ID: 1167461107

View in Genome Browser
Species Human (GRCh38)
Location 19:49625212-49625234
Sequence TCCCAGGGCGATGGGTGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 289}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167461107_1167461117 13 Left 1167461107 19:49625212-49625234 CCACAGCACCCATCGCCCTGGGA 0: 1
1: 0
2: 0
3: 23
4: 289
Right 1167461117 19:49625248-49625270 GACTTCCTCTTGGGATCTGAGGG 0: 1
1: 0
2: 3
3: 15
4: 148
1167461107_1167461114 4 Left 1167461107 19:49625212-49625234 CCACAGCACCCATCGCCCTGGGA 0: 1
1: 0
2: 0
3: 23
4: 289
Right 1167461114 19:49625239-49625261 AACCTTTCTGACTTCCTCTTGGG 0: 1
1: 0
2: 3
3: 23
4: 253
1167461107_1167461116 12 Left 1167461107 19:49625212-49625234 CCACAGCACCCATCGCCCTGGGA 0: 1
1: 0
2: 0
3: 23
4: 289
Right 1167461116 19:49625247-49625269 TGACTTCCTCTTGGGATCTGAGG 0: 1
1: 2
2: 1
3: 18
4: 221
1167461107_1167461113 3 Left 1167461107 19:49625212-49625234 CCACAGCACCCATCGCCCTGGGA 0: 1
1: 0
2: 0
3: 23
4: 289
Right 1167461113 19:49625238-49625260 CAACCTTTCTGACTTCCTCTTGG 0: 1
1: 0
2: 1
3: 20
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167461107 Original CRISPR TCCCAGGGCGATGGGTGCTG TGG (reversed) Intronic
900118110 1:1037100-1037122 TCCCAGTGGGCTGGGTCCTGGGG + Intronic
900423382 1:2565244-2565266 TCCCAGGGCTCTGGGAGGTGAGG + Intronic
900431372 1:2604631-2604653 TGCCAGGGTGGTGGGTGCCGGGG + Intronic
900698916 1:4031989-4032011 ACCCAAGGCTATGGGTGATGTGG - Intergenic
900991155 1:6099050-6099072 TGCCAGGGCCTTGGTTGCTGGGG + Exonic
901644486 1:10709226-10709248 TCCCGGGGCCATGGGGGCTCGGG + Intronic
902172024 1:14619449-14619471 TCCCAGTGCTTTGGGGGCTGAGG - Intronic
902451411 1:16499088-16499110 TCCCGGGGCTAGGGGCGCTGTGG - Intergenic
902472513 1:16658486-16658508 TCCCAGGGCTGGGGGCGCTGTGG - Intergenic
902486292 1:16748960-16748982 TCCCAGGGCTGGGGGCGCTGTGG + Intronic
902755584 1:18547345-18547367 TCCCAGTGCCTAGGGTGCTGCGG + Intergenic
902991122 1:20187511-20187533 TCCCTGTGTGATGGGTGCTGGGG + Intronic
904715482 1:32464880-32464902 TCGCAGGGTGATGGGAGTTGTGG - Intergenic
905697362 1:39985002-39985024 TCCTAGGCCGATGGGCGCAGTGG + Intergenic
906178246 1:43795164-43795186 TCCAAGGGAGATGGAGGCTGAGG - Intronic
907459357 1:54596185-54596207 TCACAGGGCAATGGGGCCTGTGG - Intronic
907587516 1:55634322-55634344 TCCAAGGGAGATGGGGGCTGTGG + Intergenic
909484869 1:76161490-76161512 TCCCTGGAGGATAGGTGCTGTGG + Intronic
912567292 1:110597216-110597238 CCCCAGGGAGACGGATGCTGAGG - Intronic
912796107 1:112694545-112694567 TGACAGGGCGCTGGCTGCTGTGG + Exonic
913670970 1:121097297-121097319 TCCCCGGGCGCTGGCGGCTGCGG - Intergenic
914022733 1:143884718-143884740 TCCCCGGGCGCTGGCGGCTGCGG - Intergenic
914661220 1:149792662-149792684 TCCCCGGGCGCTGGCGGCTGCGG - Intronic
920291984 1:204929687-204929709 TCCCTGGGGAATGGGAGCTGGGG + Intronic
920291994 1:204929716-204929738 TCCCTGGGGAATGGGAGCTGGGG + Intronic
