584051 CCACCCCAAATTAGGTACAAGAA 0: 1
1: 0
2: 1
3: 10
4: 103
Right 1167453155 19:49584065-49584087 AATTCTGTGCTCTCTGAAGCTGG 0: 1
1: 0
2: 1
3: 32
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167453155 Original CRISPR AATTCTGTGCTCTCTGAAGC TGG Intronic
900172527 1:1276026-1276048 CAATCTATTCTCTCTGAAGCCGG - Intergenic
901832650 1:11902577-11902599 AATTCCATGCTCTATGGAGCTGG + Intergenic
902808832 1:18877038-18877060 GATTCTGCCCTTTCTGAAGCTGG + Intronic
903604877 1:24568179-24568201 ATTTCTGTGCTCTCTGCCCCCGG - Intronic
904453093 1:30629100-30629122 AATCCTGTGTTCTCAGGAGCAGG - Intergenic
905316054 1:37081831-37081853 AACCCTGTGCTCTCTGAAACAGG + Intergenic
905335756 1:37243627-37243649 AATTCAGAGCCCTCTGCAGCAGG - Intergenic
907193524 1:52668110-52668132 AATTCTGTTCTCTCAAAATCAGG + Intronic
907888613 1:58617230-58617252 AGGGCTGAGCTCTCTGAAGCAGG - Intergenic
908994203 1:70132148-70132170 AATTCAGGGCTGTCTGAAGAAGG - Intronic
910643141 1:89486327-89486349 AAATCTGAGCTCTCTGTGGCAGG + Intergenic
910802046 1:91156856-91156878 ATTTCTGTGCTCACTCCAGCTGG - Intergenic
911168184 1:94743770-94743792 AATTGTATGCTCTCTGGAGGAGG + Intergenic
912074064 1:105850359-105850381 CATTTTGTACTCTCTGGAGCTGG - Intergenic
912391970 1:109309185-109309207 AATTCTGTGTTCTTTTGAGCAGG - Intergenic
913452903 1:119004190-119004212 ACTTCTGTCCTTTCTGGAGCTGG + Intergenic
915208502 1:154288116-154288138 AACCCTGTGCTCTCTGAAACAGG + Intergenic
915641327 1:157229333-157229355 CATTTTGTGCCATCTGAAGCAGG - Intergenic
916821070 1:168399358-168399380 GATCCTGAGCTCTCTGGAGCAGG + Intergenic
917309125 1:173659378-173659400 AATTCTGAACTCTCTGACTCTGG + Exonic
918817796 1:189211634-189211656 CATTCTGTGATATCTTAAGCTGG + Intergenic
918861944 1:189839361-189839383 AATTATGTGGTCTTGGAAGCAGG - Intergenic
919148795 1:193668784-193668806 CCTTCTGTGCTCTCTGAGGGGGG - Intergenic
919167205 1:193910600-193910622 AATCCTGTGATCTCTGCAGTAGG - Intergenic
920279231 1:204830267-204830289 AGTTCTGTGGGCTCTGAGGCTGG - Intronic
920341176 1:205276081-205276103 AATCCAGTCCTCTCTCAAGCTGG - Intergenic
920459566 1:206128833-206128855 AATTCTGTGCCCACTGATGGTGG + Intergenic
922687265 1:227651427-227651449 TTTACTGTGGTCTCTGAAGCAGG - Intronic
923735509 1:236603182-236603204 ACTTCTGTGCTGGCTTAAGCAGG + Exonic
923769842 1:236928889-236928911 CAATCTGTTCTCTCTGAAGCCGG + Intergenic
924129014 1:240886362-240886384 AAATCTGTGCTCATTGAATCTGG + Intronic
924316584 1:242803895-242803917 AGTTCTGTGGACTCTGAGGCAGG + Intergenic
924898991 1:248373996-248374018 AATTCTGTGCTCTGGGGAGAGGG - Intergenic
1068648814 10:59499136-59499158 AATTCTGTTCTTTCTGAGGGCGG + Intergenic
1069391845 10:67944232-67944254 TATGCTGAGCTCTCTGGAGCTGG - Intronic
1069701576 10:70430482-70430504 AATTGTGTCCTGTCTGAACCTGG - Intergenic
1070056451 10:72939712-72939734 AGTTCTGAGCCCACTGAAGCAGG + Intronic
