ID: 1167463853

View in Genome Browser
Species Human (GRCh38)
Location 19:49640040-49640062
Sequence CGGCCCCGGGGCGGGGGACC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 605
Summary {0: 1, 1: 0, 2: 5, 3: 63, 4: 536}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167463853_1167463861 -6 Left 1167463853 19:49640040-49640062 CCAGGTCCCCCGCCCCGGGGCCG 0: 1
1: 0
2: 5
3: 63
4: 536
Right 1167463861 19:49640057-49640079 GGGCCGCCCCCGCCCTGTCCCGG 0: 1
1: 0
2: 5
3: 36
4: 407

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167463853 Original CRISPR CGGCCCCGGGGCGGGGGACC TGG (reversed) Exonic
900172045 1:1273963-1273985 CGACCCCGGGGTGGGGGATGGGG + Intergenic
900183388 1:1322201-1322223 CGGCCCCGAGGCATGGGGCCCGG + Intronic
900269172 1:1778418-1778440 CGGCGCCGGCGCCGGGGTCCGGG - Intronic
900349198 1:2227079-2227101 CGGCCCCGGGGCGGAGGTCAGGG + Intergenic
900392399 1:2439359-2439381 CAGCCCTGGGGTCGGGGACCAGG - Intronic
900607873 1:3531805-3531827 GGGCCGCGGGGCGGGGGAGGGGG + Intronic
900607886 1:3531826-3531848 GGGCCGCGGGGCGGGGGAGGGGG + Intronic
901019759 1:6249700-6249722 CGGGCCCGGGGCGGCGGCGCGGG + Exonic
901443401 1:9292953-9292975 CGGCGCCGGGGCCGGGGCCGCGG + Exonic
901628845 1:10638619-10638641 CGGCCGCGGGGAGGGGCGCCGGG + Exonic
901641223 1:10694160-10694182 CGGCCCCGGCTTGGGGGCCCTGG + Intronic
902215549 1:14932254-14932276 GGGACCCGGGGCAGGGGACGGGG - Intronic
902283947 1:15394248-15394270 CAGCCCTGGGGCTGGAGACCTGG + Intronic
902601080 1:17540394-17540416 CCGCCTCTGGGCGGGGGTCCAGG - Intronic
902770684 1:18643845-18643867 CGACCCCGAGGCGGGAGGCCGGG + Intronic
902837773 1:19058051-19058073 CAGCCGCGGGGCAGGGGGCCAGG + Intergenic
903153296 1:21428259-21428281 CGGGCGCGGGGCGCGGGGCCTGG - Intergenic
903420920 1:23217411-23217433 GGGCCCCGGGGCGGCGGGGCGGG - Intergenic
904037926 1:27568698-27568720 CGGCCGCGGCGCGGGTGCCCGGG + Intronic
904039473 1:27575743-27575765 CGGGCCCGGGGCGCGGGAAGGGG - Intronic
904500118 1:30908520-30908542 CGGCGCCGGGGCCGGGGCCGCGG - Exonic
904903818 1:33878829-33878851 CAGCCCTGGGGAGGGGGACAGGG + Intronic
905137178 1:35808475-35808497 GGGACCCGGGGCGGGCGGCCGGG + Intronic
905202372 1:36323317-36323339 CCGCCCCGGGACGGCGGAACCGG - Intronic
905684882 1:39901272-39901294 GGGTCCCGGCGCAGGGGACCCGG - Exonic
905741370 1:40374017-40374039 GTGCCCCTGGGCGGGGGACCGGG + Exonic
905803858 1:40862173-40862195 CTGGCCCGGGCCGGGGGAGCCGG - Exonic
905862583 1:41361325-41361347 CAGCCCGCGGGCGGGGCACCTGG + Intergenic
906411852 1:45584737-45584759 CGGCCCTGGGGCAGGGGGCGGGG + Intronic
907519207 1:55012129-55012151 GGGCCCAGGGGCAGGGAACCTGG + Intergenic
908195376 1:61742400-61742422 CCCGCCCGGGGCGGGGCACCGGG - Intergenic
910183117 1:84506511-84506533 AGGCCCGGCGGCGGGTGACCAGG + Exonic
911144738 1:94541594-94541616 CGGTCTCGGGGCGCGGGACCCGG + Exonic
911601193 1:99849998-99850020 CGGCTCCGGGCCGGGGGACCTGG - Intergenic
914197341 1:145454434-145454456 CGGGCCCGGGGCGGCGGGGCCGG - Intergenic
915246466 1:154559052-154559074 CGGCTCGGGGGCGGGGGAAGCGG - Intergenic
915302869 1:154961570-154961592 CGGCCATGGAGTGGGGGACCCGG + Exonic
915597147 1:156902241-156902263 CAGCCCTGGGGCCTGGGACCTGG - Exonic
916128739 1:161593270-161593292 CGGCCCCTGAGCAGGGGAGCTGG + Intronic
916414036 1:164576388-164576410 CGGCGCCGCGCCGGCGGACCGGG - Intronic
916676333 1:167066825-167066847 GGGCTCCGGGACCGGGGACCCGG - Intronic
918282848 1:183023195-183023217 CGGGCCCGCGGCGCGCGACCCGG - Intergenic
919403268 1:197146486-197146508 CGGCTCCGGAGCGGGGATCCGGG + Exonic
919739171 1:200972175-200972197 CTGCCCCGGGGCTGGGGACGCGG - Intronic
920418303 1:205813084-205813106 GGGCACCCGGACGGGGGACCGGG + Exonic
922499067 1:226083582-226083604 CGGCCGCGTGGGGGCGGACCCGG - Intergenic
922718044 1:227887161-227887183 CGGGCAGGGGGCGGGGGACTGGG + Intergenic
922811227 1:228416640-228416662 CGGCCCGGGGCGTGGGGACCTGG + Intronic
923674022 1:236064947-236064969 CGGCCCCGGACAGGGGGACCTGG - Exonic
923684034 1:236142135-236142157 CGGCCCCGGGGATGGGGAAGGGG + Intergenic
923684085 1:236142252-236142274 CGGCCCCGGGGATGGGGAGGGGG + Intergenic
924172440 1:241356757-241356779 CAGCCCCGGCGCGGGGCTCCCGG + Intronic
924362335 1:243254909-243254931 CCGCCGCGGGGCGGGGGTGCGGG - Intronic
1062932813 10:1363821-1363843 CGGGCCCGGGGCGGCGCGCCCGG - Exonic
1063418282 10:5890434-5890456 CGGGCCCGGGGTGGGGCAGCGGG + Intronic
1064764762 10:18659564-18659586 CCGCGCCGCGGTGGGGGACCCGG + Exonic
1065025104 10:21534110-21534132 CGGCGCGGGGGAGGGGGACGGGG + Intergenic
1067346719 10:45443222-45443244 CGCCCGCGGGGCGGTGGTCCTGG + Intronic
1070129672 10:73647753-73647775 AGGCCCGGCGCCGGGGGACCCGG - Exonic
1070147556 10:73785836-73785858 CGGATCCGCGGGGGGGGACCCGG + Exonic
1070152236 10:73811886-73811908 CAGCCCCGCGGAGGGGGAGCCGG + Intergenic
1070800829 10:79243551-79243573 CGGCGGCGGCGCGGGGGCCCGGG - Intronic
1070877276 10:79826048-79826070 CGGTCCTGGGGCGAGGGTCCGGG - Intergenic
1070972948 10:80582493-80582515 GGGCCCCAGTGCGGGGGTCCTGG - Intronic
1071643773 10:87342092-87342114 CGGTCCTGGGGCGAGGGTCCGGG - Intergenic
1072190861 10:93075091-93075113 CGGACTAGGGGCGCGGGACCTGG + Intronic
1072591627 10:96832728-96832750 CGGCGCCGGGGCGCCGGGCCTGG - Intronic
1073063610 10:100745982-100746004 TGGCCCCGGGGCGGTGGGCCGGG - Exonic
1073088642 10:100913148-100913170 CGACCCCGGGGCTGGGGATGAGG - Exonic