920866600 1:209758645-209758667 TCCCAGGGTGGTGGGTAATGAGG + Exonic
923615967 1:235537726-235537748 TACCATGGCAATGGCTGCTGAGG + Intergenic
923621298 1:235581630-235581652 TCTCAGGGCGGAGGGTGCGGAGG - Intronic
923798376 1:237182405-237182427 CCCCAGGGAGCTGGGTGCGGTGG - Intronic
923919438 1:238546740-238546762 TCCCAGCACTATGGGGGCTGAGG - Intergenic
924536407 1:244939570-244939592 TCCCAGGGAGGTTGGTGCAGGGG + Intergenic
1063114865 10:3066692-3066714 TCCCGGGCCCATGGGGGCTGTGG - Intronic
1063246416 10:4224356-4224378 TCCCAGCGCTTTGGGTGCCGAGG + Intergenic
1063639765 10:7818331-7818353 GCCCAGGGCGGCAGGTGCTGGGG - Intergenic
1065428460 10:25630180-25630202 TCCCACGGCCAGGGGTTCTGAGG + Intergenic
1067160495 10:43821228-43821250 CCCCAGGGAAATGGCTGCTGTGG - Intergenic
1067192851 10:44086418-44086440 ACCCGGGGCAATGGGAGCTGAGG - Intergenic
1069957274 10:72059880-72059902 TCCTTGGCCCATGGGTGCTGGGG - Exonic
1070733327 10:78846692-78846714 CCCAAGGGCGATGGCAGCTGCGG - Intergenic
1072738686 10:97896666-97896688 TCCCAGGCTGATGGGGGGTGGGG - Intronic
1073142880 10:101260837-101260859 TGCCAGGGCAGTGGGTTCTGAGG - Intergenic
1073150583 10:101308764-101308786 TCCCAGGGAGATGGGGGATGGGG - Intergenic
1074493772 10:113960783-113960805 TCCCAGGGCCATGGGGGTTGAGG + Intergenic
1074963235 10:118466529-118466551 TTCCTGGGGGATGGGAGCTGTGG - Intergenic
1075244756 10:120811087-120811109 ACCCAGGGCGTTTGGGGCTGGGG - Intergenic
1075587642 10:123669102-123669124 TCCCAGGGCACTGGGAGCAGGGG - Intronic
1076521821 10:131085958-131085980 TCCCAGGGCACTTGGGGCTGTGG - Intergenic
1076767329 10:132643792-132643814 ACCCAAGGTGATGGATGCTGTGG - Intronic
1078932183 11:15921157-15921179 TGCCAGGGCCCTGAGTGCTGCGG - Intergenic
1081025639 11:38010461-38010483 TACAAGGGGGATGGGTGGTGAGG + Intergenic
1082028040 11:47586962-47586984 TACCAGGCTGATGTGTGCTGTGG + Intronic
1083415185 11:62520985-62521007 TCCCAAGGTGAAGGGTGATGTGG - Exonic
1083415288 11:62521591-62521613 TCCCAAGGTGAAGGGTGATGTGG - Exonic
1083419692 11:62545980-62546002 TCCCAGCGGGATGGGTGGGGAGG - Intronic
1083718545 11:64592678-64592700 CCCCAGGGAGCTGGGTGCGGTGG - Intronic
1084166251 11:67376024-67376046 CCCCAGGTGGATGTGTGCTGGGG - Intronic
1084451310 11:69240456-69240478 GCCCAGGGGGATGGGGGGTGAGG + Intergenic
1084561827 11:69909865-69909887 TCCCAGGGCCCTGGCTGCTCCGG - Intergenic
1085333140 11:75669192-75669214 TGCCAGGGCGGAGGGTGGTGGGG - Intergenic
1088058244 11:105610748-105610770 TCCCAGGGCTATGGAGACTGCGG + Intronic
1088554172 11:111044908-111044930 CCACAGGGAGATGTGTGCTGGGG - Intergenic
1088622236 11:111697738-111697760 TCCCAGCACTTTGGGTGCTGAGG + Intronic
1089467691 11:118696098-118696120 TCCCAGGGGGTGGGGTGGTGGGG - Intergenic
1091205391 11:133817605-133817627 TCTCAGGGCTTTGGGTGCAGGGG - Intergenic
1091596906 12:1884476-1884498 GCCCAGGGCCATGGGGACTGCGG + Intronic
1091728261 12:2860584-2860606 TCACAGGGGGCTGGGTGCGGTGG + Intronic
