ID: 1167456456

View in Genome Browser
Species Human (GRCh38)
Location 19:49598834-49598856
Sequence CTGGGTTTAGGGAGAGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 562
Summary {0: 1, 1: 0, 2: 3, 3: 51, 4: 507}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167456447_1167456456 16 Left 1167456447 19:49598795-49598817 CCACAGAGTGAGACCCTGTCTCA 0: 152
1: 713
2: 1488
3: 2816
4: 3494
Right 1167456456 19:49598834-49598856 CTGGGTTTAGGGAGAGAGGCAGG 0: 1
1: 0
2: 3
3: 51
4: 507
1167456446_1167456456 22 Left 1167456446 19:49598789-49598811 CCTGGGCCACAGAGTGAGACCCT 0: 209
1: 6307
2: 38188
3: 109250
4: 204199
Right 1167456456 19:49598834-49598856 CTGGGTTTAGGGAGAGAGGCAGG 0: 1
1: 0
2: 3
3: 51
4: 507
1167456450_1167456456 2 Left 1167456450 19:49598809-49598831 CCTGTCTCAAGAGATAAAGGAAA 0: 1
1: 0
2: 18
3: 306
4: 3082
Right 1167456456 19:49598834-49598856 CTGGGTTTAGGGAGAGAGGCAGG 0: 1
1: 0
2: 3
3: 51
4: 507
1167456449_1167456456 3 Left 1167456449 19:49598808-49598830 CCCTGTCTCAAGAGATAAAGGAA 0: 1
1: 0
2: 22
3: 422
4: 4287
Right 1167456456 19:49598834-49598856 CTGGGTTTAGGGAGAGAGGCAGG 0: 1
1: 0
2: 3
3: 51
4: 507

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167456456 Original CRISPR CTGGGTTTAGGGAGAGAGGC AGG Intronic
900283951 1:1890600-1890622 CGGGGTCTAGGGAGAGGAGCCGG - Intronic
900736066 1:4300261-4300283 CTGGCTCTGGGGAGAGAGGCTGG + Intergenic
900756667 1:4440174-4440196 CTGGGGTGAAGGAAAGAGGCTGG - Intergenic
901029831 1:6300633-6300655 CTGTGTTTGTGGAGAGAGGCCGG - Intronic
901165465 1:7218462-7218484 CTGGTTTTTGGGGGAGGGGCGGG + Intronic
901931212 1:12596927-12596949 CTGGGTTTATTGTGAGAAGCCGG + Intronic
902188896 1:14746640-14746662 CTGGGGTCAGGGAGGGAGGGTGG + Intronic
902977656 1:20100698-20100720 TTGGGTTTAGGGCGAATGGCTGG - Intergenic
903261974 1:22136398-22136420 CTGGGGTTGGGGAAAGAGGAGGG + Intronic
903325317 1:22565757-22565779 CAAGGTCTAGAGAGAGAGGCAGG + Intronic
903692431 1:25183921-25183943 CTGGATCTGGGCAGAGAGGCAGG - Intergenic
904165642 1:28553181-28553203 CTCGGTTTCGCGAGAGAGGAAGG + Intronic
904370719 1:30045948-30045970 CTGGGCTCAGGGATGGAGGCTGG - Intergenic
904402163 1:30263957-30263979 GTGGGTTTGGAGAGAGATGCGGG - Intergenic
904563204 1:31412481-31412503 ATGGGTTTAGAGTGAGAGGCTGG + Intronic
905204721 1:36336836-36336858 CGGTGGTTAGGGGGAGAGGCTGG - Intergenic
905598431 1:39229467-39229489 CTGGGCTTGGGGAGAGAACCTGG + Intronic
905682128 1:39881091-39881113 CTGGGATTAGGGTGAGGGACAGG - Intronic
905894825 1:41538768-41538790 GTGGGGTTAGGGAGGCAGGCAGG + Intronic
905970558 1:42138693-42138715 CTGGGTATGGGGAGAGTGGGAGG - Intergenic
906114926 1:43350018-43350040 ATGGGTTTAGTGAGACAGGGAGG - Intronic
906248860 1:44296009-44296031 CTAGGTTTAGGGAGGGGGCCAGG + Intronic
907926142 1:58956802-58956824 CTGGGTATAGGGAGAAAGGAAGG - Intergenic
907963772 1:59309438-59309460 TTGAGGTTAGGGAGAGAGGCAGG + Intronic
908123647 1:61008706-61008728 CTGGGGTGAGGCAGAGGGGCGGG + Intronic
908579863 1:65503140-65503162 TGGGGTTTGGGGAGAGAGGAAGG + Intronic
908788921 1:67761797-67761819 GAGGGTGCAGGGAGAGAGGCAGG + Intronic
909094084 1:71265680-71265702 GTGGGATGAGGGAGAGAAGCAGG - Intergenic
909185999 1:72486664-72486686 CTGGGTGTAGTGAGAGAGTAGGG + Intergenic
909256963 1:73436780-73436802 CAGGGATTAGGGAGAAAGGAGGG + Intergenic
909995669 1:82276305-82276327 CTGGATTTAGGGAGATAGAAGGG - Intergenic
911002372 1:93180013-93180035 CTGGGTTAAAGGAAGGAGGCTGG + Intronic
911968529 1:104399213-104399235 CTGAGGATAGGGAGAGAAGCAGG + Intergenic
912644422 1:111378643-111378665 CTGGGTTGAGAGAGAGGGGAAGG - Intergenic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
912737642 1:112164394-112164416 GTGGGTGGAGGGAGAGAGGGTGG + Intergenic
913224441 1:116686727-116686749 CTTGTTTCAGGGAGAGAAGCTGG + Intergenic
914847730 1:151292193-151292215 CTGGGTTTGGGGAAGGAGTCAGG + Exonic
915776566 1:158495018-158495040 CTGAGTGTTGGGAAAGAGGCTGG - Intergenic
915808390 1:158879037-158879059 AAGGGTTTAGGGACAGTGGCAGG - Intergenic
916060189 1:161092983-161093005 TTGTGCTTAGGGAGAGAGGAGGG + Intergenic
917834669 1:178931942-178931964 GTGGGGTTCGGGACAGAGGCGGG - Intergenic
918114240 1:181483315-181483337 CCTAGTTCAGGGAGAGAGGCAGG - Intronic
918284688 1:183040628-183040650 CTGGGTTTCAGGAGAAAGGCTGG + Intronic
919778819 1:201210051-201210073 ATGGGTTCAGGGAGTAAGGCAGG + Exonic
919778891 1:201210375-201210397 ATGGGTTCAGGGAGTAAGGCAGG + Exonic
919779137 1:201211455-201211477 ATGGGTTCAGGGAGTAAGGCAGG + Exonic
919779164 1:201211563-201211585 ATGGGTTCAGGGAGTAAGGCAGG + Exonic
919796392 1:201323792-201323814 CTGGCTGTGAGGAGAGAGGCTGG + Intronic
920100197 1:203512541-203512563 CTGGCCTCAGGGAGACAGGCAGG + Intergenic
920311604 1:205052054-205052076 CAGGGCTTGGGGAGAGAGCCTGG - Intronic
920349298 1:205327350-205327372 CTGTGTTAAGGGAGGGAGGAAGG + Intergenic
921064965 1:211616290-211616312 CTGGGGTAAGGGAGACAGGCTGG + Intergenic
921284275 1:213594957-213594979 CTGGGGGTTGGGAGAGAGGTGGG + Intergenic
922823416 1:228500732-228500754 CTGGGGGGAGAGAGAGAGGCAGG + Intergenic