1073115669 10:101090119-101090141 CAGCCCTGGGGAGGGGGAGCAGG + Exonic
1073340922 10:102744019-102744041 CGGCGCCGTGGCGGAGGAGCAGG + Exonic
1074865430 10:117542121-117542143 CGGCCCCGCGTCGGGAGAACTGG - Intergenic
1075040718 10:119104623-119104645 CGCCCCCGGCTCGGGGGAACCGG - Intronic
1075885634 10:125896679-125896701 TGGGACCGGGGCGGGCGACCGGG + Intronic
1076499366 10:130924328-130924350 CGGCCCCAGGCCGCAGGACCTGG + Intergenic
1076815595 10:132913299-132913321 CAGCCCCGGGGCCAGGCACCAGG + Intronic
1076821548 10:132942363-132942385 CCTCCCCGGGGCGGGGGTCGTGG + Intronic
1076821567 10:132942398-132942420 CCTCCCCGGGGCGGGGGTCGTGG + Intronic
1076871354 10:133196488-133196510 CGGCCATGGGGTTGGGGACCTGG + Intronic
1076909035 10:133378383-133378405 CGGCCCCTCGGCAGAGGACCGGG + Intergenic
1077140624 11:1022683-1022705 CGGCTCCAGGTCAGGGGACCTGG - Intronic
1077158846 11:1103526-1103548 CTGCCCCAGGGCGGGTGGCCAGG + Intergenic
1077194338 11:1271952-1271974 AGGCCCCGGGGACGGGGACCAGG + Intergenic
1077334363 11:1996898-1996920 CGGCCACGGGAGGGGGGCCCCGG - Intergenic
1077337182 11:2010670-2010692 GGGCCCAGGAGCGGGGGCCCAGG - Intergenic
1077435768 11:2538458-2538480 CGGTCCTGGGACAGGGGACCTGG - Intronic
1077492948 11:2870504-2870526 CGTGCCCGGGGCCTGGGACCAGG - Intergenic
1077495484 11:2884848-2884870 CGGGGCCGGGGCGGGGGCCGGGG + Exonic
1077539348 11:3139291-3139313 TGGCCCCGGGGCTGGGGCCGTGG + Intronic
1077581823 11:3422243-3422265 AGGCCCCAGGGACGGGGACCGGG + Intergenic
1077635829 11:3840901-3840923 CCTCCCCGAGGCGGGGGAGCTGG + Exonic
1078003156 11:7513729-7513751 CGGCCCAGGGGGTGGGGACGAGG + Intronic
1078139672 11:8682959-8682981 CGGGCCCGGGGCGGGGCTCCCGG + Intronic
1079126235 11:17720323-17720345 CGGCCCGGGGGCAGCGGGCCCGG - Exonic
1080551379 11:33376325-33376347 CGGCCCGGGGGAGGGGGCCCCGG + Intergenic
1081709751 11:45209153-45209175 GGGCCCTGGGGCCGGGGGCCGGG + Intronic
1081851492 11:46277939-46277961 CGGCCCCGGGTGGGGGGCGCGGG - Exonic
1083670865 11:64299413-64299435 CGGCGGCGGGGCGGCGGGCCCGG - Exonic
1083686505 11:64379266-64379288 TGGCCCAGGGAAGGGGGACCGGG - Intergenic
1084165584 11:67373422-67373444 CGGCCCCGGCGCGGGGCTCCCGG + Intronic
1084385512 11:68841093-68841115 CGGGCATGGGGAGGGGGACCGGG + Intronic
1084833688 11:71787768-71787790 AGGCCCCAGGGACGGGGACCGGG - Intronic
1085353543 11:75815786-75815808 CGGCCTCGGGCCGGGGCCCCAGG - Intronic
1085666291 11:78417888-78417910 CGCGCTCGGGGCGGGGGAGCGGG - Intronic
1087014620 11:93543227-93543249 CGGCGGCGGGGCGGGCGAGCCGG - Intronic
1087761816 11:102110671-102110693 AGGCGCCGGGGCGGGGGATGCGG + Exonic
1089208923 11:116787919-116787941 CGGGGCCGGGGCGGGCGACGGGG + Exonic
1089499824 11:118925511-118925533 CGGGGCCGGGGCGCGGGGCCGGG + Intronic
1090333401 11:125947825-125947847 CGGCCACAGGCCGGGGAACCAGG - Intergenic
1091108292 11:132943136-132943158 GGTGCGCGGGGCGGGGGACCAGG - Exonic
1091207814 11:133833165-133833187 CGGAACCGGAGCGGGGCACCGGG - Intergenic
1202817346 11_KI270721v1_random:52080-52102 CGGCCACGGGAGGGGGGCCCCGG - Intergenic
1202820166 11_KI270721v1_random:65852-65874 GGGCCCAGGAGCGGGGGCCCAGG - Intergenic
1091473814 12:753055-753077 CGGCCCCGGGGCAGAGGAGTGGG - Exonic
1091550092 12:1530410-1530432 CTGCTCCGGAGCGCGGGACCCGG - Intronic
1092160014 12:6310870-6310892 CGGCCCGGGGGCGGGGCGGCCGG + Intronic
1093711475 12:22334244-22334266 CGTCCCAGGGGCGGGGGCCGGGG + Exonic
1096073565 12:48788930-48788952 GGGCGGCGGGGCGGGGGCCCAGG - Intronic
1096077548 12:48814789-48814811 CGGCCCCGGGACCGGACACCAGG + Intronic
1096191523 12:49623338-49623360 CGCCCCCCGGGGGGCGGACCCGG + Intronic
1096242537 12:49967102-49967124 CTGCCCCGGGCTGGGGGAGCCGG + Intergenic
1096691556 12:53325093-53325115 CGGCCCCGGGTCGGGACGCCGGG - Intergenic
1096692224 12:53328279-53328301 GGGCCACTGGGAGGGGGACCCGG + Exonic
1096717410 12:53499672-53499694 GGGGCCAGGGGCGGGGGCCCTGG - Intronic
1097013106 12:55966961-55966983 CGGCCCTGGAGCGGGGGCCTGGG - Exonic
1097280997 12:57845639-57845661 CGGCCCCGGGGGAGCGCACCGGG + Intronic
1097938617 12:65279294-65279316 CGGGCCCGAGGCGTGGGAACCGG + Intronic
1099973595 12:89524922-89524944 CGGGCCGGGGGCTGGGGGCCGGG + Intronic
1100505696 12:95217960-95217982 CGTTCCCGGGGCGAGGGATCGGG + Intronic
1100830936 12:98516089-98516111 CGGCCCCAGAGCCGAGGACCGGG - Exonic
1101371781 12:104137738-104137760 CGGCCGAGGGGCGGGAGACGCGG - Intronic
1102068164 12:109996108-109996130 CGGCCCCGGGGTAGGGGTCCGGG + Intronic
1103595916 12:122024075-122024097 GGGCCCCGGGGCGGCCGGCCTGG + Intronic
1103905699 12:124326300-124326322 CAGGCCCGGGGCCGGGGACTTGG + Exonic
1104692675 12:130838867-130838889 GGTCCCCAGGGCGGGGGTCCCGG - Intronic
1104854303 12:131894896-131894918 CGGGCCGGGGGCGCGGGGCCGGG - Exonic
1105413839 13:20192804-20192826 CGGGGCCGGGGCGGGGGTCTCGG + Intronic
1106109088 13:26760934-26760956 CGGCCCAGGGGCGCGGGGCGAGG + Intergenic
1106956354 13:34942734-34942756 CGGCCGGGGGGCGGGGGCCGAGG + Exonic
1112506787 13:99980633-99980655 CGGCAGCGGGGCGGGGGCGCGGG + Intergenic
1113082522 13:106534396-106534418 GGGCCCGCGGGCGGGCGACCGGG - Intronic
1113874367 13:113585081-113585103 TGACCGCGGGGCGGGGGTCCCGG + Intronic
1114270706 14:21098425-21098447 CGGGCCGGGGGCGGGGGGGCCGG - Exonic
1114270731 14:21098462-21098484 AGGGCCGGGGGCGGGGGACCGGG - Exonic
1115985953 14:39103454-39103476 CGGCCGAGGGGCGTGGGACCGGG + Exonic
