ID: 1167455384

View in Genome Browser
Species Human (GRCh38)
Location 19:49594948-49594970
Sequence TTCGAGCGCCTGGCAGGGGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 165}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167455369_1167455384 20 Left 1167455369 19:49594905-49594927 CCTGAAGCCCTCGCAGGCACCCA 0: 1
1: 0
2: 0
3: 22
4: 227
Right 1167455384 19:49594948-49594970 TTCGAGCGCCTGGCAGGGGGCGG 0: 1
1: 0
2: 1
3: 11
4: 165
1167455376_1167455384 0 Left 1167455376 19:49594925-49594947 CCACGGTGCCCTCTTCACTGGGC 0: 1
1: 0
2: 2
3: 17
4: 188
Right 1167455384 19:49594948-49594970 TTCGAGCGCCTGGCAGGGGGCGG 0: 1
1: 0
2: 1
3: 11
4: 165
1167455378_1167455384 -9 Left 1167455378 19:49594934-49594956 CCTCTTCACTGGGCTTCGAGCGC 0: 1
1: 0
2: 1
3: 3
4: 70
Right 1167455384 19:49594948-49594970 TTCGAGCGCCTGGCAGGGGGCGG 0: 1
1: 0
2: 1
3: 11
4: 165
1167455371_1167455384 13 Left 1167455371 19:49594912-49594934 CCCTCGCAGGCACCCACGGTGCC 0: 1
1: 0
2: 0
3: 5
4: 138
Right 1167455384 19:49594948-49594970 TTCGAGCGCCTGGCAGGGGGCGG 0: 1
1: 0
2: 1
3: 11
4: 165
1167455377_1167455384 -8 Left 1167455377 19:49594933-49594955 CCCTCTTCACTGGGCTTCGAGCG 0: 1
1: 0
2: 1
3: 3
4: 72
Right 1167455384 19:49594948-49594970 TTCGAGCGCCTGGCAGGGGGCGG 0: 1
1: 0
2: 1
3: 11
4: 165
1167455374_1167455384 1 Left 1167455374 19:49594924-49594946 CCCACGGTGCCCTCTTCACTGGG 0: 1
1: 0
2: 0
3: 7
4: 134
Right 1167455384 19:49594948-49594970 TTCGAGCGCCTGGCAGGGGGCGG 0: 1
1: 0
2: 1
3: 11
4: 165
1167455372_1167455384 12 Left 1167455372 19:49594913-49594935 CCTCGCAGGCACCCACGGTGCCC 0: 1
1: 0
2: 1
3: 17
4: 187
Right 1167455384 19:49594948-49594970 TTCGAGCGCCTGGCAGGGGGCGG 0: 1
1: 0
2: 1
3: 11
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167455384 Original CRISPR TTCGAGCGCCTGGCAGGGGG CGG Exonic
900183312 1:1321907-1321929 TTCGAGTGGCTGGCAGGGGGAGG - Exonic
900241732 1:1620542-1620564 GTGGACGGCCTGGCAGGGGGTGG + Intronic
900688438 1:3964689-3964711 CACGAGCGCCTGCCAGGTGGAGG + Intergenic
901380323 1:8869316-8869338 TCCGGGAGACTGGCAGGGGGTGG + Intronic
902349980 1:15847447-15847469 TTCCCGCGCCGGGCAAGGGGCGG - Intergenic
903304462 1:22402863-22402885 TTCGAGGCCATGGCACGGGGAGG + Intergenic
903513776 1:23896156-23896178 GTCTAGGGCCTGGCAGGGTGTGG - Intronic
905308350 1:37033945-37033967 TCCGTGCGCCCGGGAGGGGGCGG - Intronic
905327496 1:37167037-37167059 CACTAGGGCCTGGCAGGGGGTGG - Intergenic
906481574 1:46202896-46202918 TTCTAGCCCCTGGGGGGGGGGGG + Intronic
906526454 1:46496059-46496081 ATCTGGCCCCTGGCAGGGGGAGG + Intergenic
922362260 1:224833919-224833941 TTAGAGCTGGTGGCAGGGGGTGG + Intergenic
1064314669 10:14244281-14244303 TTCTGGCGCCTGGAAGGGGGTGG - Intronic
1070747315 10:78941874-78941896 TGCCAGGGCCTGGCAGGGGAGGG + Intergenic
1076396778 10:130144464-130144486 TACCAGGGCCTGTCAGGGGGTGG - Intronic
