ID: 1167464913

View in Genome Browser
Species Human (GRCh38)
Location 19:49645599-49645621
Sequence CAGTGCTGGGAGAGGGCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1043
Summary {0: 1, 1: 2, 2: 12, 3: 132, 4: 896}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167464901_1167464913 27 Left 1167464901 19:49645549-49645571 CCTGTAGCTGCCTTGGAAGGGCC 0: 1
1: 0
2: 1
3: 10
4: 160
Right 1167464913 19:49645599-49645621 CAGTGCTGGGAGAGGGCAGGAGG 0: 1
1: 2
2: 12
3: 132
4: 896
1167464900_1167464913 28 Left 1167464900 19:49645548-49645570 CCCTGTAGCTGCCTTGGAAGGGC 0: 1
1: 0
2: 0
3: 13
4: 172
Right 1167464913 19:49645599-49645621 CAGTGCTGGGAGAGGGCAGGAGG 0: 1
1: 2
2: 12
3: 132
4: 896
1167464906_1167464913 6 Left 1167464906 19:49645570-49645592 CCTAGTGTGCAGTGGAAGGGAGA 0: 1
1: 0
2: 2
3: 27
4: 313
Right 1167464913 19:49645599-49645621 CAGTGCTGGGAGAGGGCAGGAGG 0: 1
1: 2
2: 12
3: 132
4: 896
1167464902_1167464913 17 Left 1167464902 19:49645559-49645581 CCTTGGAAGGGCCTAGTGTGCAG 0: 1
1: 0
2: 0
3: 11
4: 164
Right 1167464913 19:49645599-49645621 CAGTGCTGGGAGAGGGCAGGAGG 0: 1
1: 2
2: 12
3: 132
4: 896

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167464913 Original CRISPR CAGTGCTGGGAGAGGGCAGG AGG Intronic
900204698 1:1427012-1427034 CAGGGCGGGGAGAGGGGAGGGGG - Intronic
900266371 1:1759289-1759311 TACTGCACGGAGAGGGCAGGGGG + Intronic
900266383 1:1759346-1759368 TACTGCACGGAGAGGGCAGGGGG + Intronic
900339029 1:2179117-2179139 CAGTGCAGGGGCAAGGCAGGTGG - Intronic
900493129 1:2962765-2962787 GGGCGCTGGGAGGGGGCAGGAGG + Intergenic
900525066 1:3124594-3124616 CAGGCCTGGGACATGGCAGGTGG - Intronic
900531855 1:3157825-3157847 CGGTGCTGGGGGAGGCCAGATGG - Intronic
900838870 1:5031060-5031082 CGGCGCTGGGAGAAGGCAAGGGG - Intergenic
900884945 1:5408541-5408563 AGCTGCTGGGAGAGGGCAGGAGG - Intergenic
900951041 1:5858457-5858479 CAGGGCTGTGCCAGGGCAGGGGG - Intergenic
900991546 1:6100468-6100490 CAATGGTGCCAGAGGGCAGGTGG + Exonic
901239236 1:7683451-7683473 CGGAGGTGGGAGAGGGTAGGTGG - Intronic
901390700 1:8943990-8944012 CAGGGCTGGGAGTCAGCAGGTGG + Intergenic
901405210 1:9040512-9040534 TAGAGCTGGGAGTGGGCAGTTGG - Intronic
901621480 1:10591840-10591862 CTGTGCTGGGCAGGGGCAGGGGG - Intronic
901641708 1:10695932-10695954 GAGCGCTGGGAGAGGCGAGGAGG - Intronic
901784251 1:11614124-11614146 CAGCGTCAGGAGAGGGCAGGGGG - Intergenic
902183128 1:14704765-14704787 CAGTGCAGAGACATGGCAGGAGG + Intronic
902332729 1:15738451-15738473 CAGGGCTGGGGGATGGCTGGAGG + Intronic
902348357 1:15835556-15835578 CAGCACGGGGAGAGGGCAGGGGG - Intergenic
902658829 1:17887431-17887453 GGGGGCTGGGAGAGGGGAGGAGG + Intergenic
902779563 1:18695817-18695839 CAGTCATGGGAGAGGCCATGGGG - Intronic
902816709 1:18920654-18920676 AAGGCCTTGGAGAGGGCAGGTGG - Intronic
903169216 1:21541710-21541732 TAGGGTAGGGAGAGGGCAGGGGG + Intronic
903173928 1:21569662-21569684 CATTGCTAAGAGAAGGCAGGGGG + Intronic
903255055 1:22091684-22091706 TAGTACTGGGAGGGGGAAGGGGG - Exonic
903280063 1:22245250-22245272 CAGTGCAGGAGGAAGGCAGGGGG + Intergenic
903588776 1:24438459-24438481 CAGGGACGGGAGAGGGCAGGAGG - Intronic
903953903 1:27012135-27012157 CCTGGCTGGGAGAGGGGAGGAGG - Intronic
904355070 1:29933566-29933588 CAGGGATGGGTCAGGGCAGGTGG + Intergenic
904455710 1:30646901-30646923 CAGGGCTGTGGGAGGGGAGGTGG + Intergenic
904492995 1:30871765-30871787 CAGGGCAGGGAGGGGGCATGTGG - Intronic
904495806 1:30885968-30885990 GAGTGACGTGAGAGGGCAGGTGG - Intronic
904749753 1:32734190-32734212 CAGTGCTGGGATGGGGTGGGTGG + Intergenic
904840807 1:33370733-33370755 CAGAGATGGGACAGGGCTGGGGG - Intronic