924612189 1:245582921-245582943 CGGGGTGCAGGGAGAGAGGAAGG - Intronic
924730507 1:246707102-246707124 TTGGGTGGAGGGAGAAAGGCTGG - Intergenic
1062908514 10:1196058-1196080 CAGGGTTTTGGGAAACAGGCAGG - Intronic
1063459203 10:6204501-6204523 GTGGGTGTGGGGAGAGGGGCAGG - Intronic
1063993685 10:11595372-11595394 CTGGCTTTAGGCACAGAGCCTGG - Intronic
1064146252 10:12828665-12828687 CTGGGTTTATGGTGGGGGGCGGG - Intronic
1064425547 10:15226146-15226168 CTGGGTTTCTGGGGTGAGGCAGG - Intronic
1065716870 10:28579001-28579023 CTTGGTTTAGGGAGAAGAGCAGG - Intronic
1066477852 10:35765151-35765173 CTGGCTTGAGTGAAAGAGGCTGG - Intergenic
1067165788 10:43865628-43865650 ATGGGTTTAGGGGGAGATGCAGG - Intergenic
1067451686 10:46385558-46385580 CTAGAGTTAGGGAGAGAGCCAGG + Intronic
1067523985 10:47027475-47027497 CTGGGGAGAGGGAGAGAGCCAGG + Intergenic
1067585552 10:47474197-47474219 CTAGAGTTAGGGAGAGAGCCAGG - Intronic
1069547463 10:69338987-69339009 GTGGGTTGAAGGAGAGAGGGAGG - Intronic
1069556600 10:69402422-69402444 CTGTGTTTGGGTAGAGAGGGAGG - Intergenic
1070324412 10:75378517-75378539 CTGGGCTGAGGGAGGGAGGGAGG - Intergenic
1070325855 10:75388451-75388473 CTGCATTTGGGGAGAAAGGCAGG + Intergenic
1070508432 10:77137978-77138000 CTGGGTTAAGGTAGGGAGCCAGG - Intronic
1070710954 10:78682876-78682898 TTAAGTTTAGGGAGAGAGGAGGG - Intergenic
1070834601 10:79440348-79440370 CTGGGTTGATGGGGAGTGGCTGG + Intronic
1071600479 10:86956437-86956459 ATGGATTTAGGGAGTGAGGGGGG - Intronic
1072257656 10:93635744-93635766 CTGGGCTGAGAGAGAGAGACAGG + Intronic
1073463008 10:103677334-103677356 GTAGGTTTGGGGAGACAGGCTGG + Intronic
1074292520 10:112149261-112149283 GGAAGTTTAGGGAGAGAGGCTGG + Intergenic
1075005010 10:118823809-118823831 CTGTGTTTATGGAGAGGGGCTGG + Intergenic
1075310972 10:121413063-121413085 CTGGGTACAGGTAGAGATGCTGG - Intergenic
1075712135 10:124536450-124536472 CAGGGTGGAGGGAGAGGGGCCGG - Intronic
1076294650 10:129375219-129375241 CTCGGCAGAGGGAGAGAGGCTGG + Intergenic
1076526783 10:131117123-131117145 CTGTGTTCAGGGTGGGAGGCTGG + Intronic
1076716411 10:132366472-132366494 CTGGGCTGTGGGAGAGACGCAGG + Intronic
1076853337 10:133103611-133103633 CTGGACTGAGGGAGAGAGGGAGG - Intronic
1076905306 10:133358118-133358140 CGGGGCTTAGGGGCAGAGGCGGG + Intergenic
1077225245 11:1436678-1436700 CTGGGTGTAGAGGAAGAGGCTGG + Intronic
1077227602 11:1445177-1445199 CTGGGCACAGGGAGAGTGGCAGG + Intronic
1077498515 11:2898267-2898289 CTGGGTCTGGAGAGAGAGGCAGG - Intronic
1078084207 11:8224159-8224181 CTGGCTTTAGGGGAAGAAGCTGG - Intergenic
1079003354 11:16775588-16775610 CAGGGGTTAGAGAGAGAGGGAGG + Intergenic
1079334964 11:19563282-19563304 CTGTGTTTGGGAAGAGAGACTGG - Intronic
1081567028 11:44266351-44266373 CTGAGTTTAGGGAGGGAGAGGGG + Intronic
1083268085 11:61556249-61556271 CTGGGCTGAGGGAGGGTGGCAGG - Intronic
1083327212 11:61878842-61878864 CTGAGCCTGGGGAGAGAGGCAGG + Exonic
1083627653 11:64079710-64079732 TTGGGTTCAGGGAGAGAGTGGGG + Intronic
1083731198 11:64653617-64653639 TGGGATTTAGGGAGGGAGGCTGG - Intronic
1083827970 11:65213825-65213847 CCGGCTTTATGTAGAGAGGCCGG - Intergenic
1083842978 11:65315211-65315233 CTGGGTCTCGGGAGGGGGGCGGG - Intronic
1083935948 11:65870232-65870254 CTATGTCTAGGGATAGAGGCAGG + Exonic
1084068332 11:66718369-66718391 CTGGGTGTGGGGAGAGTGGCCGG - Intronic
1084450008 11:69231063-69231085 GTGGGGTTAGAGAGAGAGACGGG + Intergenic
1084461226 11:69297763-69297785 CTGGGGTAGGGGAGTGAGGCAGG - Intronic
1084941467 11:72615492-72615514 GTGGGTAGAGGGAGGGAGGCAGG + Intronic
1085168144 11:74423381-74423403 CTGGCTTTAGAGAGAGAAGAAGG + Intergenic
1085282047 11:75337504-75337526 CTTGGGTTAGGGAGTGAGTCAGG - Intronic
1085533447 11:77204737-77204759 CTGGGTGTAAGGAGAGAGGGTGG - Intronic
1085726483 11:78959494-78959516 TTGGGTTTCAGGAGAGAGGAAGG + Intronic
1085765618 11:79279345-79279367 ATGGTGTTAAGGAGAGAGGCAGG + Intronic
1088599255 11:111460931-111460953 CTGGGTTTGGTGGGAGAGACAGG - Intergenic
1089163185 11:116455284-116455306 CTGGGCTTAGGAAAAAAGGCTGG + Intergenic
1089175724 11:116547645-116547667 CTGGGCTTTGGGAGAGAGGGAGG - Intergenic
1089326588 11:117661645-117661667 CTGGCCTTAGGGAGGGATGCAGG - Intronic
1089432771 11:118436904-118436926 CCGTGTTTGGGGAGAGCGGCGGG + Exonic
1089678187 11:120104604-120104626 CTTGGTTCAGGGAGCCAGGCAGG - Intergenic
1089818099 11:121194765-121194787 CTGAGTTTTAGGAGAAAGGCTGG - Intergenic
1090062362 11:123475162-123475184 CTGGGTACAGGGAGGGAGGAAGG + Intergenic
1091588214 12:1827999-1828021 CAGGGGTTAGGGAGAGGGCCCGG - Intronic
1092037957 12:5357004-5357026 CTGGGATTTCTGAGAGAGGCAGG - Intergenic
1092160408 12:6312493-6312515 CTGGGTTGCGGGAAAGAGGAGGG + Intronic
1092288734 12:7145770-7145792 GAGAGTTCAGGGAGAGAGGCTGG - Intronic
1092739562 12:11614641-11614663 GAGGGTTTAGTGAGAGAGGTTGG + Intergenic
1092763657 12:11832507-11832529 CTGATTTTAGGAAGAGAAGCTGG + Intronic
1094066970 12:26371679-26371701 CTGAGCCTAGTGAGAGAGGCAGG + Intronic
1096114333 12:49046506-49046528 CTGGGTTTAGGAGGCCAGGCTGG - Intronic
1096250393 12:50028258-50028280 CAGGGGTGAGGGAGAGAAGCAGG + Intronic