1091787392 12:3251336-3251358 TCCCTGGTGGAAGGGTGCTGGGG + Intronic
1092069360 12:5620344-5620366 TCCCAGGGCTGTGGGTCCTAGGG - Intronic
1092299432 12:7231446-7231468 TCCCAAGGGGCTGAGTGCTGTGG - Intergenic
1094443596 12:30506208-30506230 TCCCAGAGAGCTGGCTGCTGAGG + Intergenic
1095141690 12:38671677-38671699 GGCCAGGGAGATGGGTGATGAGG - Intronic
1096226497 12:49869747-49869769 TCCCAGGGAAGTGGGAGCTGGGG - Exonic
1096247262 12:49998646-49998668 TCCCAGGACTTTGGGAGCTGAGG + Intronic
1098787391 12:74776716-74776738 TCCCATGGCGGTGGGGGCGGTGG - Intergenic
1100985434 12:100198677-100198699 TCCCAGGAAGATGGGTGGGGAGG + Intergenic
1101598591 12:106189100-106189122 CCCCAGGGCAGAGGGTGCTGTGG - Intergenic
1102028307 12:109725994-109726016 TAGCAGGGCGAGGGTTGCTGGGG + Intronic
1102171777 12:110847951-110847973 GCCCAGGACTATGGATGCTGTGG + Intronic
1103567348 12:121823262-121823284 TCCGGGGGTCATGGGTGCTGGGG - Exonic
1107028998 13:35831956-35831978 TCCCTGGGTGAGGGGTGCAGTGG - Intronic
1111785923 13:92786752-92786774 TCCCAGAGTCATGAGTGCTGTGG + Intronic
1112130439 13:96517444-96517466 TCCCAGGGAGATGGGGGGAGAGG + Intronic
1113960515 13:114123226-114123248 TCCCAGAGCAATGGCTGCTCTGG + Intronic
1114417219 14:22552888-22552910 CCCCAGGGTCATGGATGCTGAGG + Intergenic
1115513588 14:34162653-34162675 TCCCAGGGGGTAGGGTGGTGTGG + Intronic
1117546597 14:56798416-56798438 TCCCAGGGCGCTGTGGGCCGCGG - Intergenic
1118087250 14:62431916-62431938 TCCATGGGTGATGGGGGCTGGGG - Intergenic
1118166915 14:63345657-63345679 TCCCAGGAGGAAAGGTGCTGAGG - Intergenic
1118473269 14:66094310-66094332 TCCCAGGGCAGTGGGCTCTGAGG + Intergenic
1118776458 14:68977302-68977324 TCCTGGGACCATGGGTGCTGTGG - Intronic
1119426237 14:74536118-74536140 GCCCAGGGCGATGGCTTCGGGGG - Intronic
1121515325 14:94545764-94545786 TTCCATGGCAACGGGTGCTGTGG + Intergenic
1121717551 14:96087127-96087149 ACCTAGGGCGTGGGGTGCTGGGG + Exonic
1121919450 14:97867357-97867379 TCAAAGAGCAATGGGTGCTGTGG + Intergenic
1122197997 14:100103906-100103928 ACCCAGGGCCCTGTGTGCTGTGG + Intronic
1122264349 14:100539704-100539726 TCCCAGGCCCGTGGGTTCTGTGG + Intronic
1122491099 14:102116745-102116767 GCCCAGGGTGGTGGGTTCTGTGG - Intronic
1122625969 14:103085475-103085497 CCCCTGGGCTGTGGGTGCTGAGG + Intergenic
1122817085 14:104319185-104319207 TCCCAGTACCATGGGAGCTGAGG + Intergenic
1122829538 14:104389095-104389117 GTCCAGGGCGGAGGGTGCTGAGG - Intergenic
1122843621 14:104478704-104478726 CCCCAGCTCGAGGGGTGCTGGGG + Intronic
1129167083 15:73784732-73784754 CACAAGGGCCATGGGTGCTGGGG - Intergenic
1129410669 15:75348682-75348704 GCCCAGGGCGCTGGGAGCTGGGG - Intronic
1129470516 15:75751065-75751087 TCCCAGGGCCAGGGCTGCTCTGG - Intergenic
1129520319 15:76181978-76182000 TCTCAGGGTGAATGGTGCTGAGG - Intronic
1129699461 15:77759269-77759291 TCTCAGGCCCAAGGGTGCTGAGG - Intronic