905013228 1:34760768-34760790 CAGGGCTGGGCCAGGGCAGGAGG - Intronic
905158359 1:36008345-36008367 TTATGCTGGGAGAGGGAAGGAGG - Intronic
905336381 1:37247552-37247574 GAGTGCTGGGGGATGGCGGGAGG + Intergenic
905464081 1:38139699-38139721 CAGTGCTGGGGGAGTACAGGGGG - Intergenic
905642062 1:39596816-39596838 AAGTGTGGGGAGAGGCCAGGAGG - Intergenic
905919521 1:41710206-41710228 CCATGCTAGGAGAGGGGAGGTGG - Intronic
906403237 1:45521266-45521288 CAGTGCTGGGGAGGGACAGGGGG - Intronic
906929488 1:50155325-50155347 CAGTGGTGGGAGAGGGTGTGGGG - Intronic
907301682 1:53490805-53490827 CAGGGTTGGGGGAGGGCAAGAGG - Intergenic
907407107 1:54260395-54260417 CAGTGGTCAGGGAGGGCAGGAGG + Intronic
910028684 1:82689286-82689308 TGGTGCTGGAAGAGGGCAGGAGG + Intergenic
910280472 1:85495037-85495059 CAGTTCCAGCAGAGGGCAGGCGG + Intronic
911082659 1:93949212-93949234 CAGAGGAGGGAGAGGGCAAGGGG + Intergenic
912008686 1:104933516-104933538 CCGTGCTGGCAGAGGGCGGGAGG - Intergenic
912681472 1:111731965-111731987 CGTGGCTGGGAGTGGGCAGGAGG - Intronic
912799239 1:112710972-112710994 TAGAGGTGGGAGAGGGGAGGAGG - Intronic
913169589 1:116220349-116220371 CAAAGCTGGGAGAGGGAAAGTGG - Intergenic
915053513 1:153103142-153103164 CAGTGTTAGGAGTGAGCAGGTGG - Intronic
915148193 1:153808110-153808132 AAGTGGTGGGAGAGGGAGGGGGG - Exonic
915280596 1:154819739-154819761 CAGGGCTGGGCCAGAGCAGGAGG + Intronic
915597936 1:156905973-156905995 CTGTCCAGAGAGAGGGCAGGTGG - Intronic
916783767 1:168067022-168067044 CTGGGATGGGAGAGGGAAGGTGG + Intronic
916792616 1:168137005-168137027 CAGTGCGGGGCGCGGGGAGGCGG - Intronic
918284915 1:183042800-183042822 CAGTGCCAGGAGAGGGCTGGGGG - Intronic
919168720 1:193927604-193927626 CAGCGCTGGCAGAGAACAGGAGG + Intergenic
919483942 1:198122888-198122910 CTTTGCTGGCAGAGGGTAGGAGG + Intergenic
919854946 1:201698794-201698816 CAGGAGTGGGAGTGGGCAGGTGG + Intronic
920832972 1:209481904-209481926 CTGTGCTGGGAAGGGGCTGGGGG - Intergenic
921404611 1:214765138-214765160 CAGTGTAGGGAGGGAGCAGGTGG + Intergenic
921514248 1:216070128-216070150 CAGCACTGGCAGAGGGCATGCGG + Exonic
921565493 1:216712571-216712593 CAGTGCTGGGAGGCAGCAGCAGG - Intronic
922440514 1:225652589-225652611 CCGGGCCGGGAGAGGGAAGGCGG + Intronic
922804147 1:228377074-228377096 CAATGCTGGGAGAAGGCCAGCGG + Exonic
923015839 1:230126226-230126248 CTGTGCTAGGAGAGGGCTGTAGG + Intronic
923238506 1:232058180-232058202 CAGAGAGGGCAGAGGGCAGGAGG - Intergenic
924309024 1:242720810-242720832 CAGTCCTGGCAGAAGGCAGAAGG - Intergenic
924632993 1:245760011-245760033 TAGTGACAGGAGAGGGCAGGAGG + Intronic
1062903824 10:1166367-1166389 GGGTCCTGGGAGAGGGGAGGAGG + Intergenic
1062960562 10:1570620-1570642 CACTGCTGTGACAGGCCAGGGGG - Intronic
1063309936 10:4942685-4942707 TTGGGCTGGGAGAGGGGAGGTGG + Intronic
1063410427 10:5832953-5832975 CACTGGTGGGATGGGGCAGGGGG - Intronic
1063604793 10:7513608-7513630 CAGTGCTGGGCTAGGCCAGAAGG - Intergenic
1064514495 10:16131575-16131597 CAGGGCTGGGAGAGAAAAGGAGG - Intergenic
1066052560 10:31648892-31648914 CAGTGCTGGGAAAAAGGAGGAGG + Intergenic
1067053249 10:43037249-43037271 CATTGCTGTGAGAGTGCAGCAGG - Intergenic
1067168719 10:43886166-43886188 GAGTGTGGGCAGAGGGCAGGTGG + Intergenic
1067242234 10:44506715-44506737 CTGTGTTGGCAGAGGGCTGGGGG + Intergenic
1067343013 10:45419497-45419519 CGGGGCTGGGGGAGGGCCGGTGG - Intronic
1067456918 10:46425616-46425638 GAGGGCTGGGGGAGGGCCGGGGG - Intergenic
1067630286 10:47959023-47959045 GAGGGCTGGGGGAGGGCCGGGGG + Intergenic
1067678771 10:48412136-48412158 AAGTGCTGAAAGAGGCCAGGTGG - Intronic