1096626333 12:52898421-52898443 CTGGGATGAGGGCGGGAGGCAGG - Intronic
1096630321 12:52922293-52922315 CTGTCTTCAGGGAGAGAGGGAGG - Intronic
1096751092 12:53759272-53759294 CTGGGTAGAGGGTGGGAGGCTGG - Intergenic
1096798269 12:54092047-54092069 CTGGGTTTAAGGTGAGAGGTTGG - Intergenic
1096838120 12:54364153-54364175 CTGGGTTTACTGAGAGCAGCGGG - Exonic
1096873264 12:54608125-54608147 CTGGGCTCAGGAAGAGAGGCAGG - Intergenic
1097071662 12:56359871-56359893 TTAGGGTTAGGGAGATAGGCTGG + Intronic
1097168551 12:57099114-57099136 CTGGGGTTAGGGAGGAAGGGAGG + Intronic
1097189514 12:57212771-57212793 CTGCCTTCAGGGAGACAGGCAGG + Exonic
1098880868 12:75915790-75915812 CTGGGTTGAAGGAGATAGGAAGG + Intergenic
1102960106 12:117086982-117087004 CTGGGCCTTGGGAGGGAGGCAGG + Intronic
1103317297 12:120066454-120066476 CTGGGTTGGGGGAAAGAGGCAGG + Intronic
1105638530 13:22239625-22239647 CAGGGTTTTGGAAGAGAGACAGG + Intergenic
1106184428 13:27396562-27396584 CTGGGGTTGGGAAGAGAGGTGGG + Intergenic
1106468645 13:30035498-30035520 GTGGGTTTAGGGTGTGAGTCTGG + Intergenic
1106597979 13:31162452-31162474 CTGGGACTCGCGAGAGAGGCTGG + Intergenic
1108313537 13:49218029-49218051 TTGGGTCTAAGGAGAGAGGAGGG + Intergenic
1108536934 13:51392453-51392475 CTAGGTTTAGAGAGGTAGGCAGG - Intronic
1109208233 13:59505335-59505357 CTTGGTTTATGGAAAGTGGCAGG + Intergenic
1110629980 13:77697508-77697530 CTGGGATTAGGTAGCGAGGGTGG + Intergenic
1110936438 13:81295962-81295984 CTTGGTTTAGGGATAGGGGGTGG - Intergenic
1112814068 13:103251691-103251713 CAGGGTTTTGGAAGAGAGTCAGG + Intergenic
1113648983 13:112020775-112020797 CTGAGTAGAGGGAGAGAGACTGG - Intergenic
1113713069 13:112483620-112483642 CTGAGAAGAGGGAGAGAGGCTGG + Intergenic
1113743443 13:112726282-112726304 CTGTGTGCAGGGAGAGGGGCTGG + Intronic
1115090051 14:29564173-29564195 CTGGATTGAGGCAGAGAAGCAGG - Intergenic
1115846444 14:37540794-37540816 ATGGGGTAAGGGAGAAAGGCTGG - Intronic
1116577388 14:46591778-46591800 CTGGGTTCAAGGAGAGTAGCTGG - Intergenic
1118851731 14:69588951-69588973 CTGGGCTGAGTGAGAGAGGCTGG + Intergenic
1118968088 14:70607004-70607026 CTGGGTTAAGGGTGTGAGGGAGG - Intergenic
1119377322 14:74205242-74205264 TTGGATTTTGAGAGAGAGGCAGG + Intergenic
1119572963 14:75692678-75692700 CTGTGTATGGGGAGCGAGGCAGG + Intronic
1120870664 14:89334242-89334264 TTGGGGTTGGGGAGTGAGGCGGG + Intronic
1122086748 14:99312901-99312923 ATGGGGTTAGGGAGAGAGTAGGG + Intergenic
1122087324 14:99316876-99316898 CTGGGTTCGGGGAAAGAGGGCGG + Intergenic
1122092020 14:99347164-99347186 CTGGGTGTGGGGAGGAAGGCGGG - Intergenic
1122862847 14:104590218-104590240 CTGGGCCTGGGGAGAGATGCTGG - Intronic
1122863172 14:104591624-104591646 CTGGGTCCCGGGAGTGAGGCTGG - Intronic
1202902290 14_GL000194v1_random:50805-50827 CTGGGGATTGGGAGAGTGGCCGG - Intergenic
1125752799 15:42041488-42041510 CTGGGGTTGGGGAAAGAGGTTGG + Intronic
1126360828 15:47844168-47844190 CTTGGGTAAGGGGGAGAGGCAGG + Intergenic
1126667152 15:51085779-51085801 CTTTATTTAGGGAGAGAGGAGGG - Intronic
1126873052 15:53010154-53010176 CTGGAGTTCAGGAGAGAGGCTGG + Intergenic
1127184322 15:56462322-56462344 GTGGGTTTAGGAAGACAGTCTGG - Intronic
1127480413 15:59372330-59372352 CCGGGTTTACGGAAAGCGGCAGG + Intronic
1128665404 15:69533881-69533903 CTGGGTTCAGGGAATGAGGTTGG + Intergenic
1131305709 15:91241334-91241356 CGGGGTTTAGGGACAGATGGAGG - Intronic
1131515308 15:93072975-93072997 ATGGGTATGGGGAGAGGGGCAGG - Exonic
1131748089 15:95471798-95471820 CTGGCTTTAGGGAGGGAGAGAGG - Intergenic
1132153167 15:99476518-99476540 CTGGGCTTGGGGAGAGATGCTGG - Intergenic
1132566761 16:627128-627150 CTGGCTTTAGGGAGCAAGGCAGG + Intronic
1132617420 16:848635-848657 CTGGAATTAGGCAGAGATGCTGG - Intergenic
1132646007 16:999602-999624 CTGGGTTTTGGGCCAGAGTCTGG + Intergenic
1132664758 16:1076291-1076313 CAGGGTGTGGGGAGAGAGGGAGG - Intergenic
1133374546 16:5273588-5273610 CTGTGTTTAAGGTGAGAAGCGGG + Intergenic
1133702796 16:8324929-8324951 CTGGAGTGAGGGAGAGATGCTGG - Intergenic
1133899396 16:9959308-9959330 CTAGGTTTAGGGATGGAAGCTGG - Intronic
1134504001 16:14790798-14790820 CTGAGGTCAGGGAGGGAGGCAGG + Intronic
1134576571 16:15338110-15338132 CTGAGGTCAGGGAGGGAGGCAGG - Intergenic
1134725868 16:16418389-16418411 CTGAGGTCAGGGAGGGAGGCAGG + Intergenic
1134887456 16:17806321-17806343 CTTAGTTTAAGGAGAGAGCCAGG - Intergenic
1134941565 16:18293470-18293492 CTGAGGTCAGGGAGGGAGGCAGG - Intergenic
1135016187 16:18926490-18926512 CCGGGCCTGGGGAGAGAGGCGGG + Intergenic
1135052630 16:19204921-19204943 CTGGGTTTGGGGATAAATGCGGG - Intronic
1135437168 16:22436949-22436971 CCGGGCCTGGGGAGAGAGGCGGG - Intronic
1136333279 16:29595423-29595445 CCGGGCCTGGGGAGAGAGGCGGG + Intergenic
1136447963 16:30335454-30335476 CCGGGCCTGGGGAGAGAGGCGGG + Intergenic
1136990280 16:35147691-35147713 CTGGGGTGAGGGTGTGAGGCAGG - Intergenic
1137236819 16:46624180-46624202 CAGGGCTTAGGGAGGGAGGGAGG - Intergenic
1138269163 16:55682476-55682498 TTGGGTTTAGCAAGAAAGGCTGG + Intronic
1138993166 16:62417281-62417303 CTGGGGTCAGGGACACAGGCAGG + Intergenic
1139281960 16:65778921-65778943 GAGGGTTTAGGAAGAAAGGCAGG + Intergenic