1130053200 15:80501191-80501213 TCCTATGGCCAAGGGTGCTGGGG - Intronic
1132614108 16:831869-831891 TCACAGGGCGGAGGGTGCCGGGG - Intergenic
1132629691 16:911308-911330 CTCCAGGGCGAAGGGTGCCGAGG - Intronic
1132685942 16:1162174-1162196 GCCCAGGGCGAGGGGTCATGGGG - Intronic
1135206833 16:20491924-20491946 CCCCAGGGCGACGGGCTCTGGGG - Intergenic
1135212052 16:20531708-20531730 CCCCAGGGCGACGGGCTCTGGGG + Intergenic
1136026483 16:27472089-27472111 TATCAGGGGGAGGGGTGCTGAGG + Intronic
1138294360 16:55873866-55873888 TCCCAGGGCGATGCAGGCTGCGG + Exonic
1139335147 16:66226299-66226321 TCCCAGGAAGAAAGGTGCTGGGG + Intergenic
1140636797 16:76924503-76924525 TCCCAGGGCTTTTGGTTCTGTGG + Intergenic
1140783951 16:78322143-78322165 TGCCAGGGGGATGGTTGGTGGGG + Intronic
1141463696 16:84193523-84193545 TCCCCTGGCGATGCGAGCTGTGG + Intronic
1141567493 16:84912900-84912922 TCCCAGGGCTCTGGGGGCCGAGG - Intronic
1142134088 16:88443756-88443778 GCCCAGGGGGATGGTTGGTGTGG - Intergenic
1142193062 16:88726678-88726700 CCCCAGGGCGGTGGGTGCGGGGG + Intronic
1142328221 16:89432372-89432394 TGCCACGGCGATGGGTCCTGAGG - Intronic
1143464838 17:7129673-7129695 TCAAATGGCGATGAGTGCTGTGG - Intergenic
1143500769 17:7337217-7337239 TCGCAGGGCGGTGGGTACGGAGG - Intronic
1144060356 17:11578386-11578408 TCCCAGGGGGTTGGGAGATGGGG + Intergenic
1147336101 17:39727715-39727737 TCTCGGGGCGAAGGGGGCTGGGG - Exonic
1147384997 17:40075790-40075812 TCCCAGAGGGTTGGGTGCAGGGG - Intronic
1148454543 17:47804009-47804031 GCCCAGGGGGATGTGTGCAGGGG - Intergenic
1148947267 17:51274700-51274722 TCCCAGCACGTTGGGAGCTGAGG - Intronic
1149437068 17:56642191-56642213 GCCCAGGGTCTTGGGTGCTGGGG - Intergenic
1152548069 17:81012976-81012998 TCCCAGGCAGATGCCTGCTGCGG + Intergenic
1153168199 18:2285777-2285799 TCTCAGGGCCATGGGAGCAGGGG + Intergenic
1153448975 18:5205494-5205516 TGCCAGGGTGAGGGGTGGTGTGG + Intergenic
1154473237 18:14725055-14725077 TCCCAGGGCATTGGAAGCTGAGG + Intergenic
1155341915 18:24821761-24821783 TTCCAGAGCTATGGCTGCTGTGG - Intergenic
1156924586 18:42560299-42560321 TTCCAGGGCAATGGGTATTGTGG + Intergenic
1157006605 18:43590363-43590385 TCCCAGGGCAGTGGGTTCGGGGG + Intergenic
1157325421 18:46665375-46665397 GACCAGGACGATGGGTGATGTGG - Intergenic
1160535411 18:79588964-79588986 TCCCAGCGCGATGTGTGCCTGGG - Intergenic
1160920929 19:1520249-1520271 TCCCAGGGCCATGGGTCCCTGGG + Intergenic
1160960591 19:1718938-1718960 CCCCAGGTCGATGGGAGCGGGGG + Intergenic
1161877347 19:6921970-6921992 TCCCATGGGGTTGGGTGTTGTGG + Intronic
1161903890 19:7140585-7140607 TCCCAGTGAGCTGGGTACTGAGG - Intronic
1162319093 19:9960238-9960260 TTCCAGGGTGCTGGGGGCTGGGG - Exonic
1163844098 19:19628771-19628793 TCCCAGGGTGAGGGGTACGGGGG - Exonic
1165831471 19:38732735-38732757 CCACAGGGAGATGGGGGCTGGGG - Intronic
1165938478 19:39403390-39403412 TCCGAGGGAGGGGGGTGCTGGGG + Intergenic
1166351666 19:42201740-42201762 TCCCTGGGCGTTGGGTGGAGAGG - Intronic