1073622500 10:105063756-105063778 GATTCTGAGCTCTTTGAAGGAGG - Intronic
1073935247 10:108623490-108623512 AATTCTCTGCTCTGTGCAGGAGG - Intergenic
1074693362 10:116026617-116026639 AATATTGTGGTCTCTGAAGCAGG - Intergenic
1074764815 10:116692600-116692622 AGATCTTTGCTCTCTGATGCTGG - Intronic
1075206455 10:120453530-120453552 AAGTTTGTGTTCTCTGAAGGTGG - Intergenic
1077839791 11:5961452-5961474 AACCCTGTGCTCTCTGAAACAGG + Intergenic
1078403264 11:11045980-11046002 AATACTATGCTTTCTGTAGCTGG + Intergenic
1078824181 11:14911928-14911950 AATACTGTGCTCTCTGAAATGGG + Intronic
1085552039 11:77383090-77383112 AGTCCTGTGCTCTGTGAATCAGG - Intronic
1085926699 11:81032542-81032564 AATTCTTTGCTTTCTGCATCTGG + Intergenic
1088215831 11:107508083-107508105 AACTATGAGCTCTATGAAGCAGG + Intronic
1088298121 11:108323330-108323352 AATTCTGTACTCTTTTCAGCAGG - Intronic
1089665719 11:120017316-120017338 ACCTCTGTGCTCTGTGAGGCGGG - Intergenic
1090279210 11:125441821-125441843 CATGTTGTGCTCTTTGAAGCAGG + Intergenic
1091364555 11:135006897-135006919 CATTCTCTGCTCTATGATGCTGG - Intergenic
1092779041 12:11968306-11968328 AATTCTGTGCTCTAAGCATCTGG + Intergenic
1094643833 12:32301836-32301858 ATTTTTGTGCTCTGTGAAGGTGG + Intronic
1095221296 12:39619422-39619444 ATTTCTGTGTTCTCTGCAGCAGG + Exonic
1095285265 12:40403227-40403249 TATTCTGTGTTCTCTGAGGAAGG + Intronic
1096108612 12:49014797-49014819 ATTTCTGTGCTCCCTCAAGTGGG + Intronic
1097357355 12:58616577-58616599 AATTCTGTGCACTTTGAGGTTGG - Intronic
1098010481 12:66045482-66045504 AACTCAGGTCTCTCTGAAGCCGG - Intergenic
1101861494 12:108486006-108486028 AAGTCTGTGCTCTCAAAATCTGG - Intergenic
1102890465 12:116554753-116554775 GATCCTGTGCTCTCTGCAGTTGG + Intergenic
1103105459 12:118220555-118220577 AATTCAGTGTTCTGAGAAGCTGG - Intronic
1107347441 13:39477070-39477092 CATTCTGTGATTTCTGAACCTGG + Intronic
1107757695 13:43642815-43642837 AATTCTGAGCTCTATTAGGCAGG - Intronic
1108042498 13:46352247-46352269 AATTGTTTTCTTTCTGAAGCTGG - Intronic
1109144897 13:58767244-58767266 AATACTGGCCTCTCTGAGGCAGG - Intergenic
1109910078 13:68898084-68898106 CACTCTGTGTTCTCTGAAGCTGG + Intergenic
1110694813 13:78475463-78475485 AATTCTCTCCTCTGTGAACCTGG - Intergenic
1111880873 13:93955388-93955410 AACTCTGTTTTCTTTGAAGCTGG - Intronic
1112563000 13:100530101-100530123 AAATCTGTGCACTGTCAAGCTGG + Exonic
1113215834 13:108039776-108039798 TATTCTCTGCTCTGTGATGCTGG + Intergenic
1113509136 13:110838057-110838079 AACTCTGTGCTCGCAGAAACAGG - Intergenic
1113739967 13:112704770-112704792 AATCCTCTTTTCTCTGAAGCAGG - Intronic
1114336745 14:21698280-21698302 AACCCCGTGCTCTCTGAAACAGG + Intergenic
1114645072 14:24251155-24251177 GTTTCTGAGCTCTCTGAAGGAGG + Intronic
1115863019 14:37710949-37710971 GATTCTGTGCACTCTGAAGATGG - Intronic
1116514952 14:45793793-45793815 AATACTGTGATCTGTGAAACAGG + Intergenic