1068493540 10:57755296-57755318 CGGGGGTGGGAGAGGACAGGAGG + Intergenic
1068710684 10:60130207-60130229 CAGAGCTGGGGGAGGGGAGTGGG - Intronic
1068742133 10:60485529-60485551 AACCTCTGGGAGAGGGCAGGAGG + Intronic
1069613837 10:69793429-69793451 CAGTGGTGGGGGCGGGCAGAGGG + Intergenic
1069772795 10:70910186-70910208 CAGAGCTGGGTGGGGACAGGGGG + Intergenic
1069776597 10:70930860-70930882 CAATGCTGGCACAGAGCAGGCGG + Intergenic
1069959106 10:72069163-72069185 CAGAGCTGGCAGAGAGGAGGAGG - Intronic
1070169209 10:73920094-73920116 CTGAGGTGGGAGAGGGCAGAGGG - Intronic
1070594834 10:77825242-77825264 CAGGGATGGGAGGGAGCAGGGGG + Intronic
1070605136 10:77893326-77893348 CATTACTGGGTGGGGGCAGGGGG - Intronic
1070851002 10:79561339-79561361 CAGTGCAGGTTGGGGGCAGGTGG + Intergenic
1070856196 10:79609935-79609957 CAGTGCAGGGTGGGGGCAGGTGG - Intergenic
1070968887 10:80547554-80547576 CAGTGCTGGGAGCGGGAGGGAGG + Intronic
1071256873 10:83879034-83879056 TAGTGATGGGAATGGGCAGGGGG + Intergenic
1071518184 10:86313050-86313072 TAGGGCTGAGAGAGGCCAGGTGG + Intronic
1072607611 10:96997835-96997857 GGGTCCTGGGAGAGGGCTGGGGG - Intergenic
1073048872 10:100655305-100655327 CAGCGCCGGGAGAGGGGAGAGGG - Intergenic
1073308509 10:102522689-102522711 CAGTGCTAGGAAAGGACAGTGGG - Intronic
1073441047 10:103552946-103552968 CAGTGCTGGGTGATGGGAAGGGG + Intronic
1074290410 10:112133848-112133870 CAGTGGTGGGAGAGTGGAGAGGG - Intergenic
1074738800 10:116464527-116464549 CACTGCTGTGGTAGGGCAGGTGG + Intronic
1074871398 10:117578740-117578762 CAGAGCTGGGAAAGGGCACAAGG + Intergenic
1074921674 10:118020589-118020611 CGGTGCTGGGATGGGGCTGGGGG - Intronic
1075048765 10:119166327-119166349 CTGTGCTGGGGAAGGGCAGGTGG - Intergenic
1075348144 10:121699394-121699416 CAGATCTGGCAGAGGGCAGAGGG + Intergenic
1075664438 10:124220693-124220715 CAGGGCTGGCAGAGGGCGGAAGG - Intergenic
1075676870 10:124301927-124301949 CAGTGCTGGCAGATTCCAGGGGG + Intergenic
1075783684 10:125033693-125033715 CAGTGCTTGGGGTGGGCAGGGGG - Intronic
1076445205 10:130509579-130509601 CAGAGCTGGGAGAGGGCAGAGGG + Intergenic
1076474784 10:130744309-130744331 CAGGGAGGGCAGAGGGCAGGAGG - Intergenic
1076595553 10:131622956-131622978 CAGTGCTTGGAGAGAGGTGGGGG + Intergenic
1076616552 10:131759045-131759067 CAGGGCTGGGGGAGGGTGGGCGG - Intergenic
1076854702 10:133110152-133110174 CTGTCCTGGGAGACGGCAGGTGG + Intronic
1076882487 10:133246264-133246286 CAGTGTTGGGAGAGCCCAGAGGG - Intergenic
1077067274 11:647805-647827 CAGTGCTGGGAGCAGGTGGGTGG + Intronic
1077076524 11:704869-704891 CAGAGCTGGGAGTGGCCAAGTGG - Intronic
1077079767 11:720044-720066 AGGTGCTGGGGGTGGGCAGGTGG - Exonic
1077204078 11:1333189-1333211 GAGTGGAGGGAGAGGGCGGGAGG + Intergenic
1077208820 11:1358579-1358601 CCGTGCGGGGGGATGGCAGGTGG - Intergenic
1077389953 11:2296238-2296260 CTATGCTGGGAAAGGCCAGGTGG - Intronic
1077394970 11:2316211-2316233 CAGTCCTGTGAGAGGGCAGCAGG - Exonic
1077489784 11:2855426-2855448 CCGTCCTGGGGGTGGGCAGGAGG + Intergenic
1077491338 11:2862347-2862369 CAGTGCCGCGACTGGGCAGGGGG - Intergenic
1077906421 11:6538323-6538345 CAGTGTTGGGAGGGGGGTGGTGG - Intronic
1078066378 11:8081640-8081662 CAGTGCTGGGATAGGTGGGGAGG - Intronic
1078379041 11:10823054-10823076 CAGTGTTGGGAGAGGGAAAGAGG + Intronic
1078433065 11:11302454-11302476 GGGTGCAGGCAGAGGGCAGGAGG - Intronic
1078452809 11:11453028-11453050 CAGGGCTGGGTGAGGGCAGGGGG - Intronic
1078536505 11:12179263-12179285 CAGTGCTGGGCAGAGGCAGGTGG - Intronic
1078841061 11:15075850-15075872 CAGTGCTGGGAGCAGGCCAGGGG - Intronic
1079121494 11:17688296-17688318 CAGAGGAGGGAAAGGGCAGGGGG + Intergenic