1166387367 19:42389654-42389676 TCTCAGGGGGAGGGGAGCTGGGG + Intronic
1166652729 19:44586605-44586627 TCCCTGGGTGAGGGGAGCTGAGG - Intergenic
1167367905 19:49064503-49064525 TCTGAGGGAGAAGGGTGCTGGGG - Intronic
1167367922 19:49064550-49064572 TCTGAGGGAGAAGGGTGCTGGGG - Intronic
1167461107 19:49625212-49625234 TCCCAGGGCGATGGGTGCTGTGG - Intronic
1167571929 19:50293715-50293737 TCCCAGGTCAATGGGGACTGAGG - Intronic
1168010662 19:53529149-53529171 TCCCAGCGCTTTGGGAGCTGAGG + Intronic
1168240493 19:55086657-55086679 GCTCAGGGCGAGGGGTCCTGGGG - Intronic
1168316518 19:55486888-55486910 TACCAGGCCGAGGGGGGCTGGGG + Exonic
1168326467 19:55541108-55541130 TCCCAGGGTGGTGGTGGCTGAGG + Exonic
1168519028 19:57033769-57033791 TCCCATGGCCATGAGAGCTGGGG - Intergenic
1202704904 1_KI270713v1_random:15291-15313 TCCCAGGGCTGGGGGCGCTGTGG - Intergenic
926722518 2:15971716-15971738 CCCCAGGGCGAGGGCTGATGAGG - Intergenic
927917321 2:26945515-26945537 TCGCATGGTGATGGGTGCGGGGG - Intronic
927980212 2:27370302-27370324 ACTGAGGGCGATGGCTGCTGTGG - Intronic
930373732 2:50538216-50538238 TCTCAGGGAGTTGGCTGCTGGGG + Intronic
931250645 2:60528115-60528137 TCTTAGGACGATGGGTTCTGGGG - Intronic
932241402 2:70159785-70159807 TCCCAGAGCTTTGGGGGCTGAGG - Intronic
936057047 2:109269188-109269210 TCCCAGGGCGAAGGTTGGAGAGG - Intronic
936077608 2:109411673-109411695 ACCCAGGGCGAGGGGTGCGAGGG - Intronic
936105396 2:109619580-109619602 TCCCACTGTGATGGCTGCTGGGG + Intergenic
939160715 2:138585030-138585052 TTCCAGGACAATAGGTGCTGAGG + Intergenic
941088506 2:161146953-161146975 CCCTAGGGGGAGGGGTGCTGCGG - Intronic
946372793 2:219290752-219290774 TCCCAGGACCCTGTGTGCTGGGG + Intronic
946374884 2:219302104-219302126 TCACAGGGAGGTGGATGCTGAGG + Intronic
947686960 2:232096371-232096393 CCCCAAGGCGCTGGGTGCAGTGG - Intronic
947733906 2:232445171-232445193 GCCCTGGGAGCTGGGTGCTGGGG + Intergenic
947906748 2:233769905-233769927 GCCCAGAGCGTTGGGTGGTGTGG + Intronic
948822384 2:240556740-240556762 GCCCAGTGTGATGGGTGTTGGGG - Intronic
949059722 2:241949790-241949812 TCCCAGGACAAGGGGTGCTGTGG - Intergenic
1168898179 20:1338235-1338257 TCCCAGGGCACTGGGGGCAGGGG + Intronic
1169083866 20:2815241-2815263 TCCAAGGGGCCTGGGTGCTGGGG + Exonic
1169340886 20:4795435-4795457 TCCCAGTGGGGAGGGTGCTGGGG + Intronic
1169930941 20:10832420-10832442 TGCCAGGGAGCTGGGTGTTGAGG - Intergenic
1170568161 20:17618195-17618217 CCCCAGGGCGATGGGTGGCCAGG + Intronic
1171277198 20:23867468-23867490 TCACATGGTGCTGGGTGCTGGGG - Intergenic
1171290406 20:23979738-23979760 TCCCAGGGTCATGGGTGAAGGGG - Intergenic
1171337065 20:24394264-24394286 TCCCAGGGAGGAGGGAGCTGTGG - Intergenic
1171339592 20:24416879-24416901 TCCCACGTCCATGGGTGCTCCGG - Intergenic
1172124065 20:32614658-32614680 GCCTAGTGAGATGGGTGCTGCGG - Intergenic
1172221670 20:33278349-33278371 TCCCAGGTTGGTGGGGGCTGTGG + Intronic