1116817855 14:49599766-49599788 CGGGGCCGGGGCGGGGATCCGGG + Intronic
1116817918 14:49599935-49599957 CGGGGCCGGGGCGGGGGCTCCGG + Intronic
1118854703 14:69611843-69611865 CGGCCCGGGGGCGGCGGGGCCGG + Intronic
1120788018 14:88554710-88554732 CGGCCGCGCGGCGGGGCCCCGGG - Exonic
1121199681 14:92106652-92106674 CGGCACGTGGGCGGGGTACCGGG - Intergenic
1121290040 14:92766661-92766683 CGGGCCCAGGACAGGGGACCTGG + Intergenic
1121645750 14:95516423-95516445 CGGCGCGGGGGCGGGGGCCCCGG - Intronic
1121645936 14:95516881-95516903 CGGACCCGGGGCGGGGGTTAAGG + Intronic
1121665627 14:95670055-95670077 CAGCCCCTGGGCAGGGGACAGGG - Intergenic
1122108792 14:99480900-99480922 CGGCCCGGGGGCGGGGTCCGGGG - Intergenic
1122183492 14:99971975-99971997 CGGCGGCGGGGCGCGGGACGCGG - Intronic
1122410034 14:101521235-101521257 TGGCCCCGGGGCCTGGAACCTGG + Intergenic
1122543304 14:102509500-102509522 CGGGCGCGGCGCGGGGGACGGGG + Intronic
1122558127 14:102592439-102592461 GGGCGGCGGGGCGGGGGAGCGGG - Intergenic
1122917516 14:104865760-104865782 CGGTGCCGGGGCGGGGACCCGGG - Intronic
1122967365 14:105137669-105137691 CGGCTCTGGGCCAGGGGACCAGG - Intergenic
1123036642 14:105474503-105474525 CGTCCCCGGGGCGGCGGGCAGGG - Intronic
1124109532 15:26773159-26773181 CGGGCGCGGGGCGGGGGAGGAGG + Intronic
1124896941 15:33786000-33786022 TGGCCCCTGGGCTGGGGACTGGG - Intronic
1125921680 15:43528908-43528930 CGGCGCCGGGTAGGGGGGCCAGG + Exonic
1126704925 15:51397763-51397785 CTGCCCCAGGGCTGAGGACCAGG + Intronic
1130546137 15:84858449-84858471 CGGCCTTGGGGCTGGGGCCCAGG - Exonic
1131977607 15:97961349-97961371 CGGGCCAGGGGCGGGGCGCCAGG - Intronic
1132419308 15:101652093-101652115 CGGCCTCGGGCCGGGCGGCCAGG + Intronic
1132652226 16:1026688-1026710 CTGCCGCGGTGCGGGGGACCTGG - Intergenic
1132710708 16:1265903-1265925 CGGCAGCTGGGTGGGGGACCAGG - Intergenic
1132785906 16:1656893-1656915 GGGAGCCGGGGCGGGGGTCCTGG - Exonic
1133227875 16:4351167-4351189 CGGGCCGGGGGCCGGGGGCCGGG - Intronic
1133277875 16:4648932-4648954 CAGCCCCGGAGAGGAGGACCCGG - Intronic
1133350394 16:5097486-5097508 AGGCCCCAGGGACGGGGACCGGG + Intronic
1135003858 16:18801331-18801353 CGGGCCCGCGGCGGGTGACAGGG + Intronic
1136237803 16:28925265-28925287 CGGCCCCGGGCTGGAGGCCCCGG + Exonic
1136365183 16:29806426-29806448 GGGGCCGGGGGCGGGGGCCCGGG - Intronic
1136399795 16:30011068-30011090 CGGCGCGGCGGCGGGGGACGGGG + Exonic
1136556471 16:31010448-31010470 CGGCACAGAGGCGGGAGACCCGG - Exonic
1137788535 16:51155375-51155397 CGCCCCGGGGGCGGGGGACGAGG + Intergenic
1137926514 16:52546732-52546754 TGGGCCCGGGGCCGGGGGCCGGG + Exonic
1138503355 16:57462867-57462889 GGGCCCCGGGGCAGGGGGCGGGG + Intronic
1138619104 16:58197781-58197803 CGGCGGCGCGGCGGGGGACGCGG + Exonic
1139598123 16:67969635-67969657 CGGGCCCGCTGCGGGGGCCCTGG - Intergenic
1140097089 16:71884237-71884259 GGGCCGCGGGGAAGGGGACCTGG - Intronic
1140663990 16:77212429-77212451 CGGGGGCGGAGCGGGGGACCTGG - Intronic
1141168883 16:81678642-81678664 CGGCCCCGGGGGCGGGCACGCGG - Intronic
1142129997 16:88428078-88428100 GGGCCCCGGGGCTGGGGGCCTGG - Exonic
1142293016 16:89201345-89201367 CGGGCGCGGGGCGCGGGCCCGGG + Intronic
1142367556 16:89657984-89658006 CCGCCCCTGGGCGCGGGCCCAGG + Intronic
1142476290 17:191950-191972 CTGTCGCGGGGCGGGGGAACGGG - Intergenic
1142476427 17:192322-192344 CTGTCGCGGGGCGGGGGAACGGG - Intergenic
1142476543 17:192636-192658 CTGTCGCGGGGCGGGGGAACGGG - Intergenic
1142518706 17:490204-490226 CTGCCCCGGGATGGGGGGCCCGG + Intergenic
1143030309 17:3963984-3964006 CGGCGCCGGGGCTGGGGGCTGGG - Intronic
1143030464 17:3964472-3964494 CCGCCCCGGGGAGGGAGTCCCGG - Intergenic
1143125602 17:4639493-4639515 GGGCCCCGGAGCCGGGGACGAGG - Exonic
1143150938 17:4807381-4807403 CGGGCCGGGGGCAGGGGTCCAGG - Intronic
1143319542 17:6059289-6059311 GGGCCCCGGAGAGGGGGCCCAGG + Intronic
1143402873 17:6657319-6657341 GGGCCCCGGAGCCGGGGACGAGG + Intergenic
1143487164 17:7261460-7261482 CGGCCCCGGGGCGCGGGGCACGG - Intronic
1143512808 17:7405434-7405456 CAGCCCCGGGGGGCGGGGCCGGG - Intronic
1143519679 17:7438233-7438255 CGGCCCGGGGGCGGGGCAGGGGG - Intergenic
1146058703 17:29593551-29593573 CGGCGCCGGAGCCGGGGCCCGGG - Exonic
1146329609 17:31916941-31916963 CAGCCCCGGTGCGGGGTCCCGGG - Intergenic
1146445290 17:32928083-32928105 CGGGCCGGGGGCCGGGGGCCGGG + Exonic
1146787347 17:35731777-35731799 CTCCCCCCGGGCGGGGGAGCCGG + Exonic
1146944854 17:36866726-36866748 CGGCCCCAGGGAGGGTGAGCTGG + Intergenic
1146945417 17:36870031-36870053 CGGCCCCAGGGAGGGTGAGCTGG + Intergenic
1147168629 17:38605792-38605814 CAGCCCCGGGGCGCGGTGCCAGG + Exonic
1147393125 17:40122209-40122231 GAGCTCCGGGGCGGGGGGCCGGG + Intergenic
1147629245 17:41919183-41919205 CGGGGCCGGGGCGGGGCCCCGGG + Intronic
1147643195 17:42017594-42017616 CCGCGCCGGGGCGGGAGCCCAGG + Exonic
1147967164 17:44199612-44199634 CGGCCCCGGGCCCTGGGCCCCGG - Intronic
1147987510 17:44315026-44315048 CTGCGGCGGGGCGGGGGACGGGG + Intronic
1148048719 17:44759087-44759109 CGGAGCCGGGGCGGGGGCGCGGG - Exonic
1148060027 17:44830005-44830027 CGGGCCAGGGGCGGGGTCCCAGG - Intronic
1148109471 17:45136573-45136595 AGAACCCGGGCCGGGGGACCAGG - Exonic
1148139248 17:45316846-45316868 CTGCTCCGGGGCGAGGGGCCAGG + Intronic
1148323703 17:46771701-46771723 CGGCGCCGGGGCCGGGGGCGCGG - Intronic
1149314022 17:55421945-55421967 GAGCCCCGGGGCGGAGGAGCCGG - Exonic