1116535331 14:46020677-46020699 AATTCTATGCTCTTTGGACCTGG + Intergenic
1121253374 14:92514995-92515017 AGTTCTCTGCTCTGTGAAACAGG + Intronic
1122663649 14:103314463-103314485 AGAGCTGGGCTCTCTGAAGCTGG - Intergenic
1123957689 15:25356312-25356334 AATTCTGTGGTGTCTCAAGGTGG + Intronic
1124119008 15:26872511-26872533 AACTCTCTCCACTCTGAAGCAGG - Intronic
1126456659 15:48869849-48869871 ACCTCTGTGCTCTCTAAAGCTGG - Intronic
1126559759 15:50030488-50030510 CATTCTGTGCTCAGTGTAGCTGG - Intronic
1127769824 15:62222191-62222213 AATCCTGTGCTCTGTGCTGCTGG - Intergenic
1128248938 15:66151629-66151651 AAGTCTTTGCTCTAGGAAGCAGG - Intronic
1128999256 15:72319457-72319479 AATTCTGTGATCTGGGAAGGGGG + Intronic
1129652257 15:77499428-77499450 ACTCCACTGCTCTCTGAAGCTGG + Intergenic
1130245766 15:82247073-82247095 AAATCTGGGCTGTATGAAGCAGG + Intronic
1130727687 15:86457434-86457456 TATTCTCTGCTTTCTGAAGAGGG + Intronic
1131617989 15:94036517-94036539 AATTCTGTCCTCTCTGCATGGGG + Intergenic
1131775408 15:95791167-95791189 AATTATGAGCTCCCTCAAGCTGG + Intergenic
1134001870 16:10789170-10789192 CCATCTGTTCTCTCTGAAGCTGG - Intronic
1134252479 16:12583990-12584012 AATCCTGTGTTCTCTGAAGAGGG + Intergenic
1135064052 16:19294452-19294474 AAGTCAGAGCTATCTGAAGCAGG + Intronic
1135467341 16:22698438-22698460 AATTATTTGGTCTCTGAAGTAGG - Intergenic
1135928286 16:26714569-26714591 AATTCTGTTCTCTATTTAGCTGG - Intergenic
1138791817 16:59913469-59913491 AATTATTTGCTCTCTGAAAAAGG - Intergenic
1139336703 16:66236976-66236998 TAGTCTGTTCTCTCTGTAGCTGG - Intergenic
1139707918 16:68754600-68754622 AAGTCTGTGCTCTTTATAGCAGG + Intronic
1140432732 16:74918720-74918742 AAATCTTTGCTCTCTGAAGGTGG - Intronic
1140479044 16:75252694-75252716 AATTCTCTGCTGCGTGAAGCCGG - Intronic
1141252653 16:82372397-82372419 AATTCTGAGCACCCTGGAGCTGG + Intergenic
1141417928 16:83891132-83891154 ACTTCTATGCTGTCTGAAGAGGG - Intergenic
1142207753 16:88792041-88792063 AATTCTGTACCCTCCCAAGCAGG - Intergenic
1142310605 16:89310385-89310407 AATTCTGTTCTTTCTCAAGGTGG + Intronic
1144951917 17:18998941-18998963 AATACTGGGCTCTCTGGAGGAGG - Intronic
1146493837 17:33302935-33302957 AATTCTATTCTCTCTGATTCTGG + Intronic
1147814955 17:43202800-43202822 CCTTCTCTGCTCTCTGAAGATGG - Intronic
1149675609 17:58458793-58458815 GCTTCTGTGCTCTCTGTATCTGG + Exonic
1150595739 17:66602851-66602873 AATTTTGTGCTGTCTGCAGTGGG + Intronic
1151783625 17:76264521-76264543 AAGACTTTGCTCTCTGAAGATGG - Intergenic
1156318362 18:35993676-35993698 GAGTCTGTGGTGTCTGAAGCAGG + Intronic
1157450326 18:47781619-47781641 AATTCTGTATTTTATGAAGCTGG + Intergenic
1158468196 18:57710662-57710684 AATGCTGTTCTCGCTGAGGCTGG + Intronic
1159221124 18:65464347-65464369 TGTTCTGTGCTCTCAGAAACAGG - Intergenic
1160475519 18:79182249-79182271 AACTCTGTGGTCTCTGCAGGTGG + Intronic
1162545144 19:11324734-11324756 ACTTCTGGGGTCCCTGAAGCCGG + Exonic