1139786670 16:69398498-69398520 ATGGTTTTAGGGAGAGAGCAGGG + Intronic
1140204519 16:72922550-72922572 CTGGGTTGAGGGTGACAAGCAGG - Intronic
1140439126 16:74973323-74973345 CTGGGGTGATGGAGAGAGACCGG - Intronic
1141432392 16:83977192-83977214 AGGGGTTTATGCAGAGAGGCTGG + Intronic
1141526579 16:84615558-84615580 CTGAATTTAGGGAGGGAAGCTGG + Intronic
1141869199 16:86773092-86773114 CTGCGTTTTGGGAGAGGAGCAGG + Intergenic
1141931486 16:87207553-87207575 CTGGGTTTAAGGTGAGGGCCGGG - Intronic
1142499577 17:324623-324645 GAAGGTTTAGGGAGAGAGACAGG - Intronic
1142765016 17:2059797-2059819 CTGGGACTGGGGAGGGAGGCAGG - Intronic
1144307807 17:13985046-13985068 CTGGGTCCAGAGTGAGAGGCAGG + Intergenic
1144666354 17:17104927-17104949 CTTGGTTTAGGGAGGGTGGTTGG + Intronic
1144855921 17:18267736-18267758 TTGGGTGTAGGGCAAGAGGCGGG + Intergenic
1146509271 17:33431602-33431624 CTGGGTAGAGGAAGAGAGTCAGG + Intronic
1146793316 17:35765030-35765052 ATGGTTTCAGGGAAAGAGGCAGG - Exonic
1146804522 17:35854772-35854794 CTTGATTTAGGGAGGCAGGCTGG + Intronic
1147391470 17:40111922-40111944 CTGGGCTTAGGGAGAGGGAAAGG - Intergenic
1147668142 17:42161622-42161644 CTGGGGTAAGGGAAAGAGGTAGG + Intronic
1148119651 17:45200921-45200943 GTGGTTTTAGGGAGAAGGGCGGG - Intergenic
1148135800 17:45290831-45290853 TTGGGTTGGGGGAGAAAGGCAGG + Intronic
1149772231 17:59331458-59331480 CTGGGCTAGGGGAGAGCGGCTGG - Intergenic
1150410181 17:64935764-64935786 CGGGGGTGAGGGTGAGAGGCAGG - Intergenic
1151413648 17:73947595-73947617 CAGGGTTTAGTGAGAGAAGGAGG + Intergenic
1151882928 17:76905675-76905697 CTGGGTGGAGGGAGGGAGGGAGG - Intronic
1152077074 17:78166461-78166483 CTGGGTGTAGGGAGAGGGAGGGG + Intergenic
1152190260 17:78883806-78883828 CTGGGGTTGGGGAGGGCGGCAGG - Intronic
1152371997 17:79894462-79894484 CTGGGATTGGGAAGAGAGGAGGG + Intergenic
1152727082 17:81952779-81952801 CTGGGCTGTGGGAGAGGGGCAGG + Exonic
1153836979 18:8972073-8972095 CTAGGTTAAAGGAGAAAGGCTGG + Intergenic
1154485343 18:14867771-14867793 CTTGGTCTAGGAGGAGAGGCTGG + Intergenic
1155953109 18:31934450-31934472 GGAAGTTTAGGGAGAGAGGCTGG - Intronic
1156504622 18:37581613-37581635 TTGGGTTTAGGAAGATTGGCTGG + Intergenic
1157011129 18:43650232-43650254 CTGTGTTTTGGGAGAGAGGAAGG + Intergenic
1157299481 18:46469151-46469173 ATGGCTTTAGGGACAGAGGGTGG + Intergenic
1157599586 18:48885783-48885805 ATGGGGTGAGGGAGAGGGGCTGG + Intergenic
1157604076 18:48914788-48914810 CTGGGCTGGGGGTGAGAGGCTGG - Intergenic
1157879901 18:51311570-51311592 TTGGGGTAAGGGAGAGAGGATGG + Intergenic
1158757324 18:60341626-60341648 CTGAGGAAAGGGAGAGAGGCTGG - Intergenic
1159020434 18:63138658-63138680 CTGGGTCCAGGGGGAGGGGCTGG + Intronic
1159394439 18:67838170-67838192 CTGGCTTTAGAGAGAGAGAAAGG - Intergenic
1160170184 18:76546440-76546462 TTGGATTTTGGGAGAGAGACAGG + Intergenic
1160788870 19:913529-913551 CTGGGTGTAGGGATCGTGGCCGG - Intergenic
1160872025 19:1282055-1282077 GTGGGATGAGGGAGAGAGGAAGG + Intergenic
1161199361 19:3005969-3005991 CTGGGGTCGGGGAGAGAAGCAGG + Intronic
1161494502 19:4580167-4580189 TTGGGTTTAAGGAGGGAGGAGGG - Intergenic
1161627360 19:5335118-5335140 CAGGCTGTGGGGAGAGAGGCTGG - Intronic
1162020703 19:7867171-7867193 CTGGGTCCAGGGGCAGAGGCAGG + Intergenic
1162728823 19:12705648-12705670 ATGGGTTTCGGGTGAGGGGCAGG + Intronic
1163177336 19:15573550-15573572 CAGGGGTTATGGAGAGGGGCAGG - Intergenic
1163207355 19:15813449-15813471 ATGGGGATAGAGAGAGAGGCAGG + Intergenic
1163234989 19:16024843-16024865 CTGGGGTGAGAGAGAGAGGCAGG + Intergenic
1163262232 19:16198171-16198193 CTGGTGTGAGGCAGAGAGGCCGG + Intronic
1163517977 19:17776183-17776205 CTGGGTGTTGCTAGAGAGGCTGG + Intronic
1164715403 19:30387213-30387235 CTGGATGTGGGGAGAAAGGCAGG + Intronic
1164933016 19:32189713-32189735 CTGGAATTAGGGAGGGAGGCTGG - Intergenic
1165361290 19:35338451-35338473 CTGGTTCTAGGGAGAGAAGATGG + Intronic
1165382987 19:35494273-35494295 CTGGGTCTAGGGAGGGAGTGGGG + Intronic
1165392942 19:35548812-35548834 TGGGGTTCAGGGAGAGAGACTGG + Intergenic
1165426787 19:35750255-35750277 CGGGGGTTCAGGAGAGAGGCTGG + Intronic
1165749903 19:38253305-38253327 CTGGGATTCGGGAGAGGAGCTGG + Intronic
1165801386 19:38552789-38552811 GCAGGTTTAGGGAGAGAGTCTGG + Intronic
1165864736 19:38930054-38930076 TTGCGTTTAGAGAGAGAGGTAGG - Intronic
1166299336 19:41905224-41905246 CGGGGCTTAGGGCGAGAGGCAGG - Exonic
1166785627 19:45365007-45365029 CAGGGCTGAGGGAGGGAGGCAGG - Intronic
1167146255 19:47682047-47682069 CTGGGTCTTGGGCGGGAGGCGGG - Exonic
1167456456 19:49598834-49598856 CTGGGTTTAGGGAGAGAGGCAGG + Intronic
925176537 2:1788487-1788509 CTGTGTTCTGGGAGACAGGCAGG + Intergenic
925366851 2:3316554-3316576 CTGTGAGTTGGGAGAGAGGCAGG - Intronic
926285399 2:11483465-11483487 CTGTGTTTAGGGAGACTGTCTGG + Intergenic
927688669 2:25191645-25191667 GTGGGCCAAGGGAGAGAGGCAGG + Intergenic
927884635 2:26710829-26710851 CAGGCTTTCGGGAGAGCGGCTGG - Intronic
927904998 2:26849259-26849281 CTGGGTTTGAGGAGGGAGGACGG + Intronic
928403983 2:31000177-31000199 CAGGGTTTAGGGAGAGATGGTGG - Intronic
928445408 2:31329479-31329501 CTGGGTTTGGAAAGAGAAGCAGG + Intergenic