1076832875 10:133005691-133005713 CTCCAGCGCCTGACAGGGGACGG + Intergenic
1076832882 10:133005725-133005747 ATCCAGCGCCTGACAGGGGATGG + Intergenic
1077170360 11:1163413-1163435 TTCATGGGCCTGGCAGGGGGAGG - Intronic
1081861079 11:46333572-46333594 TCCCAGCGCCAGGCAGGCGGCGG - Intronic
1081993919 11:47351840-47351862 TTCGGGCCCTTGGCAGGGGGCGG + Intronic
1082262614 11:50088873-50088895 TTCTTGAGCCTGGCAGGTGGAGG + Intergenic
1083609293 11:63997577-63997599 GTCTAGCGCCTGGCAGAGGGGGG - Exonic
1084122202 11:67076223-67076245 ATCAAGCGTCTGGCATGGGGTGG - Intergenic
1085034843 11:73293584-73293606 TTCCAGTTCCTGGCAGGGGCCGG - Intronic
1087422634 11:97949567-97949589 CACCAGCGCCTGTCAGGGGGTGG - Intergenic
1088179975 11:107098306-107098328 CACGAGGGCCTGTCAGGGGGTGG + Intergenic
1090645944 11:128766744-128766766 TTCCTGCGCCTGGCAGGGGATGG + Intronic
1093418693 12:18949955-18949977 TTCTAGGGCCTGGCAGGTGCAGG - Intergenic
1095852872 12:46830435-46830457 TTCCAGGGCCTAGCAGGGGGTGG - Intronic
1097412636 12:59273887-59273909 TACCAGGGCCTGTCAGGGGGTGG + Intergenic
1100768208 12:97892469-97892491 CTCGGGGGCCTGTCAGGGGGTGG - Intergenic
1109161575 13:58981992-58982014 TTCTGGGGCCTGGCAGGGGGTGG - Intergenic
1115137367 14:30127183-30127205 TTGGGGAGGCTGGCAGGGGGAGG - Intronic
1120041868 14:79763024-79763046 TACCAGGGCCTGTCAGGGGGTGG - Intronic
1120135907 14:80868051-80868073 TTCAAAGTCCTGGCAGGGGGTGG + Intronic
1121520720 14:94584537-94584559 CTCTAGTGCTTGGCAGGGGGCGG + Intronic
1122359339 14:101150312-101150334 TTGGAGTGCCTGGGAGGGGCGGG + Intergenic
1122878878 14:104681086-104681108 TTCCAGGGCCTGGCTCGGGGAGG - Intergenic
1126477379 15:49079765-49079787 TCTGAGCCCCTGGCAGGGGTCGG - Intergenic
1132817541 16:1839674-1839696 CTCGAGGGCTTGGCAGAGGGAGG - Exonic
1132834281 16:1944948-1944970 ATCTAGAGCCTGGCTGGGGGAGG - Intronic
1133235963 16:4387558-4387580 TTGGACAGCCTGGCAGGGTGGGG - Intronic
1135988328 16:27201268-27201290 CACTAGGGCCTGGCAGGGGGTGG + Intergenic
1137569646 16:49557286-49557308 AATGAGCGCCTGGCAGGAGGAGG + Intronic
1137604824 16:49780417-49780439 CTCGGACCCCTGGCAGGGGGAGG - Intronic
1139138171 16:64230425-64230447 TTCTAGGGGCTGGCAGGAGGCGG + Intergenic
1139956893 16:70697487-70697509 TGCGAGGGCCTGGCTGGGAGTGG + Intronic
1140883945 16:79226363-79226385 TACCAGGGCCTGTCAGGGGGTGG + Intergenic
1142240374 16:88941917-88941939 GGCGAGCGCGGGGCAGGGGGCGG - Intronic
1142571856 17:879776-879798 TTCTAGCCTCCGGCAGGGGGCGG + Intronic
1143358470 17:6348541-6348563 CTTGGGAGCCTGGCAGGGGGAGG - Intergenic
1144772680 17:17768758-17768780 TTGGAGTGCATGGGAGGGGGAGG + Intronic
1146320260 17:31841316-31841338 TTCTAGTGTCTGGCAGGGAGTGG - Intergenic
1146506975 17:33414106-33414128 TTGGAGAGCCTCGCAGGGGTGGG - Intronic
1147285768 17:39401709-39401731 TCGGAGCGCCCGGGAGGGGGAGG + Intronic
1149056314 17:52370804-52370826 TACGAGAGAATGGCAGGGGGAGG + Intergenic