1150311077 17:64129963-64129985 CGGCCTCGGGGTGAGTGACCGGG - Exonic
1150675927 17:67245696-67245718 CGGCCCCGGGGCGGTTTCCCAGG - Intronic
1150983405 17:70169157-70169179 CGGCCCAAGAGCGGGGGAACCGG + Intronic
1151961360 17:77407663-77407685 AGGCCCTGGGGCGGAGGAGCAGG - Intronic
1152092462 17:78254535-78254557 CCGCCCTGGGCCGGGGGTCCAGG + Intergenic
1152212432 17:79009594-79009616 AGGCTCCGGGACGGGGGTCCGGG + Intronic
1152236577 17:79142233-79142255 CGGGCCAGAGGCCGGGGACCGGG - Intronic
1152552193 17:81035392-81035414 CGGCCCCGGGGCCGCGCGCCGGG + Intronic
1152748415 17:82051638-82051660 CGGGGCCGGGGCGGGGGTCCGGG + Exonic
1152817813 17:82418604-82418626 CGGCCCCTGGGCTGGCGGCCAGG + Exonic
1152924374 17:83080497-83080519 CGGGGCAGGGGCGGGGGGCCCGG - Intronic
1153226866 18:2906562-2906584 CGGCCCCGGGCAGGGGTCCCCGG + Intronic
1153290588 18:3498585-3498607 TGGCCTGGGGGTGGGGGACCTGG - Exonic
1153773399 18:8433098-8433120 CGGCGGCGGGGTGGGGGTCCAGG + Intergenic
1154501016 18:14998112-14998134 CGGCACCAGCGCGGGGGCCCCGG + Intergenic
1154940688 18:21110993-21111015 CAGCCGCGGGGCGGAGGAGCCGG + Exonic
1155055250 18:22176859-22176881 GGGCACCGGGGCTGGGGGCCGGG + Intronic
1155199349 18:23503587-23503609 CGCGCCCGCGGCGGGGGCCCCGG - Exonic
1157279106 18:46334197-46334219 CGGCTCCGGGGCGCGGGCGCGGG - Intronic
1157353987 18:46917111-46917133 CGGCGCGGGGGCGGCGGGCCTGG - Intronic
1157496719 18:48161846-48161868 CGGCCGCGGGGAGGGGCGCCCGG - Intronic
1157867267 18:51197438-51197460 AGGCGGCGGGGCTGGGGACCCGG + Intronic
1160024818 18:75208872-75208894 CGTCCCCGGGGAGCGGCACCGGG + Exonic
1160393940 18:78558554-78558576 CGGCCACGGGGGGCTGGACCTGG - Intergenic
1160745470 19:709168-709190 GGGCCGCGGGGCTGGGGGCCCGG + Intronic
1160794908 19:940832-940854 CTGCCCCGGTGGGGAGGACCAGG - Intronic
1160870229 19:1274593-1274615 CGGGCTCCAGGCGGGGGACCCGG - Intronic
1160873122 19:1285959-1285981 CGGCGGCGGGGCGGGGCGCCGGG - Intergenic
1161030930 19:2057498-2057520 GGGCTCCAGGGTGGGGGACCCGG - Intergenic
1161099895 19:2416383-2416405 CGGCTCCAGGGAGGAGGACCAGG - Intronic
1161101874 19:2425501-2425523 CCGCCCCGGCCCAGGGGACCAGG + Intronic
1161200022 19:3009483-3009505 GGGCCCAGGGGCTGGGGGCCGGG - Intronic
1161266363 19:3366523-3366545 CGGCCGCGGGGCGGGGGGGGGGG + Intronic
1161300117 19:3538442-3538464 CGGGACTGGGGAGGGGGACCTGG - Intronic
1161583773 19:5094339-5094361 AGGTCCCTGAGCGGGGGACCTGG + Intronic
1161812070 19:6476790-6476812 CCGCCCCGGGGGGCGGGACAAGG - Intronic
1162079313 19:8209204-8209226 CTGGCGCGGGGCGGGGGACTTGG - Intronic
1162099864 19:8333275-8333297 CGGCGCCGTGGTGGGGGAGCTGG + Intronic
1162100497 19:8335748-8335770 CGCCCCCGGCGGCGGGGACCGGG + Exonic
1162298261 19:9828138-9828160 CGGCCCTGGGACAGGGGACTTGG + Intronic
1162535835 19:11262466-11262488 CGGCGGCGGGGCCGGGGCCCGGG - Intronic
1162727064 19:12696144-12696166 GGGGCCGGGGGCCGGGGACCGGG - Intronic
1162756855 19:12865897-12865919 TGGCCCCGGGGCGGAAGACATGG + Intronic
1162914210 19:13865553-13865575 CAGCCCCGGGGCGGGCGCCCCGG + Intronic
1162940457 19:14006070-14006092 CGGCCCCGGGGTGGCTGGCCGGG - Intronic
1163255365 19:16152969-16152991 CGGCCCAAGGGCTGGGGACTTGG + Intronic
1163262277 19:16198337-16198359 CGGCGCCGGGGCCGGGGGCTCGG + Intronic
1163320566 19:16572319-16572341 GGGCCACGGCGCGGGGGGCCCGG - Exonic
1163438592 19:17310038-17310060 GGGCCCCGGGGCGGGGGAGGGGG + Intronic
1163508040 19:17719727-17719749 GGGCTCCGGGGCGGGGGTCGCGG + Intronic
1163635149 19:18434035-18434057 CCGCCCTGGGGCGCGGGTCCCGG - Intronic
1163677217 19:18661088-18661110 CGGCCCTGGGGCTGGGGAGCTGG + Intronic
1163698963 19:18777659-18777681 AGGCCCCGGGGCTGGGGGCGAGG - Exonic
1163701879 19:18790216-18790238 CCGCCCCGGGGCGGGGGGTGGGG - Intronic
1163708707 19:18832650-18832672 CGCGGCCGGAGCGGGGGACCCGG - Intronic
1163807237 19:19406402-19406424 CCGCTCAGGGGCGGGGGTCCGGG + Intronic
1164834702 19:31349719-31349741 CGGCCTAGGGGCGGGGGCCGGGG - Intergenic
1165129237 19:33621887-33621909 CGGGCCGGGGGCGGGGCGCCGGG + Intergenic
1165311266 19:35030620-35030642 GGGCCCCGGGGCTGGGCCCCCGG + Intergenic
1165471300 19:36006430-36006452 GGGCCCCAGGGCAGGGGACAAGG - Exonic
1165879468 19:39032174-39032196 CGGCTCCGGCGCGGGGACCCGGG + Exonic
1167257999 19:48442679-48442701 CGGCCGCGGCGCGGGGTACGCGG - Exonic
1167463853 19:49640040-49640062 CGGCCCCGGGGCGGGGGACCTGG - Exonic
1167709066 19:51099052-51099074 CTGGCCCGGGGCGGGGGCCTGGG - Exonic
1167781375 19:51601266-51601288 CTGGCCCGGGGCGGGGGCCTGGG + Intergenic
1168297304 19:55383740-55383762 CGGGCCCGGGGCGGCGGGCGCGG - Exonic
1168340707 19:55621684-55621706 CCGACCCGGGGAGGGGGACGGGG - Exonic
925927800 2:8682526-8682548 CGGCGGCGGGGCGGGGACCCCGG - Intronic
926891605 2:17643893-17643915 CGGCCCCGGGACAAGGGAGCCGG + Intronic
927154102 2:20211980-20212002 CGGCTCCCGTGCTGGGGACCTGG + Intronic
927713929 2:25341173-25341195 GCCCCGCGGGGCGGGGGACCCGG - Intronic
927714292 2:25342126-25342148 CGGCCCCGGCGCTGCGGAGCCGG + Intronic
927751325 2:25673276-25673298 CTGCGCCGGGACTGGGGACCCGG - Intronic
927787320 2:25982624-25982646 CGGCCCGGGTGCGGGGGACAGGG + Intronic
927809395 2:26173186-26173208 GGGCCCCGGGACGGCGGCCCCGG + Exonic
928303474 2:30147149-30147171 CGGCCCAGGGTGGGGGGCCCAGG + Intronic
929188673 2:39120666-39120688 TGGCCCCGGGGCGGTGGTGCGGG - Intronic
929780142 2:44952207-44952229 GGCCCCCGGGGCAGGGGTCCGGG + Intergenic