1172596291 20:36153429-36153451 TCCCAGGGCAGTGGATTCTGTGG + Intronic
1172645596 20:36467335-36467357 TTCCAGGGAGGTGGGTGCAGAGG + Intronic
1172866451 20:38102966-38102988 TCCCAGTGCTTTGGGGGCTGAGG + Intronic
1172875821 20:38163868-38163890 TCCCTGGGCTGTGGGAGCTGGGG + Intronic
1172888222 20:38246040-38246062 ACCCAGGACGGTGGGTGCTGTGG + Exonic
1174160298 20:48545672-48545694 GTCCTGGGCGCTGGGTGCTGGGG - Intergenic
1174163377 20:48567491-48567513 TTCCAGGAAGAGGGGTGCTGTGG - Intergenic
1175112759 20:56660213-56660235 TCAGAGTGCGGTGGGTGCTGTGG - Intergenic
1175944188 20:62551124-62551146 TGCCAGCGAGGTGGGTGCTGCGG + Intronic
1176096740 20:63347768-63347790 TCCCAGGCCTGTGGATGCTGAGG + Intronic
1176243870 20:64088173-64088195 TCCCAGGGCTGGGGGTCCTGGGG + Intronic
1176302923 21:5107282-5107304 TCCCAGGGTCACGGGTGCTTGGG - Intergenic
1176521361 21:7826918-7826940 TCCCAGGGGGATGTGGGGTGTGG + Intronic
1176801248 21:13432795-13432817 TCCCAGGGCATTGGAAGCTGAGG - Intergenic
1178215444 21:30592500-30592522 GGCCATGGCTATGGGTGCTGTGG + Exonic
1178215986 21:30598819-30598841 GACCATGGCTATGGGTGCTGTGG - Exonic
1178256618 21:31058809-31058831 TCCCAGGGAGAAAGGAGCTGAGG - Intergenic
1178655381 21:34456930-34456952 TCCCAGGGGGATGTGGGGTGTGG + Intergenic
1179397069 21:41050413-41050435 TCCCAGGGCTTTGGAGGCTGAGG + Intergenic
1179840033 21:44066295-44066317 TCCAGGGGCGACGGGGGCTGAGG + Intronic
1179853528 21:44150699-44150721 TCCCAGGGTCACGGGTGCTTGGG - Intergenic
1180767021 22:18351272-18351294 TCCCAGGGTCATGGGTGAAGGGG + Intergenic
1180779292 22:18511107-18511129 TCCCAGGGTCATGGGTGAAGGGG - Intergenic
1180812009 22:18768427-18768449 TCCCAGGGTCATGGGTGAAGGGG - Intergenic
1180908828 22:19434018-19434040 TCCCAGCACTTTGGGTGCTGAGG - Intronic
1181198164 22:21202671-21202693 TCCCAGGGTCATGGGTGAAGGGG - Intergenic
1181401580 22:22653133-22653155 TCCCAGGGTCATGGGTGAAGGGG + Intergenic
1181427758 22:22855411-22855433 TCCCAGGGCCACAGGAGCTGAGG - Intronic
1181647972 22:24243984-24244006 TCCCAGGGTCATGGGTGAAGGGG - Intronic
1181703541 22:24634230-24634252 TCCCAGGGTCATGGGTGAAGGGG + Intergenic
1181771507 22:25129027-25129049 TGCCAGGGCCCTGGGTGCAGAGG + Intronic
1181827461 22:25529634-25529656 TCCTATGGGGATGGGTGATGAGG - Intergenic
1181878275 22:25957021-25957043 TCCCAGGGCCATGGGTGTGGAGG - Intronic
1182444093 22:30380238-30380260 TCCAAGGGCTGAGGGTGCTGGGG + Intronic
1183044844 22:35211331-35211353 TCAGATGGTGATGGGTGCTGTGG - Intergenic
1184835589 22:47019175-47019197 TCCCAGTGCGCTGGGTGGAGCGG + Intronic
1203228643 22_KI270731v1_random:92166-92188 TCCCAGGGTCATGGGTGAAGGGG + Intergenic
953447825 3:42982772-42982794 TCCCAGGGCCCAGCGTGCTGTGG + Intronic
954430007 3:50465629-50465651 GCACAGGGCTATGGGAGCTGGGG + Intronic
954892566 3:53944650-53944672 TCCCAAGGCCCTGTGTGCTGAGG - Intergenic
959479387 3:106853273-106853295 TCACAGAGCGATGGAGGCTGAGG - Intergenic