1149610304 17:57954721-57954743 GCCGAGCGCCTTTCAGGGGGAGG - Intronic
1150711387 17:67533424-67533446 TTCAAGAGCCTGGAAGGTGGAGG + Intronic
1150895650 17:69207738-69207760 TACCAGGGCCTGGCAGTGGGTGG + Intronic
1151595759 17:75077286-75077308 CTGGAGCCCCTGACAGGGGGCGG + Intergenic
1152281047 17:79385050-79385072 TGCAAGGGCCTGGCAGGGGCCGG - Intronic
1152758663 17:82097575-82097597 GTCGACGGCCAGGCAGGGGGTGG + Intronic
1157067889 18:44373624-44373646 TTCAAGTTCCTGGCAGGGAGAGG - Intergenic
1160518853 18:79493262-79493284 CGCGAGCGCGTGGCACGGGGCGG - Intronic
1162098307 19:8324133-8324155 CCAGAGCGCCTGGCAGGGGCTGG - Intronic
1162811708 19:13167967-13167989 TTCGTGCTGCTGGCTGGGGGAGG + Intergenic
1165774230 19:38395522-38395544 TCAGAGCCCCTGGCAGGGGCAGG + Exonic
1166827158 19:45616692-45616714 TCAGAGCTCTTGGCAGGGGGAGG - Intronic
1167145193 19:47677184-47677206 CTCGAGCACCTGCCAGGGGCCGG + Intronic
1167291005 19:48625105-48625127 TGCGAGCGCCTGCAAGGGGCAGG - Intronic
1167455384 19:49594948-49594970 TTCGAGCGCCTGGCAGGGGGCGG + Exonic
927093315 2:19728768-19728790 TTCCAGCGGCTGCCAAGGGGCGG - Intergenic
927125495 2:20009464-20009486 CACCAGCGCCTGTCAGGGGGTGG + Intronic
929761976 2:44814509-44814531 TTCCAGAGCCATGCAGGGGGTGG + Intergenic
932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG + Exonic
933998309 2:87686082-87686104 TGCAAGCACCTGGCAGGGGCTGG + Intergenic
935183026 2:100706929-100706951 TCCGAGCGCTGGGCAGGGGAGGG + Intergenic
936057243 2:109270310-109270332 TTGGAGTGCCGGGCATGGGGAGG + Intronic
936070274 2:109365178-109365200 CTCGTGCTTCTGGCAGGGGGAGG - Intronic
936295539 2:111264791-111264813 TGCAAGCACCTGGCAGGGGCTGG - Intergenic
937131367 2:119516547-119516569 TGCCAGGGCCTGGGAGGGGGTGG + Intronic
939851285 2:147308899-147308921 TACCAGGGCCTGTCAGGGGGTGG - Intergenic
942241361 2:173965629-173965651 TCCGAGCGCCTGCAAGGTGGAGG - Exonic
944041040 2:195355235-195355257 TACCAGGGCCTGTCAGGGGGTGG + Intergenic
944148547 2:196532463-196532485 TACCAGGGCCTGTCAGGGGGTGG + Intronic
944504743 2:200399226-200399248 TTCCAGGGCCTGGAAGGAGGAGG - Intronic
946652953 2:221913887-221913909 TTCAAGCCCTTTGCAGGGGGAGG - Intergenic
948591006 2:239050188-239050210 TGCAAAGGCCTGGCAGGGGGAGG - Exonic
1169141538 20:3229808-3229830 CTCCAGCGTGTGGCAGGGGGAGG + Intronic
1172620110 20:36313135-36313157 TTCCAGCTCCTGTCATGGGGAGG + Intronic
1173007609 20:39152074-39152096 TTGGAGGGCCTGGGGGGGGGGGG + Intergenic
1173407485 20:42779114-42779136 TTCTAGTGCCAGGCAGAGGGAGG + Intronic
1174046961 20:47740530-47740552 TGGGAGCTCCAGGCAGGGGGTGG + Intronic
1174535915 20:51251407-51251429 TTCATGCCCTTGGCAGGGGGAGG + Intergenic
1175301605 20:57947126-57947148 GTGAAGGGCCTGGCAGGGGGAGG - Intergenic
1175940983 20:62537455-62537477 TCCCAGGGCCTGGCAGGGGTGGG - Intergenic