929492679 2:42409767-42409789 TTGGGTTTAAGGAGACAGGGTGG - Intronic
930544863 2:52753810-52753832 CTGGGTGCAGGGACAGAGGATGG + Intergenic
932074138 2:68647431-68647453 CTGGGTTAAAGGAGAGAGACAGG - Intronic
932129790 2:69177601-69177623 CAGGGATTGGGGAGGGAGGCCGG - Intronic
932332396 2:70905100-70905122 CTGGGCTTGGGGAGATCGGCCGG + Intronic
932457521 2:71858776-71858798 CAGGGTTCAGGGAGAGGGGAAGG - Intergenic
932607412 2:73174750-73174772 CTGGGGTTGGGGGCAGAGGCTGG - Intergenic
932849863 2:75174040-75174062 CTGGGTTTTGGGAGTGAGGCAGG - Intronic
934109523 2:88729160-88729182 CTGGGCTTTGGGAGAGAGCCTGG + Intronic
934504378 2:94879603-94879625 CTGGGGATTGGGAGAGTGGCCGG + Intergenic
934559159 2:95303405-95303427 CTGTGTTCAGGGGGAGAGGAAGG + Intronic
934708686 2:96501816-96501838 CTGGGCTGGGGGAGGGAGGCTGG + Intronic
934713451 2:96529948-96529970 CTGGGGTGAGGGAGGGGGGCTGG + Intergenic
935446249 2:103159451-103159473 GTAGGTGTGGGGAGAGAGGCAGG + Intergenic
935549017 2:104431934-104431956 CTGGGTGAATGGAGAGAAGCGGG + Intergenic
937350381 2:121156663-121156685 GTGGGTTTGGGGGGACAGGCAGG - Intergenic
937895389 2:126973731-126973753 CTGGGGCCAGGGAGAGTGGCTGG - Intergenic
938087233 2:128409526-128409548 ATGGGTTTAGGGAGTTAGGGAGG - Intergenic
940536366 2:154950102-154950124 TGGGGTTTAGGGAGAAAGGGTGG + Intergenic
941003199 2:160222170-160222192 ATAGATTTAGAGAGAGAGGCTGG + Intronic
941850590 2:170176313-170176335 CAGGGTTGAGGTGGAGAGGCGGG + Intergenic
943713516 2:191124664-191124686 TTAGGTTTAGGGAGGGAGGTGGG - Intronic
944868281 2:203883768-203883790 CTGGGCTGAGGGAAGGAGGCTGG + Intergenic
945317931 2:208391074-208391096 TTGGGCTTAGGGAGGGAGGCAGG + Intronic
945879581 2:215312109-215312131 CTGGGTTCAGGGCGAGCGGGAGG - Exonic
946177080 2:217928584-217928606 CTGGGTTTGGGGAAAGGGCCAGG - Intronic
946444333 2:219725519-219725541 GTGAGTTTGGGGAGACAGGCAGG - Intergenic
947023349 2:225708922-225708944 ATGAGGTCAGGGAGAGAGGCAGG + Intergenic
947362749 2:229363162-229363184 CTGGGATGAGGAAGAGAGGGAGG + Intronic
948035230 2:234853043-234853065 CTGGGCTTGGTGAGAGAGGAAGG - Intergenic
948035426 2:234854570-234854592 CTGGGCTTGGTGAGAGAGGGAGG - Intergenic
948046822 2:234951862-234951884 CGGGGCTTCGGGAGAGGGGCGGG - Intergenic
948299140 2:236888839-236888861 CTGGGTTTATGGCGAGGGGACGG + Intergenic
1169262933 20:4150689-4150711 GGGGGGTTAGGTAGAGAGGCTGG - Intronic
1170510082 20:17067475-17067497 CTGGGTGTTGGGAGAGGGGAGGG + Intergenic
1171170548 20:23011696-23011718 CTGGGTTGTGGGAGGGAGGTGGG + Intergenic
1171467619 20:25341753-25341775 CTGGGTATAATGTGAGAGGCGGG + Intronic
1171798138 20:29582294-29582316 CTGGGTTTAAGGTGAGAGGTTGG + Intergenic
1171850100 20:30301867-30301889 CTGGGTTTAAGGTGAGAGGTTGG - Intergenic
1173290724 20:41712685-41712707 CTGTGTTTAGGGAAGCAGGCTGG - Intergenic
1173436882 20:43041490-43041512 CTGGCTTTGGGGAGACAGGGCGG - Intronic
1173732343 20:45337702-45337724 CTGGGCTTCTGGGGAGAGGCAGG + Intronic
1175711098 20:61221740-61221762 CTTTGATTAGGGAGAAAGGCTGG - Intergenic
1176141016 20:63545128-63545150 CCGGGTGTCGGGAGAGGGGCCGG + Intronic
1176621658 21:9065572-9065594 CTGGGGATTGGGAGAGTGGCCGG - Intergenic
1176693319 21:9944221-9944243 CTTGCTTTAGGGAGACAGTCAGG - Intergenic
1176723979 21:10414679-10414701 CTTGGTCTAGGAGGAGAGGCTGG + Intergenic
1176795991 21:13371705-13371727 CTTGGTCTAGGCGGAGAGGCTGG - Intergenic
1177125198 21:17185250-17185272 CTGGGTTTATAGAGGGAGGAAGG - Intergenic
1178510571 21:33201828-33201850 CTGGGTTGGGGGATAGGGGCAGG + Intergenic
1178511699 21:33210666-33210688 CTGGGTCTAGAGTCAGAGGCAGG - Intergenic
1178845326 21:36169681-36169703 CTGGGTGTGGGCAGCGAGGCGGG + Intronic
1179290465 21:40013776-40013798 CAGGGTTTGAGGAGAGAGCCAGG + Intronic
1179395062 21:41031958-41031980 CTGGGTCTTGAGAGAGATGCAGG - Intergenic
1179486820 21:41715855-41715877 CTGGGGGTAGGGAGTGGGGCAGG + Intergenic
1180305224 22:11067853-11067875 CTCGGTCTAGGAGGAGAGGCTGG + Intergenic
1181435988 22:22911159-22911181 CTGGGTGCAGGGAGAAGGGCTGG - Intergenic
1181510360 22:23386208-23386230 CTGGGTTGAGAGAGAGATGGGGG - Intergenic
1181540964 22:23573162-23573184 CTGGGTACAGGGAGAAGGGCTGG + Exonic
1181559308 22:23690847-23690869 ATGGGTTTAGTTAGAAAGGCTGG - Exonic
1181639286 22:24188338-24188360 CGGGGTCTTGGGAGAGGGGCTGG - Intronic
1181797414 22:25320168-25320190 CTGGGTACAGGGAGAAGGGCTGG - Intergenic
1181841914 22:25670630-25670652 CAGGATTCAGGGAGAGAGGGAGG - Intronic
1181984494 22:26790052-26790074 CTGGGTTAGGTGAGAAAGGCAGG + Intergenic
1182013900 22:27023026-27023048 CTGGGGCTAGGGAGGGAGGGAGG + Intergenic
1182471089 22:30548720-30548742 CTGGGATAAGGGAGAAAGGAAGG - Intergenic
1182555776 22:31127603-31127625 TGGGGCTTATGGAGAGAGGCAGG + Intronic
1182696112 22:32200314-32200336 CTGGGTGCAGGGAGAAGGGCTGG - Intronic
1183081240 22:35458035-35458057 CTGGGATTAGGGAGAGGTGGGGG + Intergenic
1183361139 22:37384134-37384156 CTTGGTGGAAGGAGAGAGGCAGG + Intronic
1183383650 22:37502984-37503006 CTGGGCTCGGGGTGAGAGGCTGG + Intronic
1183397476 22:37580250-37580272 CTGGGCTAAGTGAGGGAGGCTGG - Intronic