929966840 2:46542822-46542844 CGGGGCCGGGGCGGGGATCCGGG + Exonic
929966911 2:46542991-46543013 CGGGGCCGGGGCGGGGGCTCCGG + Exonic
929983187 2:46699483-46699505 CGGCGCGGGGGCCGGGGAGCAGG - Intronic
931252823 2:60549471-60549493 CAGGCCCGGGGCAGGGGCCCCGG + Intronic
932191137 2:69742191-69742213 GGGCTCCGGGCCGGGGGTCCTGG + Intronic
933666970 2:84971581-84971603 CGGGCCCGAGGCGCTGGACCCGG + Intronic
934566971 2:95346583-95346605 CGGCGCGGCGGCGGGGGTCCCGG - Intronic
935746426 2:106193853-106193875 CTGCCCGGGCGCGGGGGACTCGG - Intronic
937134916 2:119544376-119544398 ACGCCCCAGGGCGGGGGAGCCGG - Intergenic
937259404 2:120576096-120576118 GGGCCTCGGGGCCAGGGACCTGG - Intergenic
937438904 2:121900666-121900688 GGGCCCAGGGGCGGGGGACCAGG + Intergenic
937917787 2:127107330-127107352 CCGCCCCGGGGCGGTGCAGCTGG - Exonic
938018282 2:127885660-127885682 CGGTCCTGGGGCGAGGGTCCGGG - Intronic
938073085 2:128318584-128318606 CGGGCGCGGGGCGCGGGGCCTGG + Intergenic
938301121 2:130213696-130213718 CGGGGCCGGGGCGGGGATCCTGG - Intergenic
938364670 2:130725669-130725691 GGGCCCGGGGGCGGGGGGGCTGG + Intergenic
938455595 2:131460771-131460793 CGGGGCCGGGGCGGGGATCCTGG + Intergenic
938455668 2:131460943-131460965 CGGGGCCGGGGCGGGGGCTCCGG + Intergenic
938500187 2:131828301-131828323 CGGCACCAGCGCGGGGGCCCCGG + Intergenic
939629451 2:144516079-144516101 CGGCCCCGCGCCGGGTGATCGGG + Intronic
940353990 2:152718562-152718584 CGGACCCGGGGCGGGGCAGGTGG + Exonic
942241185 2:173964932-173964954 AGGCCCCGGGGCGGGCGGCCCGG - Intronic
944413476 2:199463086-199463108 CGGCCGCGGGCCGGGGGACCGGG + Intronic
946692607 2:222320249-222320271 CGCGCCGGGGGCGGGGGACGGGG - Intergenic
946921346 2:224584899-224584921 GGACCCCGGGGCCGGGGGCCGGG - Intronic
947506631 2:230712928-230712950 AGGCGCCGGGGCGGGGGCACAGG + Exonic
947915580 2:233830004-233830026 CAGCCCCGTGTCGGGGGACATGG + Intronic
948468620 2:238163881-238163903 CGGCCCCGGGGCCAGGGGCGCGG - Exonic
948479342 2:238240248-238240270 CGGCACCGGGGCGGCGACCCCGG + Intronic
948662267 2:239514951-239514973 TGGCCACGGGGCGGGGGAGGGGG - Intergenic
948824637 2:240568378-240568400 CGGGGCCGGGGCGCGGGGCCGGG - Intronic
948933715 2:241149264-241149286 GGGCGCAGGGGCGGGAGACCCGG + Intronic
949004281 2:241636812-241636834 CGGCCGGGGCGCGGGGGAGCGGG - Intronic
1168973587 20:1947541-1947563 CGGCCCTGGCGCAGGGAACCGGG + Intergenic
1169044443 20:2524729-2524751 CAGCGCCGGGGCTGGGGTCCGGG - Intergenic
1169080240 20:2794025-2794047 CCGCCCCCGGGGGGAGGACCTGG + Intergenic
1169214739 20:3786524-3786546 CCGCCCCGGGGCGGGGGGCCCGG + Exonic
1169235613 20:3927700-3927722 AGGCCCCCGGTCGGGGGAGCAGG - Intronic
1170578569 20:17681837-17681859 CGGACTCGGGGCGGGGGTGCCGG - Intronic
1170889125 20:20364437-20364459 CGGCCCGCGGGCGGGAGGCCCGG + Intergenic
1170889804 20:20367873-20367895 CGGCGCCGGGCGGGGCGACCAGG + Intergenic
1172044629 20:32071565-32071587 CAGCCCGGGGGCAGGGGACCTGG + Intronic
1172581327 20:36050877-36050899 CGGCCCGGGGCCGGAGGGCCTGG + Intergenic
1172618707 20:36306396-36306418 CGGAGCCGGGGCGGGGGCCGGGG + Exonic
1173840432 20:46153348-46153370 GGGCCTCGGGGTGGGGGACAGGG - Intergenic
1174403125 20:50286695-50286717 CAGCCCCCTGGCTGGGGACCTGG - Intergenic
1175408702 20:58752127-58752149 CGGACCAGGGGAAGGGGACCCGG + Intergenic
1175831052 20:61965736-61965758 AAGGCCCGGGGCGGGGCACCTGG - Intronic
1175847423 20:62065939-62065961 CGGCCGGGGGGCGGGGGAGCGGG + Intergenic
1175913055 20:62413758-62413780 CCGGCCCGGGGTGGGGGACGTGG + Intronic
1176121665 20:63456869-63456891 CCTCCCCGGGGCTGGGGACCTGG + Intronic
1176125360 20:63472541-63472563 CGGCTCCCGGCCGGGGGGCCTGG - Exonic
1176128965 20:63488219-63488241 CGGGGGCGGGGCGGGGGCCCGGG + Exonic
1176131078 20:63497117-63497139 CAGCCCTGGGGTGGGGGTCCTGG - Intronic
1176239073 20:64067655-64067677 AGGCCCAAGGGCTGGGGACCAGG - Intronic
1176284908 21:5014347-5014369 CGGCCGTGGGTCAGGGGACCTGG - Intergenic
1176549491 21:8214997-8215019 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
1176557386 21:8259226-8259248 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
1176568416 21:8398031-8398053 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
1176576328 21:8442261-8442283 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
1176856987 21:13981374-13981396 CGGCGCCGGGGTGGGGGGACTGG - Intergenic
1176867610 21:14062849-14062871 CGGCGCCGGGGTGGGGGGACTGG + Intergenic
1178436648 21:32565821-32565843 GGTCCCCGGTGAGGGGGACCTGG - Intergenic
1178753175 21:35323608-35323630 GTGCCCCGGGGCGGGGGGCAGGG - Intronic
1178865185 21:36320717-36320739 CGTCCCGGGGGCGGGGGGACGGG + Intronic
1179794784 21:43776464-43776486 GGGGCGCGGGGCGGGGAACCTGG + Intergenic
1179872273 21:44249128-44249150 CGGCCGTGGGTCAGGGGACCTGG + Intronic
1180161440 21:46000235-46000257 GGGCCCCAGGGAGGGTGACCTGG + Intronic
1180843771 22:18970830-18970852 CGGCCCCGGGAGGGCGGAGCCGG + Intergenic
1181026741 22:20131522-20131544 CGGCTCCGCGGCCCGGGACCAGG + Intronic
1181057702 22:20267876-20267898 CGGCCCCGGGAGGGCGGAGCCGG - Intronic
1181094471 22:20495961-20495983 CGGCCCTGGGGCGGGGAGACAGG + Intronic
1181395543 22:22618642-22618664 CAGCCCCGGGCTGTGGGACCAGG + Intergenic
1183780379 22:39995314-39995336 CGGCGCCGGCGCGGGGGCCTTGG - Exonic
1183956347 22:41382473-41382495 TGGCCCCGGGGGAGGGGCCCTGG - Intronic