1079195730 11:18324862-18324884 CAGTGCAGGGAAGAGGCAGGAGG - Intronic
1079366470 11:19814372-19814394 CAGGGGAGGGAGAGGGCAGTGGG - Intronic
1080451042 11:32379267-32379289 CAGAGCTGAGATAGGCCAGGAGG - Intergenic
1081235594 11:40643621-40643643 CCGTGCTGGTGGACGGCAGGGGG - Intronic
1081812643 11:45922392-45922414 CAGAGCGGGGGCAGGGCAGGGGG + Intronic
1081861010 11:46333303-46333325 CAGCGCTGGGACTGGGCTGGCGG + Intronic
1082665510 11:55971169-55971191 CAGTGCAGGGAGGGTGCTGGTGG - Intergenic
1082835820 11:57649508-57649530 CAGAGCTTGGAGAGGGATGGAGG + Exonic
1083089949 11:60189525-60189547 TAGTGTTGGGAGATGGCAGCTGG - Intergenic
1083266019 11:61547093-61547115 CAGAGGTGGGTGGGGGCAGGAGG + Intronic
1083851867 11:65372765-65372787 CAGTGCAGGAAGTAGGCAGGAGG - Intergenic
1084117516 11:67050673-67050695 GAGAGAGGGGAGAGGGCAGGGGG - Exonic
1084214414 11:67639772-67639794 CTGTGCGGGAGGAGGGCAGGTGG + Intergenic
1084268966 11:68019139-68019161 CAGTGCAGGGAGAGAGCTGGAGG - Intronic
1084313774 11:68331961-68331983 CTGGGCTGGGAGAGGGCAGGTGG + Intronic
1084659246 11:70537442-70537464 CACAGCTGGGAGAGGGCATGTGG + Intronic
1084945715 11:72637283-72637305 TAGGGCTGGGGGAGGGGAGGCGG - Intronic
1085071255 11:73548571-73548593 CAGTTCTGGGAGTGGGGAGAGGG - Intronic
1085203252 11:74714455-74714477 AGGTCCAGGGAGAGGGCAGGAGG - Intronic
1085238611 11:75033741-75033763 CAGTGTGGGAAGAGGTCAGGAGG + Intergenic
1085282863 11:75342243-75342265 CAGGGCTCGGAGAGGGAAGCAGG - Intronic
1085391658 11:76185293-76185315 CAGTGCCTGGCCAGGGCAGGTGG - Intergenic
1085423204 11:76381039-76381061 CAGTGCTGTGAGCGGCCGGGAGG + Intergenic
1085507561 11:77068815-77068837 CAGTGCTGGGGGAAGGTAGGTGG + Intronic
1085996126 11:81916258-81916280 CAGTTCAGGGAGAGGACATGGGG + Intergenic
1087143855 11:94792503-94792525 CAGTGCTGGGACAGCTCAGCCGG + Intronic
1087946246 11:104164015-104164037 CAGCGCAGGGCGAGCGCAGGCGG - Exonic
1088553394 11:111037367-111037389 TAGTGCTGGGAGAGGTATGGAGG + Intergenic
1088627123 11:111737451-111737473 CAGTGCCTGGAGAGGACATGGGG - Exonic
1088848613 11:113687897-113687919 CAGGGAGGGGAGAGGGCAGAAGG + Exonic
1088903725 11:114138115-114138137 AAGTGGTGAGGGAGGGCAGGAGG + Intronic
1088926519 11:114308396-114308418 CCTTGCTGAGACAGGGCAGGAGG + Intronic
1089077485 11:115749868-115749890 CAGAGCTGGGATTGGGCAGGAGG + Intergenic
1089567317 11:119378553-119378575 AAGAGCTGGGGGAGGGGAGGAGG + Intronic
1089702652 11:120254819-120254841 CAGTCCAGGGAGAGCCCAGGTGG - Intronic
1089729589 11:120511913-120511935 CAGCGCAGGGAGCGGGCCGGGGG - Intronic
1089966348 11:122656929-122656951 GAGGGCAGGGAGAGCGCAGGTGG + Intronic
1090207443 11:124893726-124893748 CAGACCTGGGAGAAGGCAGGAGG + Exonic
1090225845 11:125071827-125071849 CAGTGCTGGTGGAGGGCTTGTGG + Intronic
1090381645 11:126331645-126331667 CTGTGCTGGGCGAGGGGATGGGG + Intronic
1090394097 11:126407683-126407705 GAGTGGGGGGAGCGGGCAGGGGG - Intronic
1090415098 11:126535099-126535121 CAGAGCTGGGAGCAGGCAGATGG + Intronic
1090432339 11:126656562-126656584 CAGTGCAGGGGCTGGGCAGGCGG - Intronic
1090445755 11:126763420-126763442 AAGAGCAGGGAGAGGGCATGAGG + Intronic
1090832571 11:130429259-130429281 CTGTCCTGTTAGAGGGCAGGTGG + Intergenic
1091234125 11:134008381-134008403 CAGAGCAGGGAGAGGAGAGGTGG - Intergenic
1091323508 11:134667804-134667826 AAGTGCAGGGAGAGGGCCTGGGG - Intergenic
1091636506 12:2201120-2201142 CAATTCTGGGAAAGGGGAGGAGG - Intronic
1092051081 12:5470648-5470670 GAGATCTGGGAGAAGGCAGGGGG - Intronic
1092377346 12:7966921-7966943 GAGAGGTGGCAGAGGGCAGGGGG + Intergenic
1092492244 12:8956200-8956222 TGGTGCCAGGAGAGGGCAGGAGG - Intronic