961404456 3:126668404-126668426 TCCATGTGCGTTGGGTGCTGTGG + Intergenic
961508439 3:127387215-127387237 TGCCAGGGGGATGGATGCCGCGG - Intergenic
962751005 3:138434824-138434846 TCCCAGGGCGCTGGGGGCCCCGG - Exonic
964466428 3:156998119-156998141 TCCCAGTAGGATGGGAGCTGAGG - Intronic
969284401 4:6193813-6193835 TCCCAGGGCTTTGGCTGCTCAGG - Intronic
969687063 4:8681601-8681623 TCCCAGCGCCATGGGGGGTGGGG + Intergenic
970304386 4:14716753-14716775 TCCCAGCGAGGTGGGTGGTGAGG - Intergenic
972156787 4:36172915-36172937 TCATAGGGCGATGGGTTGTGTGG - Intronic
974821497 4:67071800-67071822 TCCCATGGCTAAGGGTGGTGCGG + Intergenic
975789484 4:77933194-77933216 TCCCAGCATGCTGGGTGCTGAGG - Intronic
981687978 4:147476098-147476120 TCCCAGGCCCATGGGTGGAGTGG + Intergenic
984599169 4:181706332-181706354 TCCAGGGGCGGTGGGTGCTAGGG + Intergenic
985768519 5:1794828-1794850 ACCCAGAGAGCTGGGTGCTGTGG - Intergenic
985823259 5:2175308-2175330 ACCCAGGGTGAGGGGTGCTGTGG + Intergenic
986772872 5:10989314-10989336 GCCCTGGGCTATGGGAGCTGGGG - Intronic
987862801 5:23507755-23507777 TCCCAGGGTGAGGGGATCTGGGG - Intronic
988942301 5:36158830-36158852 TCTCTGGGAGATGGGGGCTGGGG - Intronic
989279347 5:39622572-39622594 TCCCAGGGTGGCGGGTTCTGGGG + Intergenic
990631938 5:57679958-57679980 TCACAAGGAGATGGGTTCTGGGG + Intergenic
992368141 5:76114241-76114263 TCCCATGGTGATGGGGGATGGGG - Intronic
994173687 5:96686525-96686547 TTCCAGAGGGATGGGGGCTGAGG + Intronic
995044256 5:107626529-107626551 TCCCAGGGCTTTGGGAGGTGAGG - Intronic
998094962 5:139391771-139391793 TCCCAGGGCGTGGTGTGGTGTGG - Exonic
999269289 5:150287014-150287036 TCACAGAGCTATGGGTGATGAGG + Intronic
999623371 5:153494298-153494320 TGCCAGCACGATGGGTGCTTGGG + Intronic
999721462 5:154401988-154402010 ACCCTGGGTGAGGGGTGCTGAGG - Intronic
1001980376 5:176034015-176034037 TCCCAGGAGGGTGGCTGCTGTGG - Intronic
1002237085 5:177810050-177810072 TCCCAGGAGGGTGGCTGCTGTGG + Intergenic
1002421782 5:179152773-179152795 TCTCATGGCGATGGGGGCTCTGG - Intronic
1002724282 5:181284014-181284036 TCCCAGGAGGGTGGCTGCTGTGG + Intergenic
1003070689 6:2943286-2943308 TACCAGGGCCATTGGTGCTGGGG - Intergenic
1005989291 6:30893192-30893214 GCCCAGGGAGAAGGGTGCAGAGG - Intronic
1006738952 6:36293889-36293911 TCCCAGGGCTCTGTGTGCAGGGG - Intronic
1007480505 6:42146597-42146619 TCCCAGTGCTTTGGGAGCTGAGG + Intergenic
1007589185 6:43011310-43011332 TCCCAGGGCTGTGTGGGCTGTGG - Exonic
1008169705 6:48187836-48187858 TGGCAGGGCGAGGGGAGCTGAGG - Intergenic
1013314417 6:108927370-108927392 ACCCAGGCTGATGGGTGGTGAGG + Intronic
1013797295 6:113901890-113901912 TCCCAGTGAGATGGCTGCAGAGG + Intergenic
1017760124 6:157562242-157562264 GCCCAGGGCTGTGGGTGTTGTGG - Intronic
1018934382 6:168263936-168263958 TAACAGGGAGATGGGGGCTGGGG - Intergenic
1019607804 7:1918828-1918850 CCCCAGGGCGACTGGTGCTGTGG + Intronic
1019989873 7:4683301-4683323 GTCCAGGCCGATGGGAGCTGGGG - Intronic