1184080370 22:42215046-42215068 CAGGGTTTCAGGAAAGAGGCTGG - Exonic
1184092345 22:42299312-42299334 CTGGATGTGGGGAGAGGGGCTGG - Intronic
1184269115 22:43368204-43368226 CTGGGTGTAGGGGGTGAGGTAGG + Intergenic
1184298118 22:43539006-43539028 CTGGCTTTGGAGAGAGAGGAGGG - Intronic
1184485842 22:44778846-44778868 GTGGGGTTAGAGAGAGAGGAGGG - Intronic
1185229276 22:49670914-49670936 CTGGGGATGGGGAGGGAGGCTGG + Intergenic
1185230304 22:49676920-49676942 CTGGCATTGGGGAGGGAGGCTGG - Intergenic
1185272818 22:49936472-49936494 CTGGGCTTAGGGAGAGGTGGGGG + Intergenic
949577842 3:5356052-5356074 CTGGGATTAGGGATGGAGACTGG - Intergenic
949917747 3:8977609-8977631 GTGGGTGGAGGGAGAGTGGCTGG + Intergenic
950752883 3:15144834-15144856 CTGTGTTTAAGGTGAGAAGCGGG + Intergenic
951370923 3:21846715-21846737 CTAGCTTTAGAGAGAGAGGATGG + Intronic
952490946 3:33872013-33872035 CTGGGTCAAGGGACAGGGGCAGG - Intergenic
953017902 3:39096029-39096051 CAGGGACTAGGGAGGGAGGCAGG + Exonic
953812003 3:46120825-46120847 CTGGGTTAAGGTAGAAAGGTTGG + Intergenic
953928329 3:46993595-46993617 CTAGCTTTAGGGAGACAGGTTGG + Intronic
953978035 3:47397053-47397075 CTGAGGAGAGGGAGAGAGGCAGG + Intronic
954447724 3:50555561-50555583 TTGGGTTGGGGGAGAGGGGCAGG + Intergenic
954611083 3:51944907-51944929 CTGGGTGAGGGGTGAGAGGCAGG + Exonic
954709410 3:52497890-52497912 ATGGGTTTGGGCAGCGAGGCAGG + Intronic
955069197 3:55558131-55558153 CTGTGACTAGGCAGAGAGGCAGG - Intronic
955166053 3:56512364-56512386 CTGGCTTTAGGAAGATAGTCTGG + Intergenic
955555747 3:60135394-60135416 CAGGGTGTAGGGATAGAGTCTGG - Intronic
956723592 3:72138969-72138991 CTGGGTTTGGAGAGAGGGGCAGG - Intergenic
957572083 3:81959837-81959859 CTGGTTTTAGAGAGAAAGTCAGG - Intergenic
958151014 3:89695536-89695558 CTGTGTGTAGGGAGAGGGGCAGG - Intergenic
958669806 3:97188912-97188934 TTGGGATTAGGGAAAGAGGCAGG + Intronic
959401621 3:105909297-105909319 CAGGGTTTGGGGAGGGAGGTGGG - Intergenic
960006423 3:112785865-112785887 CCAGGTTTCGGAAGAGAGGCAGG + Intronic
960783409 3:121345861-121345883 TTGGGATTAGGGAAGGAGGCAGG - Intronic
961285428 3:125798554-125798576 CTGTGTTTAAGGTGAGAAGCGGG + Intergenic
961475052 3:127141005-127141027 CTGAGTTTGGGGAGAGATGATGG + Intergenic
961501757 3:127341163-127341185 CTGGGTTGGGTGAGAGGGGCTGG - Intergenic
961749938 3:129088877-129088899 CAGGGCTTAGGGAGGGAGGGAGG - Exonic
962597162 3:136957918-136957940 CTGGGTTTGGGCAGAAAGGAGGG + Exonic
963240433 3:142997698-142997720 CTGGGTTTCAGGATATAGGCTGG - Intronic
964718356 3:159746695-159746717 CAGGATATAGGGAAAGAGGCTGG - Intronic
965220519 3:165921092-165921114 CTGAGTGTTGGGAGAGAAGCTGG + Intergenic
965526466 3:169724552-169724574 CAGGGATTAGGGAGGGAGGAAGG + Intergenic
966726572 3:183114297-183114319 CTTGGTTTAGGAAGGGGGGCGGG - Intronic
967293805 3:187946705-187946727 GTGAGTTTAGGGAGGCAGGCAGG + Intergenic
967933348 3:194706666-194706688 CTGGGCTGAGGGAGAGATGCTGG + Intergenic
968007002 3:195249936-195249958 CTGGCTCTGGGGAGAGAGGATGG - Intronic
968267682 3:197375284-197375306 CTGGGCTCAGGGAGACAGGGAGG + Intergenic
968530026 4:1086718-1086740 ATGGGGTTGGGGAGAGAGGATGG + Intronic
968530066 4:1086832-1086854 ATGGGGTTGGGGAGAGAGGATGG + Intronic
968634638 4:1671683-1671705 GTGGGATTAGGGAGGGAGGCTGG - Intronic
968908574 4:3465457-3465479 CTGGTGTGAGGGAGAGAGGAAGG + Intronic
970593560 4:17579364-17579386 CTGCTTTTAGGGAGAAAGGGAGG + Intronic
971874189 4:32283857-32283879 CTGGGTACAGGGAGAAAGCCAGG + Intergenic
973180213 4:47257548-47257570 GTGGGTGTAGGGAGGGAGGGTGG + Intronic
974381038 4:61140187-61140209 GTGGGCTTGGGGAGAGATGCAGG - Intergenic
978387736 4:108192532-108192554 CTTGGTTCAGGGCTAGAGGCTGG + Intergenic
979590328 4:122471783-122471805 CTGGGGAAAGGGAGAGAGACAGG - Intergenic
980288516 4:130813176-130813198 CGGGGTTGAGGGAGGGAGGAGGG - Intergenic
980365928 4:131804449-131804471 CTTGCTTTAGGGAGACAGTCAGG - Intergenic
982044094 4:151424417-151424439 CTGGCTGTAGGGAGAAAGGCAGG + Intronic
982649079 4:158064200-158064222 CTGTGCTTTGGGAGAGAGACTGG - Intergenic
983558910 4:169082238-169082260 CTGGAGTTAGAGAGAGAAGCAGG - Intergenic
984297828 4:177876226-177876248 CGTGTTTTAGGGAGAAAGGCTGG - Intronic
985030427 4:185783724-185783746 TTGGTTTCAGGCAGAGAGGCAGG + Intronic
985579370 5:688926-688948 CTGGGCTCAGGGGGAGGGGCTGG + Intronic
985594216 5:780985-781007 CTGGGCTCAGGGGGAGGGGCTGG + Intergenic
985968002 5:3352262-3352284 GTGGGTTGAGGGAGGGGGGCAGG + Intergenic
986763132 5:10898035-10898057 CTGGGGTGTTGGAGAGAGGCAGG + Intergenic
986859094 5:11904777-11904799 GTGGGTTGGGGGAGGGAGGCTGG + Intergenic
986859466 5:11909692-11909714 CTGGATACAGTGAGAGAGGCTGG + Intergenic
987058637 5:14220344-14220366 CTGAGGAGAGGGAGAGAGGCGGG - Intronic
987065763 5:14288328-14288350 CTGGGTGGGGAGAGAGAGGCTGG - Intronic
990994008 5:61712982-61713004 CAGTGGCTAGGGAGAGAGGCTGG + Intronic
991229378 5:64313299-64313321 ATGGGTAAAGGGAGAGAGGAAGG - Intronic
994022574 5:95044642-95044664 CTGGGTTAAAGGACAGAGGGAGG - Intronic
996404730 5:123094099-123094121 AAGGGTTTAGGGAGAGGGGCTGG + Intronic