1093498347 12:19782601-19782623 CAGTGCTTTGAGAGGGCAAGAGG + Intergenic
1093563303 12:20570157-20570179 CAGTGCTTTGGGAGGCCAGGTGG + Intronic
1093669520 12:21856967-21856989 CAGTGCTGAGAGAGGGTAGATGG - Intronic
1094087605 12:26610931-26610953 CTGTGCGGGGAGATGGGAGGAGG - Intronic
1094398033 12:30029736-30029758 CAACCCTGGGAGAGGGCAGGAGG - Intergenic
1096114933 12:49050252-49050274 CAGGGCTGGGGCAGGGCTGGGGG + Exonic
1096211574 12:49770193-49770215 CGGTGCTGGCTGTGGGCAGGGGG - Intergenic
1096747632 12:53738893-53738915 GAGAGCAGGCAGAGGGCAGGAGG + Intergenic
1096764081 12:53868774-53868796 CAGTGGTGGGAGATGGCAGCAGG + Intergenic
1096796768 12:54082610-54082632 CCGGGCTGGGGGAGGGGAGGCGG + Intergenic
1097233564 12:57525967-57525989 AAGTGCTGGGAGGGGGTAGTGGG - Exonic
1098347726 12:69524066-69524088 CATGGCTGGAGGAGGGCAGGGGG + Intronic
1100426237 12:94489561-94489583 CAGTCCTGGGACAGGGTAGTGGG - Intergenic
1101594226 12:106149471-106149493 CAGGGCAGGGAGAAGGAAGGCGG + Intergenic
1101843621 12:108344701-108344723 CAGGGCAGGGAGAAGGCAGTGGG + Intergenic
1102222705 12:111205205-111205227 CAGCTCTGGGAGGGGGCTGGGGG - Intronic
1102463942 12:113117086-113117108 CGGCTCTGGGAAAGGGCAGGAGG + Exonic
1102527167 12:113520271-113520293 CAGAGCGGGGAGAGAGGAGGGGG + Intergenic
1103215970 12:119201823-119201845 CAGAGCTGGGTCAAGGCAGGGGG - Intronic
1103536581 12:121637691-121637713 AAGTGCTGGGGGTGGGGAGGTGG + Intronic
1103556884 12:121771725-121771747 CAGTGCTGGGGGCTGGGAGGTGG - Intronic
1103619261 12:122176343-122176365 CAGTGACGCGAGAGGACAGGAGG + Intronic
1103810713 12:123611332-123611354 CATTGCTGGGATGGGCCAGGAGG + Intronic
1103923368 12:124410889-124410911 AAGAGCTGGGAGAGGACAGACGG + Intronic
1104015375 12:124958305-124958327 CAGGTCTGGGGGAAGGCAGGAGG + Intronic
1104697243 12:130872434-130872456 CAGGCCTGGGAGCGGGAAGGCGG - Intronic
1104854564 12:131895700-131895722 CAGTGCTGGGGGAGGGGGCGTGG + Intronic
1104936777 12:132368817-132368839 CAGAGCCGGGGGAGGGCAGTGGG - Intergenic
1105002895 12:132702684-132702706 CAGTCCAGGCACAGGGCAGGTGG + Intronic
1105019360 12:132805634-132805656 CTGTGCTGGGAGAGCGCCTGGGG - Intronic
1105551674 13:21402730-21402752 CAGTGATGGGAAAGTGCAAGGGG - Intronic
1105649994 13:22366632-22366654 CAGAGGTGGGAGAGGGTAGGGGG + Intergenic
1105707365 13:22976694-22976716 CAGTCCCGGGAGAGGAAAGGTGG - Intergenic
1105843106 13:24272513-24272535 GAGAGCTCTGAGAGGGCAGGGGG + Intronic
1106080389 13:26495843-26495865 CAGAGCTTGGAGAGGACAGCTGG + Intergenic
1106098094 13:26668276-26668298 CTGAGCTGGGAGAAGGCAGGAGG - Intronic
1107420328 13:40240107-40240129 CAGTGTGGAGGGAGGGCAGGGGG - Intergenic
1107697621 13:43015850-43015872 CAGTGGAAGGAGAGGGGAGGAGG - Intergenic
1107874445 13:44777713-44777735 CAGGGATGGGAGAGGGTAGGGGG + Intergenic
1108158740 13:47616067-47616089 GAGTGCTGGGAGGGTGCAGGGGG + Intergenic
1108180659 13:47836847-47836869 CAGTGCTGGGGAATGGCAGCAGG + Intergenic
1108839355 13:54593263-54593285 CAGTGGTGGGAGGGTTCAGGTGG - Intergenic
1109814058 13:67556081-67556103 CAGTGTAGGGAGAAGCCAGGTGG + Intergenic
1110980399 13:81890016-81890038 CAGTGCCAGCAGAGGGCAAGAGG - Intergenic
1111443877 13:88319680-88319702 GAGAGATGGGAGATGGCAGGGGG + Intergenic
1112783407 13:102926392-102926414 CTGTGCTGGGAGTGGATAGGGGG + Intergenic
1113692679 13:112322781-112322803 CTGTGCTGGGGGTGGGCAGCAGG + Intergenic
1113873466 13:113579362-113579384 CAACGGTGGGAGGGGGCAGGGGG - Intergenic
1113984688 13:114304165-114304187 CAGTGCTGGGGCAGGGCTGGTGG + Intronic
1114458427 14:22872134-22872156 CAGGGCTGGGGGCGGGGAGGCGG - Exonic
1114527603 14:23376539-23376561 CAGAGATGGGAGAGGACGGGAGG - Intergenic