1175952229 20:62589544-62589566 TTTGAGGGCCTGGCCTGGGGAGG + Intergenic
1176286333 21:5021193-5021215 ATCGCGCGCCTGGCAGGGGCGGG - Intergenic
1179870848 21:44242282-44242304 ATCGCGCGCCTGGCAGGGGCGGG + Intergenic
1180183072 21:46126604-46126626 CTCGAGGGCCGGGCTGGGGGAGG + Intronic
1180913511 22:19469755-19469777 TTCCAGCTCCTGGCATGGGCAGG - Intronic
1184850371 22:47116229-47116251 TCCCAGCTCCTGGCAGGTGGTGG - Intronic
950707443 3:14791806-14791828 TGCGAGTGCCTGGGAAGGGGTGG + Intergenic
952918170 3:38265515-38265537 TACCAGGGCCTGTCAGGGGGTGG - Intergenic
954368362 3:50157622-50157644 TTGGACAGCCTGGCAGGTGGGGG - Intronic
954886880 3:53882365-53882387 TTCGAGCGCCTAGTGGGGGTCGG + Intergenic
957958813 3:87224259-87224281 TGCCAGGGCCTGTCAGGGGGTGG - Intergenic
959623782 3:108426799-108426821 TGAGAGCTCCTGCCAGGGGGGGG + Intronic
961862136 3:129925726-129925748 TTCTAACCCCTGGCATGGGGCGG + Intergenic
962202419 3:133412705-133412727 TTCCAGAGCCTGGCACAGGGAGG + Intronic
966911439 3:184562330-184562352 TTCCAGCGCCCGGCAGCCGGCGG - Exonic
968905135 4:3447405-3447427 TCCGTGGGCCTGACAGGGGGTGG + Intronic
968970689 4:3791969-3791991 CTGGAGCACCTGGCAGGTGGGGG + Intergenic
969638282 4:8382063-8382085 TCCAAGGGCCAGGCAGGGGGAGG - Intronic
971244055 4:24912825-24912847 TGAGAGCGACTGGCAGGGGCTGG - Exonic
972883439 4:43454950-43454972 TTCCAGAGGCTGGCAGGGAGAGG - Intergenic
974825045 4:67117436-67117458 CTCCAGGGCCTGTCAGGGGGTGG + Intergenic
980260045 4:130436979-130437001 CACCAGGGCCTGGCAGGGGGAGG - Intergenic
980276392 4:130656345-130656367 ATCCAGGGCCTGTCAGGGGGTGG + Intergenic
981132110 4:141168779-141168801 CACCAGCGCCTGTCAGGGGGTGG + Intronic
984146303 4:176065784-176065806 TTGGAGCGCCCGAGAGGGGGAGG - Intergenic
984616332 4:181902749-181902771 TACCAGGGCCTGTCAGGGGGTGG + Intergenic
984713656 4:182906040-182906062 TGCGAGGGCCTTGGAGGGGGTGG - Intronic
984765741 4:183399004-183399026 TCCCGGCGCCTGGCAGCGGGAGG - Intergenic
995725860 5:115179869-115179891 TTCCAGCGCCTGGGAAGGGCGGG - Intronic
997282193 5:132656282-132656304 TCCGAGCGCCAGGCAGGGCAAGG - Intronic
997596217 5:135109006-135109028 TCAGAGTGCCTGGCAGGGAGAGG + Intronic
1000214838 5:159145522-159145544 TGCCAGGGCCTGTCAGGGGGTGG + Intergenic
1003115838 6:3283561-3283583 TCTGAGCGTCTGGCAAGGGGGGG - Intronic
1009289780 6:61868331-61868353 ATGGAGTGCCTGGCAGGGAGGGG - Intronic
1010689319 6:78890255-78890277 TACCAGGGCCTGTCAGGGGGTGG + Intronic
1013651545 6:112200092-112200114 TGCGAGCAGCTGGCAGGTGGAGG + Intronic
1015875896 6:137822161-137822183 TTCTTGAGCCTGGCAGGCGGAGG + Intergenic
1017446559 6:154511582-154511604 TTTCAGCGCCTGGCAGGGGAGGG + Intergenic
1017592310 6:155990731-155990753 TACGGGGGCCTGTCAGGGGGTGG - Intergenic
1018613299 6:165662901-165662923 TTCGGGCGGCCGGCAGGGGTGGG - Intronic
1019644211 7:2120476-2120498 TTCCAGAGCCTGGCACAGGGAGG + Intronic