1023841456 7:44100875-44100897 TCCCAGAGCCATGGGACCTGAGG - Intergenic
1027170188 7:75866425-75866447 TCCCAAGGGGATGTGTGCTTGGG + Intronic
1027189931 7:75990596-75990618 TCCCAGAGGGCTGGGTGCGGTGG + Intronic
1032387801 7:131536646-131536668 TCCCAGGGGGAGGGGCGCTGGGG - Intronic
1032421247 7:131781778-131781800 TCCCAGGGAGATTGGTGCGGAGG + Intergenic
1032847873 7:135767377-135767399 TCCCAGGACGTGGGATGCTGTGG + Intergenic
1033303133 7:140204050-140204072 TCCCAGCGCTATGTGGGCTGTGG + Intergenic
1034124004 7:148654794-148654816 TCCCAGAGTGATGGTTGCTGTGG - Intergenic
1034261507 7:149759508-149759530 GCCCTGGGCGCTGGGTGCTTTGG - Intergenic
1034385440 7:150737153-150737175 TGCCCCGGTGATGGGTGCTGAGG + Intronic
1034976106 7:155450030-155450052 GCCCGGGGCGTTGGGCGCTGCGG + Intergenic
1035265586 7:157688963-157688985 TCCCGGCGCGGAGGGTGCTGCGG + Intronic
1035350023 7:158239084-158239106 CCCCGGGGTGATGGGGGCTGTGG - Intronic
1036649234 8:10631794-10631816 ACCAAGGGCGATGGGTCCTGGGG + Intronic
1042190051 8:66177344-66177366 TCCAAGGGCTGAGGGTGCTGCGG + Exonic
1047412624 8:124636731-124636753 TCCAATGGCGATGGGTGCTTAGG - Intronic
1048076590 8:131078233-131078255 TCCCAGGGCGGTCCTTGCTGGGG - Intergenic
1049222279 8:141433577-141433599 TCCCAGGGTCCTGGGGGCTGGGG - Intergenic
1049666310 8:143844831-143844853 TGCCAGGGCCATGAGTGGTGAGG + Intergenic
1049844170 8:144792124-144792146 GCCCATGGCGACGGGTCCTGGGG + Exonic
1050493211 9:6211723-6211745 TCCCAGTGTTTTGGGTGCTGGGG - Intergenic
1051156273 9:14150249-14150271 TCCCTGGGTTATGGGCGCTGAGG + Exonic
1053886420 9:42647447-42647469 TCTCAGGAGGATGGCTGCTGTGG + Intergenic
1054172646 9:61855721-61855743 TACCAGGGCGATGGAGGCTTGGG + Intergenic
1054225439 9:62454896-62454918 TCTCAGGAGGATGGCTGCTGTGG + Intergenic
1054664894 9:67725080-67725102 TACCAGGGCGATGGAGGCTTGGG - Intergenic
1058728245 9:107824078-107824100 TCCCTGGGGGATGGGTGGGGAGG + Intergenic
1060050196 9:120373220-120373242 TCCGATGGCAATGGTTGCTGTGG + Intergenic
1060529482 9:124339949-124339971 TACCAGGGCGACGGGGGCAGGGG - Intronic
1060550170 9:124481258-124481280 TTCCAGGGCTGTGGGGGCTGGGG + Exonic
1061191763 9:129086354-129086376 TCCCAGGGAGACAGGGGCTGGGG - Intronic
1062238873 9:135525471-135525493 GCCGAGGGTGAGGGGTGCTGAGG - Intronic
1062280979 9:135751474-135751496 CCCCAGGACGATGGGCCCTGGGG - Intronic
1062390726 9:136332701-136332723 TCCCAGAGGGATGGGTGAGGTGG + Intronic
1187727086 X:22214569-22214591 TCTCAGGGACATGGGAGCTGGGG + Intronic
1197132016 X:123016335-123016357 TACCAGGGGGATGGGTGGAGTGG - Intergenic
1197936785 X:131747720-131747742 TCCCAGGGGGAAGGGTGCGGTGG + Intergenic
1199897341 X:152137561-152137583 TCCCAGGGAGATGGTGGCTTTGG - Intronic
1200256777 X:154586463-154586485 GCCCAGGGAGATGGGTGCAGAGG + Intronic
1200260992 X:154617940-154617962 GCCCAGGGAGATGGGTGCAGAGG - Intronic
1200267034 X:154652308-154652330 GCCCAGGGAGATGGGTGCAGAGG - Exonic