1115119994 14:29927650-29927672 CTGGGCTGGGGGAGGGCAAGGGG + Exonic
1116500491 14:45615697-45615719 CAGTGCTGGTATAGGATAGGTGG + Intergenic
1117186753 14:53247542-53247564 CAGGGCCAGGGGAGGGCAGGGGG - Intergenic
1117300407 14:54420579-54420601 CAGTACTGGGAGGGGGCGAGTGG - Intergenic
1118030831 14:61816282-61816304 CAGTCCTGGAAGAGGGTGGGTGG + Intergenic
1118338650 14:64877109-64877131 CAGTCCTGGAAGTGGCCAGGAGG - Intronic
1118377093 14:65187046-65187068 CAGGGCAGGAAGAGGCCAGGGGG - Intergenic
1118723575 14:68610604-68610626 CAGTTCTGGGAGTGAGCAGCAGG - Intronic
1119155249 14:72404406-72404428 CAGTGCTGGAACAAGGCAGATGG - Intronic
1119182167 14:72612592-72612614 CAGGGAAGGGAGAGGGCAGGAGG + Intergenic
1119273161 14:73327896-73327918 GTGTGGTGGGGGAGGGCAGGCGG - Intronic
1119804774 14:77475552-77475574 CACTGCAGGGAGAGGGCAGGCGG - Exonic
1119842059 14:77800487-77800509 CAGAGCTGGAGGAGGGCCGGAGG + Intronic
1119866808 14:77981140-77981162 CTGGGCTGGGGGAGGGCAGCAGG - Intergenic
1120196423 14:81488831-81488853 AAGGGCTGGGAGAAGACAGGTGG + Intronic
1120991453 14:90381165-90381187 CAATGCTGAGAGATGGGAGGAGG - Intergenic
1121017488 14:90557296-90557318 CAGGGCTGGGAGAAGTCACGTGG + Intronic
1121081911 14:91115124-91115146 CAGTGCTGGAGGAGGGCAGCAGG + Intronic
1121744046 14:96274109-96274131 CAGGGGAGGGAGCGGGCAGGTGG + Intergenic
1121780048 14:96616427-96616449 CAGAGCAGGGAGAGGCAAGGAGG + Intergenic
1122031576 14:98916160-98916182 CACTGCTGGGAGAGGGCTGGGGG - Intergenic
1122113718 14:99517670-99517692 CAGGGCTGGGAGGTGGCAGCTGG - Intronic
1122370476 14:101226495-101226517 TAGTCCTGGGAGGGGGCAGCTGG + Intergenic
1122628617 14:103097353-103097375 CAGTGCCCGGAGAGTCCAGGGGG - Intergenic
1122637896 14:103138794-103138816 CAGCGCGGGGACAGGGCGGGCGG + Intergenic
1122692707 14:103538771-103538793 CACTGCTGGGGCAGGGCAGCAGG - Intergenic
1122696502 14:103555741-103555763 TAGGGCTGGGAGAGGGCCGGAGG + Intergenic
1122940120 14:104977474-104977496 CAGTGCTGGGCAAGGGAAAGTGG - Intronic
1123043122 14:105498704-105498726 CAGTGCTGGGAGCGAGACGGTGG + Exonic
1123102538 14:105815043-105815065 CAGTGCTTTGAGATGCCAGGAGG - Intergenic
1123123116 14:105927198-105927220 CAGTGCTGGCTGAGGACAGGCGG - Intronic
1123989088 15:25670018-25670040 CAGGGCTGGGGGAGGGAACGAGG + Intergenic
1124342845 15:28901288-28901310 CAGAGCTGGGTGGGGGCTGGGGG - Intronic
1124383855 15:29190130-29190152 CAGCCCAGAGAGAGGGCAGGTGG - Intronic
1124406944 15:29401504-29401526 CAGTGATGGCAAAGGGCAGAGGG + Intronic
1125411853 15:39414855-39414877 GAGTGCAGGATGAGGGCAGGTGG + Intergenic
1125540453 15:40466892-40466914 GGGTGCTGGGAGAGGGTTGGGGG + Exonic
1126271740 15:46827547-46827569 CAGTGATGAAAAAGGGCAGGGGG + Intergenic
1126382818 15:48066373-48066395 CAGGGCAGAAAGAGGGCAGGGGG - Intergenic
1126759947 15:51960888-51960910 GAGTGTGGGGAGAGGGAAGGGGG + Intronic
1127099513 15:55550900-55550922 CAGTGGTGGGGGATGGGAGGTGG + Intronic
1127171499 15:56307418-56307440 CAGTCCTGGCAGTGGCCAGGTGG - Intronic
1127288641 15:57551552-57551574 CAGTGCTGCTAGAGAGCTGGAGG - Intergenic
1128107574 15:65055898-65055920 CAGAGGCAGGAGAGGGCAGGGGG + Intronic
1128291955 15:66484834-66484856 CAGTGTTGGGGGTAGGCAGGAGG + Intronic
1128349190 15:66877778-66877800 CTGTGCTGGGACAGGGAGGGTGG + Intergenic
1128677662 15:69623802-69623824 CAGTGCTGGGGGAGGCTAGGAGG - Intergenic
1128765378 15:70248111-70248133 CAGTGTTGGGGGTGGGCAGTGGG - Intergenic
1128768245 15:70264147-70264169 CAGTGCTGGAAGCGGGTAGCAGG - Intergenic
1129029083 15:72605518-72605540 CAGGCTTGGGAGGGGGCAGGAGG - Intergenic