1184153056 22:42649439-42649461 CGGGCGCGGGGGCGGGGACCGGG + Intronic
1184334487 22:43845237-43845259 TGGCCTGGGGGCAGGGGACCAGG - Intronic
1184347746 22:43923884-43923906 CGGCGGCGGGGCGGGGGCGCGGG - Exonic
1184369962 22:44075996-44076018 TGGCCGTGGGGCAGGGGACCTGG + Intronic
1184523629 22:45009359-45009381 CTGCCCGGGGGCGGGGGGCGAGG - Intronic
1184557362 22:45240625-45240647 CGGCCTCGGTGAGTGGGACCCGG - Intronic
1184662532 22:45972042-45972064 AGGCCCCTGGGCGGGGCACCGGG - Intronic
1184679420 22:46062080-46062102 CGGCCCCGGGGCGGGAGGTGCGG - Intronic
1184698016 22:46150536-46150558 CGGCCCCGCGGCGGGGGCAGCGG + Intronic
1184820381 22:46905536-46905558 CGGCCCCGGGGAGGAGGGCACGG + Intronic
1184853979 22:47136546-47136568 AGACCCGGGGACGGGGGACCAGG + Intronic
1185068582 22:48644222-48644244 GGGGCCCCGAGCGGGGGACCAGG + Intronic
1185217464 22:49609672-49609694 CGTCCACGGGGCGGGAGGCCTGG + Intronic
1185386031 22:50531669-50531691 CGGCCCCGGGCCAGGCCACCTGG - Exonic
1185398444 22:50604198-50604220 CGGCTCCGAGGCGGGCGACGAGG - Exonic
1185413437 22:50697583-50697605 GGGCCCCGGGGCGGCGGTGCGGG - Intergenic
1203254378 22_KI270733v1_random:131319-131341 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
1203262434 22_KI270733v1_random:176398-176420 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
950084663 3:10248757-10248779 CGGCCCCGGGGCCGCGGATCCGG + Exonic
953326107 3:42013713-42013735 GGGCCCCGGGGCGGCGGGCGGGG - Intergenic
953464245 3:43105553-43105575 GGGGCCGGGGGCCGGGGACCTGG - Intronic
953484957 3:43286546-43286568 CGGCCGCGGGGAGGGGGTGCCGG - Exonic
953909187 3:46883206-46883228 CGGGCCGGGGGCGGGGGGCCCGG + Intronic
954004157 3:47578665-47578687 CGAGCCGGGGGCGGGGGCCCGGG - Exonic
954174254 3:48831070-48831092 TGGCCCAGGGGGTGGGGACCCGG + Intronic
954200447 3:49020738-49020760 TGGCCCCAGGGCGAGTGACCTGG - Intronic
954277962 3:49554674-49554696 CGGGGCCGGGGCCGGGGCCCGGG - Exonic
955298732 3:57757011-57757033 CCGCCCCGGGAAGGGGGACGCGG - Exonic
956678128 3:71754012-71754034 CGGCCCCGGGGCGGAGCGCACGG + Intronic
956761369 3:72447439-72447461 CGGCTTCGGGGCCGGGGTCCCGG - Intergenic
957054681 3:75434858-75434880 AGGCCCCAGGGACGGGGACCGGG + Intergenic
958641535 3:96813499-96813521 CGGCCCTGGGGCGGGGGCCGCGG + Intergenic
960586119 3:119322866-119322888 CGGCCCGGCCGCGGGGGTCCCGG + Intronic
961300164 3:125916855-125916877 AGGCCCCAGGGATGGGGACCGGG - Intergenic
961506009 3:127371012-127371034 GGGGCCGGGGGCTGGGGACCAGG - Intergenic
961754789 3:129121456-129121478 GGGCCCAGGCCCGGGGGACCCGG - Exonic
961888341 3:130111219-130111241 AGGCCCCAGGGACGGGGACCGGG + Intronic
963040399 3:141066008-141066030 GGGCCACGGGGCTGGGAACCAGG - Exonic
963082017 3:141402791-141402813 CGCTCCCGGGGCTGGGGACGTGG + Intronic
967055447 3:185825463-185825485 CGGCCCCGGGCTGGGGCTCCGGG + Intergenic
967859716 3:194141652-194141674 GGGGCCCGGGGCGGGGGAAGCGG - Intergenic
968026041 3:195443120-195443142 CGGCCAAGGGGCGGGGCATCCGG + Intergenic
968213340 3:196867795-196867817 CGGCCCCGGGTCGGGAGGCGGGG + Intergenic
968372783 4:11132-11154 CGGCGCCGGGGCGGGGGTCGGGG + Intergenic
968372796 4:11181-11203 CGGCGCCGGGGCGGGGGTCGCGG + Intergenic
968479256 4:826369-826391 CGGACCCGGGGCGGGGGCGGGGG + Intergenic
968591110 4:1460096-1460118 TGGCCCTGGGGCTGGGGTCCTGG + Intergenic
968775171 4:2536132-2536154 CGGCACCTGGGCGGCGGACAGGG + Intronic
968809281 4:2792866-2792888 CGGCCCCGGGACGAGGCCCCTGG - Intergenic
968958477 4:3730701-3730723 GGGCCCCAGGGCGGGGGTGCCGG + Intergenic
968997493 4:3955166-3955188 AGGCCCCAGGGACGGGGACCGGG + Intergenic
969053327 4:4387303-4387325 CGGCCCCAGGACCGGGGACCGGG + Intronic
969248866 4:5954292-5954314 CAGCCCCGGGGCTGGGTCCCTGG - Intronic
969344747 4:6563687-6563709 CGGGCCCGGGGCGGGGGGCGGGG + Intergenic
969656075 4:8499279-8499301 CGGCCCAGGGCAGGGGGCCCAGG - Intergenic
969756524 4:9153527-9153549 AGGCCCCAGGGACGGGGACCGGG - Intergenic
973996829 4:56467300-56467322 CGGCCCCGCACCGTGGGACCAGG + Exonic
978754302 4:112286006-112286028 CGGCCAGGGGGCTGGGTACCTGG - Intronic
978903410 4:113979563-113979585 CGGCCGCGGGGCTAGGGACCCGG - Exonic
978954591 4:114598699-114598721 CGGCTGGGGGGCGGGGGGCCTGG + Exonic
979624273 4:122827588-122827610 CGGCTCCGGGCCGGGGGTACTGG - Intronic
980075153 4:128287243-128287265 CGGCCGAGGCGCGGGGGTCCCGG + Intronic
981929881 4:150177910-150177932 GGGCACTGGGGCTGGGGACCAGG + Intronic
982257663 4:153466317-153466339 CGGGCCCGGGGCGAGGCAGCTGG + Intergenic
984795871 4:183659425-183659447 CGGGCCCGGGGCGTGGGGCCTGG + Exonic
985129657 4:186726761-186726783 CGCGCCCGGGGCGGGGGGCGAGG - Intergenic
985462611 4:190121434-190121456 CGGCGCCGGGGCGGGGGTCGGGG - Intergenic
985696614 5:1344652-1344674 CGTCCGCGGGGCCGGGGGCCGGG - Intronic
985714276 5:1446602-1446624 CAGCCCCGGAGCCGGGGAGCGGG - Intergenic
985769400 5:1799550-1799572 CGACCCCGGGGCGGGAGAACTGG - Intronic
986392040 5:7296076-7296098 CAGCCCTGGGGTGGGGGACACGG + Intergenic
988482037 5:31639191-31639213 CGGCCCCGGGCAGCGGGACGCGG + Intergenic
989178778 5:38556384-38556406 CAGCCCCGGGGCGGCGGCCGAGG - Intronic
992530093 5:77645222-77645244 CGGGCGGGGGGCGGGGGCCCGGG - Intergenic
992813082 5:80408417-80408439 CGGCCCGGGAGCGGGGAACCGGG - Intronic
993386346 5:87267761-87267783 CGGAGCGGGGGCGGGGGGCCGGG - Intergenic
995106435 5:108381697-108381719 AGGCCCCGAGGAGGGGGACCGGG + Exonic