996621898 5:125515296-125515318 CAGGGTATAGGGTGAGAGGAAGG + Intergenic
997157599 5:131576088-131576110 CTAGGTATAAGGTGAGAGGCCGG - Intronic
997366326 5:133327552-133327574 CTGGGTCTTGGCTGAGAGGCGGG - Intronic
997817466 5:137033025-137033047 CTGGGGATGGGCAGAGAGGCAGG + Intronic
998159257 5:139803838-139803860 CTGGGCTTAGGGAGGGGGCCTGG + Intronic
998273472 5:140728593-140728615 CAGGGATTAGGGATAGAGGGAGG - Intergenic
998474554 5:142409366-142409388 CTGTGCTCACGGAGAGAGGCAGG + Intergenic
998875356 5:146593674-146593696 CTGGGTTTGGGGTGAGGGGAAGG + Intronic
999121283 5:149211387-149211409 CAGGGTATAGGAAGAAAGGCCGG - Intronic
999234605 5:150082971-150082993 CAGGGTCTAGAGAGACAGGCTGG - Intronic
999822332 5:155240406-155240428 CAGGGGTTGGGGAGAGAGACAGG - Intergenic
999943877 5:156574203-156574225 ATGGCTTTAGGCAGACAGGCTGG - Intronic
1000555261 5:162718072-162718094 AAGAGTTTAGGGAGGGAGGCTGG - Intergenic
1001085353 5:168696465-168696487 CAGGGGTCAGGGAGAGAGGTGGG + Intronic
1001253326 5:170165232-170165254 AGGGCTTTAGGGAGAGAGGGAGG - Intergenic
1001997740 5:176175352-176175374 CAGGGTTTAGGAAGGGAGCCCGG - Intergenic
1002064186 5:176643907-176643929 TTGGGCTCAGGGAGAGAGCCTGG + Intronic
1002359930 5:178662386-178662408 CTGCGTCTGGGGAGAGAGGAGGG - Intergenic
1002724121 5:181283210-181283232 CTTGGTCTAGGAGGAGAGGCTGG + Intergenic
1002842851 6:921257-921279 CAGGGTTTTGGAAGAGAGGCAGG - Intergenic
1003098130 6:3157716-3157738 CTGGGTCTAGGGTGGGCGGCCGG + Intergenic
1003116441 6:3286814-3286836 CTGGGTGCAGGGAGGGAAGCTGG - Intronic
1003128657 6:3376793-3376815 AGGGGTTTGGGGAGTGAGGCTGG + Intronic
1004406317 6:15337082-15337104 CAGGGTTTTGGAAGAGAGGCAGG - Intronic
1004628395 6:17398177-17398199 CTGGGTTTAGGATGAGAGGGAGG + Intronic
1004813951 6:19292130-19292152 CTGCTTTTTGGGAGAGAGGTGGG - Intergenic
1004962664 6:20808679-20808701 CTGGGTTTCAGGAGAGAAGATGG + Intronic
1006154495 6:32006937-32006959 CTGGGTTGTAGGGGAGAGGCTGG + Intergenic
1006160807 6:32039673-32039695 CTGGGTTGTAGGGGAGAGGCTGG + Intronic
1006468789 6:34213691-34213713 CAGGGTTTAGGGATGGAGGAAGG - Intergenic
1007129042 6:39452384-39452406 CTGGGCTTGGGCAGAGAGGATGG - Intronic
1007183498 6:39947937-39947959 ATGGGTGTAGGGAGGGAGGGAGG + Intergenic
1007409563 6:41653978-41654000 CTGGGGTGGAGGAGAGAGGCAGG - Exonic
1007549958 6:42721663-42721685 CTGGGTGCGGGGAGAGGGGCTGG + Intronic
1007586692 6:42994879-42994901 CTGGGAGTAGGGACAGAGGGAGG + Intronic
1008090775 6:47291658-47291680 CTTGGTTTAGGCAGAGATGGGGG - Intronic
1009509154 6:64526170-64526192 CAGGGTTTAAGGAGAGAGCTAGG + Intronic
1012930671 6:105313092-105313114 CTGGTTTTAGGGAGGTAGACTGG - Intronic
1015483516 6:133742209-133742231 CTGTGCTGAGGGTGAGAGGCAGG + Intergenic
1016081501 6:139862632-139862654 CTTAGTGTAGGGAGAGGGGCAGG - Intergenic
1017121460 6:151028100-151028122 CTGGGTTGAGGCAGGGAAGCAGG + Intronic
1017220546 6:151961104-151961126 CTGGAGTTTAGGAGAGAGGCTGG + Intronic
1017668639 6:156747819-156747841 GTGAGATTAGGGAGAGAGGAAGG - Intergenic
1017877936 6:158538934-158538956 CTGTGGTCAGAGAGAGAGGCTGG + Intronic
1018176355 6:161182250-161182272 GAGGGTATAGGGTGAGAGGCTGG - Intronic
1018961928 6:168455378-168455400 ATGGATTTAGAGAGAGGGGCAGG + Intronic
1019304284 7:325522-325544 GTGGGTGAAGGGAGAGGGGCTGG - Intergenic
1019918933 7:4150636-4150658 CTGAATGTAGGGAGGGAGGCAGG + Intronic
1020027648 7:4910578-4910600 CCGGGGTTAGGGGGGGAGGCGGG - Intronic
1020100541 7:5391936-5391958 CTGGGCTTAGGCAGAGAATCAGG - Intronic
1020707687 7:11566291-11566313 TGGGGTTTGGGGAGAGAGGTAGG + Intronic
1021738956 7:23666095-23666117 CAGGGTTTGGGGAGAGTGGGTGG + Intergenic
1022159231 7:27692318-27692340 CTGGCTTTAGGCACAGTGGCTGG - Intergenic
1022250505 7:28602701-28602723 TTAGGTTTGGGTAGAGAGGCTGG + Intronic
1022399869 7:30026908-30026930 GTGGATTTTGGGAGAGGGGCGGG + Intergenic
1024658916 7:51474949-51474971 CTTGCTGTGGGGAGAGAGGCTGG - Intergenic
1024692116 7:51814358-51814380 CTGAGGTTTGGGAGAGAGGCTGG + Intergenic
1027570221 7:79856891-79856913 CTGTGTTTGGGGAGAGAGCATGG - Intergenic
1029179199 7:98687788-98687810 CTGGGCTTAGAGAGAGGAGCAGG - Intergenic
1030067779 7:105673647-105673669 CTGGAGTTGGAGAGAGAGGCAGG + Intronic
1030094406 7:105885259-105885281 CTGGGTGGTGGGAGAGAAGCAGG + Intronic
1030106393 7:105990875-105990897 CTTGGTGTAGGGAGAAAGGAAGG - Intronic
1030974718 7:116107277-116107299 ATGGCTGTAGGGAGAGAGGGAGG - Intronic
1031028856 7:116713097-116713119 ATGGGTTAAGGAAAAGAGGCCGG + Intronic
1031451871 7:121931442-121931464 CTGGGTTTAGGGAGAGTGGAGGG - Intronic
1032198878 7:129805261-129805283 GTGGGTGCAGGGGGAGAGGCAGG - Intergenic
1032278734 7:130483830-130483852 CAGGGAATAGGGAGAGTGGCAGG - Intergenic
1032383628 7:131506835-131506857 CTGGGGCTAGAGAGGGAGGCAGG - Intronic
1032638427 7:133736825-133736847 CTGGGTTTGGGGAAAGAGTAGGG - Intronic
1034954742 7:155327566-155327588 CAGGGTTGGGGGAGAGAGGGGGG - Intergenic
1035470648 7:159106755-159106777 CTGGGTAGGGGCAGAGAGGCCGG + Intronic
1035726186 8:1825341-1825363 TGGGGTTCAGGGAGAGAGGTGGG - Intronic
1037020595 8:13965769-13965791 CTTGGTTTTGGGAGGGAGGGAGG - Intergenic