1163865604 19:19770523-19770545 AACCCCGTGCTCTCTGAAACAGG + Intergenic
1163921874 19:20296919-20296941 ACCCCTGTGCTCTCTGAAACAGG + Intergenic
1164214631 19:23134269-23134291 AATTCTGTGCTTTCAGATCCCGG + Intronic
1165523214 19:36330580-36330602 AATTCTCTCCGCTCTGAAGAAGG + Intergenic
1167453155 19:49584065-49584087 AATTCTGTGCTCTCTGAAGCTGG + Intronic
1168362564 19:55754589-55754611 AGTTCTTTGATCTCGGAAGCTGG - Intergenic
925559468 2:5174341-5174363 ATTTCTGAGGACTCTGAAGCTGG - Intergenic
926426308 2:12741423-12741445 AATGCTTTGCTCCCTGAAGGGGG + Exonic
926494853 2:13573493-13573515 ATTTCTGTACTCTCTGAATGAGG - Intergenic
927009949 2:18893005-18893027 AATTCTGTGGTCTGTGAAATTGG + Intergenic
927362071 2:22247725-22247747 GATTCTGTTTTCTCTGAGGCAGG + Intergenic
928019991 2:27696765-27696787 AATTCTGTCATCTGTGAAGCAGG + Intergenic
928076453 2:28269337-28269359 GACTCTGTGCTCTCTGCACCCGG + Intronic
928612790 2:33006980-33007002 ATTACTGTGGTCTCTGTAGCAGG + Intronic
931254284 2:60556417-60556439 AATTGTGTGCGCTCTGACGATGG + Intergenic
931403033 2:61949432-61949454 ATGACTGTGCTCTCTGAAGCTGG - Intronic
932121230 2:69102491-69102513 AAATCTGTGATCTCAGTAGCCGG - Intronic
933850966 2:86366430-86366452 TACTCTGTGGTCTCTGGAGCTGG + Intergenic
934091941 2:88558769-88558791 AATTCTGGGCTCTTGGGAGCAGG + Intronic
938295384 2:130175185-130175207 AGTTCTATGCTCTCTGGACCAGG + Intronic
938461236 2:131498643-131498665 AGTTCTATGCTCTCTGGACCAGG - Intergenic
938786604 2:134635712-134635734 CACCCTCTGCTCTCTGAAGCTGG - Intronic
939696484 2:145331497-145331519 AGCTCTGTGCCCTCTGAAGGAGG - Intergenic
940600763 2:155856825-155856847 AATTCTCTGGTCTCTTAAGCAGG - Intergenic
940997283 2:160163321-160163343 AATTCTATGCTTTTTAAAGCTGG + Intronic
941430241 2:165405990-165406012 AATTATATACTCTCTAAAGCAGG - Intergenic
941650772 2:168090320-168090342 AATTTTCTGCTCCCTGAAGAAGG + Intronic
944367875 2:198945634-198945656 AATTGTTTACTCTCTGAAGAGGG - Intergenic
945123920 2:206487699-206487721 AATTCTTTCCTCTCTGCATCGGG - Intronic
946157204 2:217814807-217814829 AATTCAGTCCTCTTTGTAGCAGG - Intronic
946694303 2:222337266-222337288 AAAACTGTACTATCTGAAGCAGG - Intergenic
946837247 2:223784434-223784456 AGTGTTGTGCTCTCTGATGCAGG - Intronic
947144280 2:227050616-227050638 AAATCTGTGATATCTGAAACTGG + Intronic
948085915 2:235247849-235247871 TATTCTGTCCTCTCTCTAGCAGG - Intergenic
948546254 2:238730802-238730824 AATTCTGTGCTTTTTGCAGAGGG - Intergenic
1170581281 20:17701335-17701357 AATTCCGACCTCTGTGAAGCAGG + Intronic
1172062302 20:32194969-32194991 AGGGCTGTGCTCTCTGCAGCAGG + Exonic
1172110395 20:32541311-32541333 AATGCAGGGCACTCTGAAGCTGG + Intronic
1172279725 20:33700411-33700433 AACCCTGTGCTCTCTGAAACAGG + Intergenic
1173049555 20:39546178-39546200 ATTACTGTGCTCTGGGAAGCAGG + Intergenic
1176258830 20:64168222-64168244 TAATCTCTTCTCTCTGAAGCTGG - Intronic