995725659 5:115178866-115178888 TGGCCCCAGGGCTGGGGAGCTGG - Intronic
996091471 5:119355942-119355964 CCTCCCCGGGGCGGGAGAGCGGG - Intronic
998119160 5:139561750-139561772 CGGCCCCCGGGGCGGGGACGGGG - Exonic
999300111 5:150485874-150485896 GCGCCCCGGGGCGGGGGCCGGGG - Intronic
1001395896 5:171419587-171419609 CGGCGAGGGGGCGGGGGGCCGGG - Intergenic
1001431830 5:171668093-171668115 CGGCCTCGGGGCGGGCGTCCGGG + Intergenic
1002046318 5:176543446-176543468 CGGGGCCGGGGCGGGGGTCCTGG - Intronic
1002160721 5:177312526-177312548 CGGCGGAGGGGCGGCGGACCCGG + Intronic
1002184298 5:177447073-177447095 CGCGGCCCGGGCGGGGGACCGGG - Intronic
1002460768 5:179372499-179372521 GGGCCCCGGGGAAGGGGAGCAGG + Intergenic
1002598268 5:180338454-180338476 CCGCCTCGTGGCTGGGGACCGGG - Intronic
1002897664 6:1389094-1389116 CGGCCCTGGGGAGGGCGGCCAGG + Intergenic
1002928729 6:1619642-1619664 CTGCACCGGGGCGGGGGAGGGGG - Intergenic
1002980091 6:2127684-2127706 GGCCCCCTGGGCTGGGGACCAGG - Intronic
1003212263 6:4078888-4078910 GGGCCTCGGGGCGGCGCACCGGG - Exonic
1003345191 6:5260593-5260615 GGGGCCAGGGGCCGGGGACCGGG - Intronic
1003345199 6:5260607-5260629 GGGGCCGGGGGCGGGGGGCCAGG - Intronic
1003425751 6:5997229-5997251 GGGCCCCGGGGGGGGGGGACGGG - Intergenic
1004720561 6:18264603-18264625 CGGGCGCGGGGCGGGGGAGGCGG + Exonic
1006155201 6:32009929-32009951 CGGGCCCGGGGCCGGGGGCTGGG - Intergenic
1006161507 6:32042663-32042685 CGGGCCCGGGGCCGGGGGCTGGG - Intronic
1006450719 6:34104263-34104285 CTTCCCCGGGGCTGGGGACATGG + Intronic
1006535614 6:34696656-34696678 CGCCGCCGGGCCCGGGGACCTGG + Exonic
1006770301 6:36547422-36547444 CGTCTCCGCGGCGGGGGACCGGG - Exonic
1007479762 6:42142307-42142329 AGGCCCCGGAGGAGGGGACCGGG - Exonic
1007783040 6:44265067-44265089 GGGCCCCGAGGCTGAGGACCCGG - Exonic
1009975638 6:70667999-70668021 CGGCAGCGGGGCGGGGAGCCTGG - Exonic
1013033676 6:106360565-106360587 CGCCCCCGGGGTGGGGAGCCGGG + Intergenic
1013225584 6:108117847-108117869 CGGCCTCGGGGCGGTGGGGCAGG - Intronic
1016590162 6:145735348-145735370 CGGCACCGCGGCGGGCGACGGGG - Exonic
1016937253 6:149456612-149456634 GGGCGGCGGGGCGGGGGGCCGGG - Intronic
1018150285 6:160931182-160931204 GGGGCCCGGGGCGGGGGCGCGGG + Intergenic
1018628726 6:165804785-165804807 CGGCCCCGGGGCCGGGCCGCGGG + Intronic
1018742956 6:166744377-166744399 CGGCCCCGGGCCCGGGGAGTCGG + Intronic
1018854478 6:167665858-167665880 AGGCCCAGGGGCTGGTGACCAGG - Intergenic
1018935581 6:168271862-168271884 CTGTCCCGGGGCGAGGTACCTGG - Intergenic
1019630903 7:2049333-2049355 CTGACCCTGGGCGGGGCACCGGG - Intronic
1019750998 7:2729671-2729693 CGGCCTCGGGACGAGGGCCCTGG + Exonic
1020134741 7:5580918-5580940 GGGCCCAGGTGCGGGAGACCTGG - Intergenic
1020136888 7:5592695-5592717 GGGCCCCGGGCCGAGGGACCCGG - Intergenic
1020274329 7:6615599-6615621 CGGGCCGGGGGCGGGGGCGCGGG - Exonic
1022943583 7:35261279-35261301 CTGCCGCGGGGCGGGGGAGAAGG + Intergenic
1023842276 7:44104322-44104344 GGGGCCCGGGGCGGGGGCGCCGG - Intergenic
1023850281 7:44146295-44146317 GGGGCCCGGGGCGGGGCACAGGG - Intronic
1023863586 7:44228681-44228703 CGGCGCCGGGGCAGGGTAGCTGG + Intronic
1023990673 7:45126443-45126465 GGGCCTCGGGGCGGGGGGCAGGG + Intergenic
1024520956 7:50304067-50304089 CGGGCCCGGCGCGGGCGAGCGGG + Intergenic
1025028246 7:55535512-55535534 TGGCTGCGGGGCGGGGGACTGGG - Intronic
1025695288 7:63771541-63771563 CAGCCCCGAGGCGGGGAGCCTGG + Intergenic
1025777380 7:64570560-64570582 CGGCCCGGGGTCGGGGGAGGGGG + Intergenic
1025940860 7:66075633-66075655 CGGCCCCGGGGCGGGGAAGCGGG - Intergenic
1026787866 7:73313160-73313182 CGGCCACGGGCAGGGGTACCCGG + Exonic
1026806710 7:73433727-73433749 AGCCCCCGGGGCGGGGCTCCGGG - Intergenic
1029248615 7:99220374-99220396 CAGCCCCAGGGCTGGGGAGCAGG - Intergenic
1029270530 7:99374638-99374660 AGGGCCCGGGGGCGGGGACCTGG - Intronic
1029445943 7:100612835-100612857 GGCCCCCTGGGCGGGGGTCCCGG + Exonic
1029701455 7:102249050-102249072 CGGCCCTGGGGCGGGCAGCCAGG + Exonic
1029741536 7:102494220-102494242 CGGCACCGGGGTGGGGTATCCGG - Intronic
1030304314 7:108003278-108003300 GCGCCCCGGGGGGTGGGACCGGG - Intergenic
1030347904 7:108455095-108455117 GGGCCCCGGGGCTGGCGAACAGG - Intronic
1031043575 7:116862989-116863011 CTCCGCCGGGGCCGGGGACCGGG + Intronic
1033165616 7:139036163-139036185 CGGCCCCGGCGCGTGGAAGCAGG + Intergenic
1033253182 7:139777781-139777803 CGGCGCCGGGGGAGGGGGCCGGG + Intronic
1033253203 7:139777837-139777859 CGGGCCCGGCGCGGGGGGCTCGG + Intronic
1034159513 7:148982754-148982776 CGGCCCAGGGCTGGGGGCCCAGG + Intergenic
1034222891 7:149459855-149459877 CGGCCCCGAGGTGGGGCGCCCGG - Intronic
1034434760 7:151058146-151058168 CGGCGCCGCGGCGGGGCGCCCGG - Exonic
1034461274 7:151199310-151199332 CGGCCGCGGGGCGGGGGTGCAGG - Intronic
1034977560 7:155457372-155457394 CGCACCCGGAGCGGGGGACGCGG + Intergenic
1035464180 7:159064249-159064271 TGGCTCCGGGGCAGGGGACCGGG - Intronic
1036184333 8:6611502-6611524 AGGGCCCGGGGCCGGGGAGCAGG + Intronic
1036379761 8:8228835-8228857 AGGCCCCAGGGACGGGGACCGGG - Intergenic
1036723897 8:11201609-11201631 CAGCTGCTGGGCGGGGGACCGGG + Intergenic
1036788905 8:11704867-11704889 CGCCCTCGGGGCTGGGGTCCAGG + Intronic
1036849804 8:12193817-12193839 AGGCCCCAGGGACGGGGACCGGG + Intronic
1036871168 8:12436090-12436112 AGGCCCCAGGGACGGGGACCGGG + Intronic
1037901562 8:22692172-22692194 CGATCCCGGGGCCGGGGAGCTGG - Intronic