1129163420 15:73760821-73760843 CAGTACTTGGAGAGGGAAGTGGG - Intergenic
1129756660 15:78103075-78103097 CAGAGATGGGAGAGGACATGGGG - Intronic
1129825706 15:78633873-78633895 CAGTGCTGGGGCAGGGGAGCAGG + Intronic
1129952433 15:79603865-79603887 CAGTGCTGGAAGGGTGCAGTGGG + Intergenic
1129989293 15:79948236-79948258 CAGTGCTGTGACAGAGGAGGAGG - Intergenic
1130044754 15:80435172-80435194 GAGGGCAGGCAGAGGGCAGGAGG - Intronic
1130546832 15:84862958-84862980 CTGGGCTGGGAAAGGGGAGGGGG - Intronic
1130577790 15:85107583-85107605 CAGTGGAAGGAGAGGGGAGGGGG + Intronic
1130871201 15:87973660-87973682 GAGAGCTGGGAGAGAGGAGGAGG + Intronic
1131076603 15:89499231-89499253 CTGGGCCGGGAGGGGGCAGGTGG + Intergenic
1131344844 15:91636979-91637001 CAGTGCTGGGATAGGGTCAGAGG - Intergenic
1131837459 15:96405489-96405511 GAGTGCTGGCAGTGGGGAGGAGG - Intergenic
1132478410 16:153806-153828 CGGTGCTCGGAGAGGGCCGCAGG + Intronic
1132480495 16:164396-164418 CGGTGCTCGGAGAGGGCCGCAGG + Intronic
1132555837 16:572286-572308 CAGTGGTCAGAGAGGGCAGGCGG - Intronic
1132648153 16:1008462-1008484 AGGTGCTGGCAGAGGCCAGGAGG - Intergenic
1132854831 16:2040069-2040091 CAGTGCTGACAGAGGGCGGGCGG + Intronic
1132870844 16:2115146-2115168 CTGTGCTGGGAGAGAGGAAGAGG + Intronic
1132941300 16:2509757-2509779 CAATGCTGGGAGATGGCACTGGG - Intronic
1133060277 16:3170502-3170524 CTGTACTGGGCGGGGGCAGGGGG - Intergenic
1133197988 16:4184360-4184382 CCGTGCGGGGACAGGGCTGGAGG - Intergenic
1133524056 16:6587176-6587198 CAGTGCGGAGAGAGGGGAGCTGG - Intronic
1133899872 16:9963995-9964017 AAGTGCTGTGATAGGGCATGTGG + Intronic
1134024806 16:10945469-10945491 CAGCTCTGGGGGAGGACAGGTGG + Intronic
1134183226 16:12063966-12063988 AGGGGCTGGGAGAGAGCAGGTGG + Intronic
1134245122 16:12534055-12534077 CAGTGCAGAGTGAGGGCAGCAGG + Intronic
1134521686 16:14921758-14921780 CTGTGCTGGGAGAGAGGAAGAGG - Intronic
1134537183 16:15035369-15035391 CAAGGCTGTGTGAGGGCAGGTGG + Intronic
1134633765 16:15776880-15776902 GGGTGATGGGAGAGGGCAGCTGG + Intronic
1134709356 16:16320409-16320431 CTGTGCTGGGAGAGAGGAAGAGG - Intergenic
1134716568 16:16360438-16360460 CTGTGCTGGGAGAGAGGAAGAGG - Intergenic
1134950246 16:18348236-18348258 CTGTGCTGGGAGAGAGGAAGAGG + Intergenic
1134958182 16:18391721-18391743 CTGTGCTGGGAGAGAGGAAGAGG + Intergenic
1135155590 16:20050218-20050240 CAGTGATGGGAGCGGGCAATAGG + Intronic
1135553768 16:23418619-23418641 CACGTCTGGGAGAGGGCTGGGGG - Intronic
1135620297 16:23950000-23950022 CAATGCAAGGAGAGGGAAGGAGG - Intronic
1136024805 16:27462509-27462531 CAGGGCTTGGTGGGGGCAGGAGG + Intronic
1136036494 16:27544458-27544480 CTGGGCTGGGGGAGGGGAGGAGG + Intronic
1136061385 16:27728984-27729006 CAGTCCTGGCAGGAGGCAGGTGG - Intronic
1136084357 16:27874019-27874041 CATAGCTGGGAGAGGGGAGCAGG + Intronic
1136089126 16:27905855-27905877 CAGGGGTGGGAGTGGGAAGGTGG - Intronic
1136247979 16:28986006-28986028 CTGAGCTGGGAGAGGGGAGATGG + Intronic
1136346407 16:29679035-29679057 CAGGCCTGGCAGAGGACAGGAGG + Exonic
1136517158 16:30775067-30775089 CAGTGCCCGGAGAGGCCAGAGGG + Exonic
1136561110 16:31039837-31039859 CAGGGCTGGGGCAGGCCAGGGGG - Intronic
1136573896 16:31112103-31112125 CAAAGCTGGGGGTGGGCAGGGGG - Exonic
1136610154 16:31361360-31361382 CAGTGCTGGGGGACGTCAGTGGG - Intronic
1136656501 16:31712362-31712384 CAGTGCCGGGAGAGTGGAGGAGG + Intergenic
1137564245 16:49523446-49523468 CTGGGCTGGCAGAGGCCAGGGGG + Intronic
1137983726 16:53090835-53090857 CTCTGCTGGGACAGGGCATGGGG - Intronic
1138454935 16:57115764-57115786 CAGTGCAGGGAGGGGGCTGCTGG - Intronic
1138599093 16:58044696-58044718 CAGTTCTGGGAAGGGGCAGCAGG + Intronic