1179450750 21:41466798-41466820 ATTTCTGTGCTTTCTGGGGCTGG - Intronic
1181846891 22:25717468-25717490 GATTGTAAGCTCTCTGAAGCAGG + Intronic
1185263774 22:49886602-49886624 CATGCTGCGCTCTCTGAAGGAGG + Exonic
951662652 3:25086871-25086893 CAATCTATTCTCTCTGAAGCAGG - Intergenic
951889499 3:27555223-27555245 AATTCTTTGCTTTATCAAGCAGG - Intergenic
955655898 3:61244571-61244593 CCTTCTGCCCTCTCTGAAGCAGG + Intronic
957205863 3:77197993-77198015 AATTCTGGCCCCTGTGAAGCTGG - Intronic
959069836 3:101692028-101692050 AACCCCGTGCTCTCTGAAACAGG + Intergenic
959070739 3:101700182-101700204 AACCCCGTGCTCTCTGAAACAGG + Intergenic
959985314 3:112564890-112564912 AACCCTGTGCTCCCTGAAACAGG - Intronic
960680348 3:120241240-120241262 AATTCTGTGGTCTCTAAATTTGG - Intronic
961174888 3:124826827-124826849 AATTCTGTTTTCTGTGAAGTGGG + Intronic
962221854 3:133571099-133571121 AATTCTCTCCTCTGTGAAGCTGG - Intergenic
962620540 3:137173733-137173755 AATACTGTGCTCTTATAAGCAGG + Intergenic
962858561 3:139373755-139373777 AATTCAGTGTGCTCTCAAGCCGG + Exonic
963349500 3:144135297-144135319 AACTCTGGGCTCTCTGAGGAGGG + Intergenic
964414684 3:156434908-156434930 ATTTATGTTCTCTTTGAAGCAGG + Intronic
966135879 3:176697632-176697654 AAATCTGTGCTCTCTGCAAAAGG + Intergenic
966319142 3:178681173-178681195 AAATCTATGCTCTCTGACACAGG - Intronic
967966264 3:194962324-194962346 ATTTCTGTCCTCTATGGAGCTGG - Intergenic
968712779 4:2131678-2131700 AATTCTGGTCTCTTTGATGCTGG + Intronic
969018257 4:4119924-4119946 AGCTCTGTGCTCTATGCAGCTGG - Intergenic
969067833 4:4502876-4502898 AACTCTGTGTTTTCTGAAGTAGG - Intronic
969685574 4:8672224-8672246 GATGCTGTGCTCTTTGATGCTGG + Intergenic
969794945 4:9520248-9520270 AGCTCTGTGCTCTATGCAGCTGG + Intergenic
972231571 4:37078561-37078583 AATTCTTTGCTCTTTGCAGAAGG + Intergenic
973962288 4:56123721-56123743 ACTACTGTGGTCTCTGAAGATGG - Intergenic
977070696 4:92382190-92382212 AATTATGTGTTCTCTTAAGGTGG + Intronic
977807287 4:101316010-101316032 AATTCTATGTTCTAGGAAGCAGG + Intronic
978910589 4:114058735-114058757 AATTTTTTGCTCTCAGAAGATGG + Intergenic
979978828 4:127229593-127229615 AATTATGTACTTTCTGAAGAAGG - Intergenic
980096535 4:128497154-128497176 AATTCTGTGCTAACTGAAGTTGG + Intergenic
980327311 4:131363885-131363907 AATTCTGTGTTCTCTGAACTAGG + Intergenic
981171866 4:141635047-141635069 GATACTGTGTTCTCTGCAGCCGG - Intergenic
981895763 4:149796691-149796713 TATTCTGAGCCATCTGAAGCTGG - Intergenic
982817076 4:159899439-159899461 AATGCTGTGCTTTCAGAATCAGG - Intergenic
983820284 4:172184405-172184427 AATTCTTTTGTCTCTGAACCAGG + Intronic
984128047 4:175836772-175836794 AATTCTGTGATCTACAAAGCTGG - Intronic
984512554 4:180696127-180696149 AATTCTGTGGTCTCTTAAATTGG + Intergenic
986155852 5:5175450-5175472 CAAGCTGTGCTTTCTGAAGCTGG + Intronic
989263937 5:39450509-39450531 AAATCCCTGCTCCCTGAAGCAGG - Intronic