1038633002 8:29263124-29263146 CGGAGCCGGGGGTGGGGACCGGG + Intronic
1038761126 8:30384798-30384820 CGGGCCCCGGGAGGGCGACCTGG - Exonic
1038798279 8:30727991-30728013 CGCCACCGGGGCGGGGAACTGGG - Intergenic
1040592194 8:48803817-48803839 CTGCCCTGGAGCGGGGGACCAGG + Intergenic
1040850717 8:51898708-51898730 CGGGCCGGGGGCGGAGGACTTGG - Intronic
1041059384 8:54021908-54021930 CGTCCCCGGGGAGGGTGTCCGGG - Intronic
1041689785 8:60678306-60678328 CTGCCCCGGGGCGGCGCACCCGG + Intergenic
1043873876 8:85463925-85463947 CGGCCCGGGGGAGGGGGCTCGGG - Exonic
1045432048 8:102123810-102123832 CGGGGCCGGGGCCGGGGGCCGGG - Intronic
1047024512 8:120811612-120811634 GGGCGCCGGGGCTGGGCACCCGG - Exonic
1047330879 8:123885744-123885766 TGGGCCAGGGGCGGGAGACCTGG + Intronic
1049370424 8:142261658-142261680 CGGCCCCGGGGTGGGGGTGCAGG + Intronic
1049409125 8:142464667-142464689 CGGCCCCGGGCCGGGCCGCCGGG + Exonic
1049419470 8:142510561-142510583 CGGGCCGGGGGCGCGGGCCCCGG + Intronic
1049508996 8:143018469-143018491 CGGCCCCGGGGCGGGGGCAGGGG - Intronic
1049548907 8:143247263-143247285 CGGCCTCGGGGCCGGCGCCCGGG - Exonic
1049588059 8:143440983-143441005 GGGCCCTGGGGCGGGGGACGTGG + Exonic
1049746900 8:144266791-144266813 CGGGCCGGGGGCGGGGGGCCAGG + Exonic
1049762281 8:144336917-144336939 CGGGCGGGGGGCGGGGGTCCTGG + Intergenic
1049844195 8:144792202-144792224 CGGCCTCGGGGGCGGGGTCCCGG - Intronic
1049936314 9:504597-504619 CGCCGCCGGGGCGGGGAAGCCGG - Intronic
1049973620 9:842006-842028 CGGCTCCGGGGCGTCGGACCTGG + Exonic
1051896791 9:21995844-21995866 AGGCTCCGGGTCGGGGCACCGGG - Intronic
1053163486 9:35829316-35829338 CGGGGCGGGGGCCGGGGACCTGG - Intronic
1053163489 9:35829322-35829344 CGGGCCCGGGGCGGGGGCCGGGG - Intronic
1053381187 9:37650823-37650845 CTCCCCCGGGGCGGGGGTCGCGG + Intronic
1055654924 9:78442177-78442199 CTGCCCCGGGGCGGTGGCGCCGG - Intergenic
1056219136 9:84434220-84434242 TGGCCTCAGGGCTGGGGACCTGG - Intergenic
1057665202 9:97039225-97039247 CGGCCACTGGGCGGGGCCCCGGG + Intronic
1059305350 9:113349596-113349618 CGGAGCCGGGGCCGGGGTCCGGG + Exonic
1059769854 9:117414887-117414909 CGGCCCCGGCTCGGGGCTCCGGG - Exonic
1060148025 9:121268512-121268534 CGCCCCCGGGATGGGGGAACTGG + Intronic
1060200939 9:121651563-121651585 CGGCCCCGCGGCGGGGGCTGGGG - Intronic
1060209096 9:121699477-121699499 GGGCGGCGGCGCGGGGGACCGGG - Intronic
1060283478 9:122228854-122228876 CGGGCCCGGGGCGGCGGGGCCGG - Intronic
1060555187 9:124504428-124504450 CTCCCCCGGGGAGGGGGTCCCGG - Intronic
1060789802 9:126478408-126478430 CTGCCCCTGGGCTGGGGACCTGG + Intronic
1061261504 9:129483005-129483027 CGGGCCCAGGGCGGGGGAGCAGG + Intergenic
1061299628 9:129697317-129697339 CGGCCTAGGGGAGGGGGAGCGGG - Intronic
1061570881 9:131476805-131476827 CGGCCCCTCGGCGGGGCTCCAGG - Intronic
1061680714 9:132241316-132241338 CGACCCGGGGGCGGTGGACGGGG + Intronic
1061947681 9:133917895-133917917 GGGGACCAGGGCGGGGGACCAGG - Intronic
1061961783 9:133992398-133992420 CGGCGGCGCAGCGGGGGACCTGG - Intronic
1061987155 9:134136353-134136375 AGGGGCCGGGGCGGGGGTCCCGG - Intronic
1062008085 9:134251555-134251577 CGGCCCCGGGGCCGGGAGCCAGG - Intergenic
1062015018 9:134287043-134287065 TGGCCCCGGGGCAGGGGACAGGG + Intergenic
1062279835 9:135746982-135747004 CTGCCTCGGGGAGGGGGAGCCGG + Intronic
1062305841 9:135906938-135906960 CGGGCCGGGGCCGGGGGACGCGG - Intronic
1062325459 9:136010489-136010511 CTGGCCCTGGGCGGGGGAGCAGG + Exonic
1062353328 9:136149692-136149714 CTGCCCTGTGGAGGGGGACCTGG + Intergenic
1062353430 9:136150141-136150163 CAGCCCCGGGGCTGGGGCCCTGG + Intergenic
1062499521 9:136846276-136846298 CGGCGCCAGCGCGGGGGCCCCGG - Exonic
1062532844 9:137009314-137009336 CGGGCCCGGGGGGGGCGGCCAGG - Intronic
1062624391 9:137436321-137436343 CGGCCCCGGGGAGGGGCACAGGG - Intronic
1062624431 9:137436425-137436447 CGGCCCCGGGGAGGGGGCACAGG - Intronic
1062696341 9:137877991-137878013 CGGGCCCGGGGCGGCGGGGCCGG + Exonic
1062718581 9:138023320-138023342 GACCCCCGCGGCGGGGGACCAGG + Exonic
1062718678 9:138023623-138023645 CGGCCCCCGAGCGGGGCCCCGGG + Exonic
1203787629 EBV:136690-136712 CGGGCCCGCGGGCGGGGACCCGG + Intergenic
1203732016 Un_GL000216v2:99281-99303 TGGGACCGGGGCGGGCGACCGGG + Intergenic
1203470779 Un_GL000220v1:114463-114485 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
1203478600 Un_GL000220v1:158435-158457 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
1185466490 X:358140-358162 CGTCCCCTGGGCCGGGGGCCCGG + Intronic
1185874484 X:3691417-3691439 CTCCCCCGGGGCGGGGGGACTGG - Intronic
1186426087 X:9465193-9465215 CGGCGGCGGGGCGGGGGCGCTGG - Exonic
1190214900 X:48473650-48473672 TGGCCCAGGGGCAGGGGACTAGG - Intergenic
1190385625 X:49879948-49879970 CGGGGCCGGGGCGGGGGCCGGGG - Exonic
1190745787 X:53321129-53321151 CGGCCCAGGGGCAGGGGAACGGG + Exonic
1190984458 X:55488602-55488624 CGGGCCCGGGGCTGGGGCCGAGG + Exonic
1195278913 X:103310727-103310749 CGGTCCCGCGGCGGGGCCCCGGG + Exonic
1197728658 X:129792882-129792904 CTGCCCCAGGGATGGGGACCAGG + Intronic
1197745968 X:129932398-129932420 CGGCCGCGGGGCGGGGCGCTGGG - Intergenic
1198517563 X:137425036-137425058 GGGCCCGGGGGCGGGGGGCGGGG + Intergenic
1200057721 X:153470408-153470430 CCACTCCAGGGCGGGGGACCGGG - Intronic
1200121973 X:153795352-153795374 CAGCCCCGGGCCCGGGGGCCAGG + Intronic
1200173657 X:154097316-154097338 CGCCCGCGGGGCCGGGGGCCGGG + Intronic