1019708277 7:2506851-2506873 TTCGAGAACCTGGGAGGGAGGGG + Intergenic
1020492401 7:8803637-8803659 TACCAGGGCCTGTCAGGGGGTGG + Intergenic
1023146240 7:37153562-37153584 TGCTGGAGCCTGGCAGGGGGAGG + Intronic
1023983075 7:45080839-45080861 CTCCAGGGCCTCGCAGGGGGTGG - Intronic
1029707720 7:102284609-102284631 TTGCAGCCCCTGGCAGGCGGGGG - Intergenic
1031406902 7:121396486-121396508 GTGCAGCGCCTGGCCGGGGGCGG - Intergenic
1032016218 7:128381823-128381845 TGTGAGGGCCTGGCGGGGGGTGG - Intergenic
1033565085 7:142570313-142570335 ATGGAGCTCCTGGCAGGGAGGGG + Intergenic
1034415487 7:150962295-150962317 TTCGAGGGCCTGGCTGGCTGTGG - Intronic
1038272038 8:26083023-26083045 ATGGAGCCCCTGCCAGGGGGAGG + Intergenic
1038644485 8:29350863-29350885 TTCAAGCTCCGGGGAGGGGGTGG - Intergenic
1038734418 8:30156295-30156317 TTGGAGAGCCTGGCAGGGTTGGG - Exonic
1041666815 8:60453683-60453705 TACCAGGGCCTGTCAGGGGGTGG + Intergenic
1043296726 8:78673071-78673093 CTCCAGGGCCTGTCAGGGGGTGG - Intronic
1044073502 8:87790658-87790680 TACCAGGGCCTGTCAGGGGGTGG + Intergenic
1046103575 8:109642281-109642303 TACCAGGGCCTGTCAGGGGGTGG + Intronic
1047201061 8:122768106-122768128 TACCAGGGCCTGTCAGGGGGTGG + Intergenic
1048473798 8:134725244-134725266 TTCAAGCGCCTGGCAAAGAGTGG + Intergenic
1049218069 8:141416839-141416861 GGGGAGAGCCTGGCAGGGGGAGG + Intronic
1049363518 8:142225438-142225460 TGTGAGCACCTGGCAGGGGAGGG - Intronic
1049643184 8:143724743-143724765 TTCTAGCGCCTGGCTTGGGCCGG + Exonic
1052228273 9:26116313-26116335 TTTGTGGGCGTGGCAGGGGGAGG + Intronic
1052795346 9:32918817-32918839 TTTGAGCGGTTTGCAGGGGGAGG + Intergenic
1054890534 9:70246301-70246323 TACCAGGGCCTGCCAGGGGGTGG + Intergenic
1055832049 9:80391337-80391359 TACCAGGGCCTGTCAGGGGGTGG + Intergenic
1057199042 9:93130674-93130696 GTGGAGCGCATGGCAGTGGGTGG + Intronic
1058896349 9:109403987-109404009 TTCCAGCACATGGCTGGGGGTGG + Intronic
1061053944 9:128211870-128211892 TCAGAGCTCCTGGCAGAGGGCGG + Intronic
1062022707 9:134326802-134326824 TTCGGGCGCCGGGCCCGGGGAGG + Intronic
1062488731 9:136793831-136793853 TTCCAGTGCCTGGCAAGGTGAGG - Intronic
1062574360 9:137199608-137199630 TCCGAGCTCCTGGCTCGGGGAGG + Exonic
1185741315 X:2535015-2535037 TACCAGGGCCTGTCAGGGGGTGG + Intergenic
1185845788 X:3436320-3436342 TTTGAGAGCCAGGTAGGGGGTGG + Intergenic
1189317161 X:40064298-40064320 TTCGCCCGCCTGCCGGGGGGTGG - Intronic
1190215392 X:48476514-48476536 TTCGGGCGGCTGGCACCGGGTGG + Intronic
1192210322 X:69123694-69123716 ACAGAGCACCTGGCAGGGGGTGG - Intergenic
1193449779 X:81651597-81651619 CTCGTGCTTCTGGCAGGGGGAGG - Intergenic
1198585313 X:138114197-138114219 TTCCAGTGCCTGGCAGGGAGGGG + Intergenic
1200119813 X:153784920-153784942 CTCGAAGGCCTGGAAGGGGGAGG - Exonic
1200818640 Y:7559971-7559993 TTTGAGAGCCAGGTAGGGGGTGG - Intergenic
1202040702 Y:20680406-20680428 TACCAGGGCCTGTCAGGGGGTGG + Intergenic