990063032 5:51675643-51675665 AATTCTGTCTTCTCAGAAGCAGG + Intergenic
991294848 5:65070020-65070042 ACCTCTGTGGTCTCTGAGGCTGG + Intergenic
991342077 5:65622784-65622806 AATTCTGTGCTGTAAGAAACTGG + Intronic
992131109 5:73693757-73693779 TAATCTGTGCTCCCTGAAGTTGG + Intronic
992443322 5:76813373-76813395 AACCCTGTGCTCTCTGAAACAGG + Intergenic
994291914 5:98036523-98036545 AACTTTATGCTCTCTGAAGTGGG - Intergenic
995889887 5:116939227-116939249 AATTCCCTTCTCTCTGAATCTGG + Intergenic
996322262 5:122232129-122232151 CAGTCTGTTCTCTCTGAAGCCGG - Intergenic
999509724 5:152236727-152236749 AATGCTGTCTTCTCTGAAGAGGG + Intergenic
1001005664 5:168047592-168047614 AATTCTGAGCTCTCGCCAGCTGG + Intronic
1001104087 5:168838595-168838617 AACTCTGGGTTCTCTGAAGTGGG + Intronic
1005163615 6:22894090-22894112 TATTCTGTGCTTTCTGGAGAAGG - Intergenic
1006448478 6:34092681-34092703 AATTCCCTTCTCTCTGGAGCTGG + Intronic
1006572418 6:35016798-35016820 AAGTCTGTGCTCCCTGAGGAAGG + Intronic
1007792255 6:44317160-44317182 AACCCCGTGCTCTCTGAAACAGG + Intronic
1008188571 6:48425535-48425557 AATTGTGTGCACTCTGAAGTAGG - Intergenic
1008863635 6:56182545-56182567 AATTCTGTGTTAGCTGAAGATGG - Exonic
1009797303 6:68487243-68487265 ATTTTTGTTCTCTCTGAAGTTGG + Intergenic
1010534453 6:77010992-77011014 GATTATGTGCTCCATGAAGCCGG + Intergenic
1011083034 6:83510305-83510327 AATTCTGGCTTCTCTTAAGCAGG - Intergenic
1011555944 6:88571673-88571695 GTTTGGGTGCTCTCTGAAGCAGG + Intergenic
1011955120 6:93016620-93016642 ACTTCTCTACTCTCTGGAGCTGG + Intergenic
1013219380 6:108064092-108064114 AATTTTGGGATCTTTGAAGCTGG - Intronic
1014840963 6:126219459-126219481 AAATCTGTGCAGTCTGATGCTGG - Intergenic
1015312112 6:131777526-131777548 AAATCTGTACTTTCTCAAGCTGG + Intergenic
1015497747 6:133898370-133898392 AACTCTCTCCTCTCTGGAGCTGG + Intergenic
1017056040 6:150436333-150436355 AAGTCTCTGCTCTGTGAAGGAGG + Intergenic
1017995468 6:159528137-159528159 AATTCTGCCCTCTCTGTAGCAGG - Intergenic
1018229118 6:161658933-161658955 TATTCTATGCCCTCTGAAGCAGG - Intronic
1018959003 6:168432996-168433018 AAATGTGTGCTCTCTGCAGTTGG - Intergenic
1019521935 7:1464772-1464794 AACTCTGTGCTCCTTGAAGGTGG - Intergenic
1019933499 7:4239198-4239220 AGGTCTGTGCTCTCTGTGGCTGG - Intronic
1020439356 7:8201222-8201244 AATTTTGGGCTGTCAGAAGCTGG - Intronic
1021837656 7:24696241-24696263 AAATTTGTGTTCTCTTAAGCTGG - Intergenic
1021970954 7:25965521-25965543 AGTTCTGTGCTTTCTGAAGACGG + Intergenic
1024112627 7:46162534-46162556 AGTTCTGTGCTGTTTGCAGCAGG - Intergenic
1024909912 7:54435654-54435676 AAATCTGTGCACTCTGAGGGCGG + Intergenic
1025323786 7:58181971-58181993 AAATCTGCTCTCTCTAAAGCAGG - Intergenic
1025378440 7:59150577-59150599 AAATCTGCTCTCTCTAAAGCAGG - Intergenic
1025403806 7:59600421-59600443 AAATCTGCTCTCTCTAAAGCAGG - Intergenic
1025421062 7:59906360-59906382 AAATCTGCTCTCTCTAAAGCAGG - Intergenic