1037106044 8:15110193-15110215 CTGTCTTTAGGGAGGGAGGTAGG + Intronic
1037295368 8:17394519-17394541 CAGGGTGTAGGGAGAGAGAAAGG + Intronic
1037310396 8:17549453-17549475 CCGGGTTTAGGGAAAGAGCAAGG + Intronic
1038023138 8:23566967-23566989 TTGTTTTGAGGGAGAGAGGCGGG + Intronic
1038437445 8:27545829-27545851 CTGTGTATAGGGAGAAAGCCAGG + Intergenic
1038466925 8:27772752-27772774 GTGGGTTAAGGGAAAGAGGCTGG + Intronic
1038675716 8:29621060-29621082 CAGGGTGGAGGGAGAGAGGTTGG + Intergenic
1041437437 8:57858128-57858150 CTGGGAGCAGGGAGGGAGGCAGG + Intergenic
1042193192 8:66208739-66208761 CTGGATTCATGGAGAGAGGAGGG + Intergenic
1042804423 8:72756277-72756299 CAGGGTATAGGGAGACAGGAAGG - Intronic
1044706029 8:95009517-95009539 GTGGGTTATGGGAGAGAGGGTGG + Intronic
1044819720 8:96147445-96147467 CCTAGTTTGGGGAGAGAGGCAGG - Intronic
1044840234 8:96331009-96331031 GTAGGTCTAGGGAGAGAGACAGG - Exonic
1045487843 8:102646331-102646353 CTGGCTTGAGTGAGAGATGCTGG + Intergenic
1045886033 8:107098793-107098815 CTGTGTTTTGGGAGAGATGGAGG + Intergenic
1046911449 8:119631890-119631912 CTGGGTGTAGGGAGAAGGACAGG - Intronic
1047034548 8:120922848-120922870 GAGGCTTTAGGGAGAGAAGCAGG + Intergenic
1047410326 8:124619392-124619414 TCTGGTTTAGGCAGAGAGGCGGG - Intronic
1048722649 8:137344316-137344338 CTGGGTTTAGGAAGAAAGTGTGG + Intergenic
1049001263 8:139826813-139826835 CTGGGTTTCTGCAGAGAGGTTGG + Intronic
1049283213 8:141761093-141761115 CTGTGTTTGGGGACAGAGGTGGG - Intergenic
1049418745 8:142507509-142507531 CTGGGGGCAGGGAGAGAGACGGG - Intronic
1049610741 8:143553634-143553656 CTGGGAGGAGGGAGGGAGGCCGG - Exonic
1049644942 8:143731969-143731991 CTCGGGTTGGGGAGGGAGGCAGG + Intronic
1050217607 9:3345217-3345239 CTGGGTTTAGGGAGACTGGGAGG + Intronic
1050297185 9:4217380-4217402 CTGCCCTTAGGGTGAGAGGCTGG - Intronic
1050303428 9:4282692-4282714 TTGGGATTATGGAGAGTGGCAGG - Intronic
1050610611 9:7348903-7348925 CTGGGTATAGAGGCAGAGGCTGG + Intergenic
1051433223 9:17002039-17002061 ATGGAGGTAGGGAGAGAGGCAGG + Intergenic
1052818958 9:33123957-33123979 CTGGGATGAGGGAGAAAGGGAGG - Intronic
1052821184 9:33138922-33138944 TTGGGGTTGGGGAGAGAGGAGGG - Intronic
1053567833 9:39271523-39271545 CTGGGGTGAGGAAGAGAGGCTGG + Intronic
1053630274 9:39930309-39930331 CTTGCTTTAGGGAGACAGTCAGG - Intergenic
1053775496 9:41533219-41533241 CTTGCTTTAGGGAGACAGTCAGG + Intergenic
1053787875 9:41665160-41665182 CTGGGTTTAAGGTGAGAGGTTGG - Intergenic
1053833840 9:42112470-42112492 CTGGGGTGAGGAAGAGAGACTGG + Intronic
1053886260 9:42646644-42646666 CTTGGTCTAGGAGGAGAGGCTGG + Intergenic
1054129310 9:61347476-61347498 CTGGGGTGAGGAAGAGAGGCTGG - Intergenic
1054157254 9:61649607-61649629 CTGGGTTTAAGGTGAGAGGTTGG + Intergenic
1054176151 9:61876502-61876524 CTGGGTTTAAGGTGAGAGGTTGG - Intergenic
1054213613 9:62320393-62320415 CTTGCTTTAGGGAGACAGTCAGG + Intergenic
1054225280 9:62454093-62454115 CTTGGTCTAGGAGGAGAGGCTGG + Intergenic
1054596712 9:67074940-67074962 CTGGGGTGAGGAAGAGAGACTGG - Intergenic
1054661388 9:67704306-67704328 CTGGGTTTAAGGTGAGAGGTTGG + Intergenic
1054771834 9:69090557-69090579 CTGGGTTGGGGGAGGGAGGAAGG + Intronic
1054839411 9:69719969-69719991 CTGGGGTGAGGGAGAGAGATGGG - Intronic
1057548989 9:96038429-96038451 CTGGGCACTGGGAGAGAGGCAGG + Intergenic
1057592018 9:96381057-96381079 CTGGCATCAGGGAGAGGGGCTGG - Intronic
1057781828 9:98056635-98056657 TTGGCTGTCGGGAGAGAGGCGGG + Intergenic
1059099123 9:111452882-111452904 CTGAGTTTAGGGATTGGGGCAGG + Intronic
1059368043 9:113801813-113801835 CTGGGGTGAGGGAGAGAAGGCGG + Intergenic
1061211876 9:129198374-129198396 GTGGGTGCAGGGAGAGACGCTGG + Intergenic
1061310353 9:129758142-129758164 CTGGGCTTAGTGAGTGAGGGGGG - Intergenic
1062538219 9:137030198-137030220 CTGGGCTCAGGGAGGGAGGGCGG - Exonic
1203744842 Un_GL000218v1:35982-36004 CTGGGGATTGGGAGAGTGGCCGG - Intergenic
1203565262 Un_KI270744v1:83502-83524 CTGGGGATTGGGAGAGTGGCCGG + Intergenic
1186073344 X:5847846-5847868 CTGCTCTGAGGGAGAGAGGCAGG + Intronic
1186442379 X:9597311-9597333 CTGGGTTTAAGGAGAGCAGCAGG - Intronic
1186664683 X:11705098-11705120 CTGTGTGTGGGGAGAGAGCCAGG + Intergenic
1186974749 X:14889591-14889613 GGGGGTTGGGGGAGAGAGGCAGG - Intronic
1187282127 X:17865429-17865451 CCAGGTTTAGGGAAAGAGGATGG + Intergenic
1188774344 X:34194906-34194928 CTGGGGTGAGGGAGGGAGGGAGG - Intergenic
1192206213 X:69098176-69098198 ATGGGTTGAGGGAGAGAGGATGG - Intergenic
1192764231 X:74125970-74125992 CTGGGTATAAGGTGAGAGGATGG + Intergenic
1195325118 X:103752182-103752204 GTGGGATGAGGGAGGGAGGCAGG + Intergenic
1195862889 X:109400128-109400150 CTGGATTGAAGGAGAGAGGCTGG + Intronic
1195965648 X:110427889-110427911 CTGGGTGAAGGGAGGGAGGAAGG - Intronic
1197411086 X:126117211-126117233 CTGGGTTTGGGGAGAGAGGTGGG - Intergenic
1197891611 X:131275268-131275290 CTGGGTTTGGGGAGTAAGCCTGG + Exonic
1198777163 X:140192153-140192175 CTGAGTTTAGGAGGAAAGGCAGG - Intergenic
1201158180 Y:11151025-11151047 CTGGGGATTGGGAGAGTGGCCGG - Intergenic
1201691760 Y:16774963-16774985 ATGGGTGTAGGGAGGGAGGGAGG - Intergenic