1025435049 7:60155393-60155415 AAATCTGCTCTCTCTAAAGCAGG - Intergenic
1025440672 7:60255219-60255241 AAATCTGCTCTCTCTAAAGCAGG - Intergenic
1025455855 7:60525064-60525086 AAATCTGCTCTCTCTAAAGCAGG - Intergenic
1025462056 7:60635791-60635813 AAATCTGCTCTCTCTAAAGCAGG - Intergenic
1025635548 7:63316964-63316986 AATTCACTCCTGTCTGAAGCTGG + Intergenic
1025647147 7:63431206-63431228 AATTCACTCCTGTCTGAAGCTGG - Intergenic
1026514967 7:71060948-71060970 GATTCTATGCTGTCTGGAGCAGG + Intergenic
1027742456 7:82027844-82027866 TATTCAGTGGTCCCTGAAGCTGG + Intronic
1029355435 7:100048393-100048415 CAGTCTGTTCTTTCTGAAGCCGG + Intergenic
1030287829 7:107844802-107844824 AATTCTATGCTGTCTGGAGATGG + Intergenic
1032570034 7:132986108-132986130 AACCCTGTGCTCTCTGAAACAGG + Intronic
1033236623 7:139642856-139642878 ATCTCTGTGCACTCTGCAGCAGG + Intronic
1033294235 7:140115498-140115520 AACCCCGTGCTCTCTGAAACAGG + Intronic
1033545084 7:142392354-142392376 AAACCTGAGCTCTCTGGAGCTGG + Intergenic
1037501235 8:19487372-19487394 CATCCTGTGCTCTTTGAATCTGG - Intronic
1040714022 8:50225268-50225290 AAATCTGTTCTCTCTGAAGCAGG + Intronic
1041152788 8:54953979-54954001 ATTTCAGTGCTCTGTGAAGCTGG + Intergenic
1041298445 8:56386580-56386602 AATTCTGTTCTGCCTGATGCTGG - Intergenic
1041374024 8:57193772-57193794 AGTTGTGGCCTCTCTGAAGCTGG + Intergenic
1041786682 8:61642006-61642028 ATTTCTGTCCTCTGGGAAGCAGG + Intronic
1041947271 8:63460162-63460184 AATTCTCTGGCCACTGAAGCTGG + Intergenic
1042986797 8:74593713-74593735 AATTCTGTGAACTCTATAGCCGG + Intergenic
1043525552 8:81093152-81093174 AGTTCTGTTCTCTGTGCAGCTGG - Intronic
1045330842 8:101154511-101154533 TACACTGTGCTCTCTGAGGCAGG + Intergenic
1045544432 8:103115668-103115690 TATTCTCTGCTCTGTGATGCTGG + Intergenic
1045990972 8:108307388-108307410 AAATCTTTACTCTCTGTAGCTGG - Intronic
1047498739 8:125426910-125426932 AAATCTGGGAGCTCTGAAGCTGG + Intergenic
1048361348 8:133699768-133699790 AATTCTGTGCTCTGCAAAGCTGG - Intergenic
1048782268 8:138015392-138015414 ATTTCTGTGCCCTCTCCAGCTGG - Intergenic
1049230343 8:141478509-141478531 AATTCTCTGCTCTGAGAGGCCGG + Intergenic
1049308077 8:141918051-141918073 AAGTCTGTGCACACGGAAGCAGG - Intergenic
1050310912 9:4352503-4352525 CATTCTGTGCTCTCTGATCCTGG - Intergenic
1050504276 9:6331163-6331185 AATTCTATGCTTTCAGAACCTGG - Intronic
1051152575 9:14099738-14099760 AATTATGTGCTTTCTGAATCAGG + Intronic
1051501794 9:17786135-17786157 AATTCTGTTCTGGATGAAGCAGG - Intronic
1052472391 9:28916404-28916426 CAATCTATTCTCTCTGAAGCCGG + Intergenic
1053533617 9:38905134-38905156 AATTCTGTCCCCTCTGAATGAGG - Intergenic
1054205841 9:62129563-62129585 AATTCTGTCCCCTCTGAATGAGG - Intergenic
1054632519 9:67458807-67458829 AATTCTGTCCCCTCTGAATGAGG + Intergenic
1055630444 9:78218486-78218508 AAATCTGTGGTCCCTGAAGCTGG + Intergenic
1057898735 9:98930916-98930938 AGGGCTCTGCTCTCTGAAGCGGG - Intergenic
1058179748 9:101782602-101782624 AATTCTGTGAACTCTGAATATGG + Intergenic
1058757850 9:108100363-108100385 GATTCTGAGCTCTCTGGATCAGG + Intergenic
1058779156 9:108316035-108316057 AATTCTGTGTTGTCTGCATCTGG + Intergenic
1059113704 9:111581194-111581216 AATTCTGTACTTTCTTAATCTGG - Intronic
1186724281 X:12340075-12340097 ACTTCTGTGCTATCTGCAACAGG + Intronic
1187254350 X:17628648-17628670 AAATCTGTACTTTCTGAGGCAGG + Intronic
1188715736 X:33457121-33457143 CATTCTGAGCTATCTGGAGCAGG - Intergenic
1189123469 X:38420560-38420582 CAATGTCTGCTCTCTGAAGCTGG - Intronic
1189556899 X:42154400-42154422 AATTCTCTTCTTTCTAAAGCTGG - Intergenic
1190408788 X:50114226-50114248 CAATCTATTCTCTCTGAAGCAGG - Intergenic
1190687956 X:52890902-52890924 CAGTCTATTCTCTCTGAAGCCGG - Intergenic
1190698026 X:52964890-52964912 CAGTCTATTCTCTCTGAAGCCGG + Intronic
1191058270 X:56266699-56266721 AATTATGTGGCCTCTAAAGCAGG + Intronic
1191703644 X:64070196-64070218 ATTTCTGTGCTCTGTGGAGAGGG + Intergenic
1193032881 X:76918495-76918517 AATTCTTTTCTCTCTCAGGCTGG - Intergenic
1195386848 X:104321781-104321803 AATTCAGTGCATTCTAAAGCTGG - Intergenic
1195503702 X:105632398-105632420 AAATCTATGGTCTCTCAAGCAGG - Intronic
1199145662 X:144363085-144363107 CAATCTATTCTCTCTGAAGCTGG - Intergenic
1201220094 Y:11760439-11760461 AGTTCTGTGGACTCTGAGGCAGG + Intergenic
1201366782 Y:13215675-13215697 AATTCTATGACCTCTGATGCTGG + Intergenic
1201440218 Y:14000682-14000704 AACCCCGTGCTCTCTGAAACAGG - Intergenic
1201444353 Y:14042026-14042048 AACCCCGTGCTCTCTGAAACAGG + Intergenic
1202277734 Y:23142631-23142653 AATTCTGTGCTCTGCAAAGTGGG + Intronic
1202279543 Y:23166813-23166835 AATTCTGTGCTCTAAGAATTCGG + Intronic
1202280108 Y:23175195-23175217 AATTCTGTGCTCTAAAAAGTGGG + Intronic
1202280837 Y:23186040-23186062 AATTCTGTGCTCTAAAAAGTGGG + Intronic
1202284889 Y:23230019-23230041 AATTCTGTGCTCTAAGAATTCGG - Intronic
1202287469 Y:23266136-23266158 AATTCTGTGCTCTGCAAAGTGGG - Intronic
1202287634 Y:23268520-23268542 AATTCTGTGCTCTGCAAAGTGGG - Intronic
1202287799 Y:23270905-23270927 AATTCTGTGCTCTGAAAAGTGGG - Intronic
1202287963 Y:23273289-23273311 AATTCTGTGCTCTGAAAAGTGGG - Intronic
1202288129 Y:23275673-23275695 AATTCTGTGCTCTGCAAAGTGGG - Intronic
1202288293 Y:23278057-23278079 AATTCTGTGCTCTGCAAAGTGGG - Intronic
1202432675 Y:24802884-24802906 AATTCTGTGCTCTAAGAATTCGG + Intronic
1202436727 Y:24846867-24846889 AATTCTGTGCTCTAAAAAGTGGG - Intronic
1202437292 Y:24855254-24855276 AATTCTGTGCTCTAAGAATTCGG - Intronic
1202439409 Y:24884193-24884215 AATTCTGTGCTCTGCAAAGTGGG - Intronic
1202439573 Y:24886578-24886600 AATTCTGTGCTCTGAAAAGTGGG - Intronic
1202439738 Y:24888963-24888985 AATTCTGTGCTCTGAAAAGTGGG - Intronic
1202439903 Y:24891347-24891369 AATTCTGTGCTCTGAAAAGTGGG - Intronic
1202440068 Y:24893732-24893754 AATTCTGTGCTCTGAAAAGTGGG - Intronic