1138658032 16:58501789-58501811 CAGGGCTGGGAGAAGACAGTGGG + Intronic
1138998305 16:62478672-62478694 TAGCGCTGGAAAAGGGCAGGAGG - Intergenic
1139099173 16:63744560-63744582 CAGTGCTGGTGCAGGGCGGGTGG - Intergenic
1139590764 16:67931620-67931642 CAGGGCTGGGAGGGGGCAAGAGG - Intronic
1140035862 16:71370822-71370844 CAGTGCTGTGATGGGGAAGGAGG - Intronic
1140326060 16:74004957-74004979 CAGTGGTGGGTCATGGCAGGTGG + Intergenic
1140462121 16:75148499-75148521 CAGTGCTGCGAGCGCGCCGGTGG + Intronic
1141005109 16:80344701-80344723 CCGTGCTAGGAGAGGGTAGGAGG + Intergenic
1141013650 16:80427058-80427080 CAGTGGTGGGAAAGGGAGGGAGG - Intergenic
1141181078 16:81753848-81753870 GAGGGCTGGGAGAGGGCCTGGGG + Intronic
1141494113 16:84395140-84395162 CAGAGCTGGGAGTGTGTAGGTGG + Intronic
1141677145 16:85523901-85523923 CAGAGGTGGGAGGGCGCAGGAGG + Intergenic
1141920895 16:87134652-87134674 CAGTGCATGGACACGGCAGGCGG - Intronic
1142127410 16:88417068-88417090 CAGCTCTGGAAAAGGGCAGGCGG - Intergenic
1142306475 16:89288756-89288778 CAGTGCGGGGACAAGCCAGGTGG + Intronic
1142585263 17:968310-968332 TTGAGCTGGGAGAGGCCAGGGGG - Intronic
1142882082 17:2889638-2889660 CAGCACTGGGAGGAGGCAGGAGG + Intronic
1143150092 17:4802338-4802360 CAGAGCTGGGAATGGCCAGGAGG + Intergenic
1143336544 17:6175795-6175817 CAGTGCTGGGTGTTGGCAGGGGG - Intergenic
1143518196 17:7430373-7430395 CAGTGCTGGAGCAGGGCTGGGGG - Intergenic
1143563671 17:7709207-7709229 GCATGCTGGGAGGGGGCAGGGGG - Exonic
1143996154 17:11008153-11008175 CCCTGCTGGGAGAGAGAAGGAGG - Intergenic
1144179076 17:12734974-12734996 CCGTGCAAGGACAGGGCAGGGGG - Intronic
1144642904 17:16948390-16948412 CAGCACTGGTGGAGGGCAGGTGG + Intronic
1144969110 17:19096065-19096087 CAGTCCTGAAAGAGGGCAGGAGG - Intronic
1144978806 17:19156001-19156023 CAGTCCTGAAAGAGGGCAGGAGG + Intronic
1144989416 17:19222231-19222253 CAGTCCTGAAAGAGGGCAGGAGG - Intronic
1145117866 17:20228299-20228321 CAGTGCTTTGAGAGGCCAGGAGG - Intronic
1145416012 17:22714736-22714758 CAGAGGAGGCAGAGGGCAGGAGG - Intergenic
1145787171 17:27601678-27601700 CACTGCTAGGAGATGGCAGAAGG + Intronic
1145881515 17:28356179-28356201 AAGTGCTGTGGGAGGTCAGGAGG - Intronic
1146327662 17:31901131-31901153 GAGTGCTGTGAGAGCCCAGGGGG - Intronic
1146380302 17:32322886-32322908 CAGGCCTGGGAGGAGGCAGGGGG + Exonic
1146457642 17:33019905-33019927 CTATGCTGGGGGAGGGCAGGGGG + Intronic
1146626706 17:34440388-34440410 CAGTGCTGAGAGCGGGTAGAGGG - Intergenic
1146632581 17:34481496-34481518 CACTGCAAGAAGAGGGCAGGCGG - Intergenic
1146667554 17:34715211-34715233 CAGTGCTGGGGCTGAGCAGGAGG - Intergenic
1146727398 17:35167370-35167392 CAGTGCTTTGGGAGGCCAGGTGG + Intronic
1146798509 17:35800036-35800058 CAGTGCAGAGAGAGGGAGGGAGG - Intronic
1146931145 17:36778805-36778827 CTGTGCTGGAGGAGGGCAGCTGG - Intergenic
1146941210 17:36845579-36845601 CAGTGCTGAGAGGAGGAAGGTGG + Intergenic
1146965524 17:37025489-37025511 CATTGACGGGGGAGGGCAGGAGG + Intronic
1147598860 17:41733842-41733864 CAGTGCCAGGAGAGGGGCGGGGG - Intronic
1147603026 17:41757611-41757633 GTGAGCTGGGGGAGGGCAGGAGG - Intronic
1147645976 17:42034165-42034187 CTGGGCAGGGAGAGGGCTGGAGG - Intronic
1147652565 17:42070909-42070931 CAGTGCTGGGAGAGGGCAGTGGG - Intergenic
1147685999 17:42287364-42287386 CTGTGCTGTGAGTGGGCAGCTGG + Intergenic
1148105761 17:45118082-45118104 GACTGCTGGGAGGGGCCAGGAGG - Exonic
1148153566 17:45410359-45410381 CAGTGCTGGCACAGGGCAACAGG + Intronic
1148559414 17:48597387-48597409 CAGGGCTGGGAGAGGGGGGTTGG + Intronic
1148745231 17:49914296-49914318 CAGTCCTGGGAGAGAGCAGCCGG - Intergenic
1148778509 17:50109149-50109171 CAGAGCTGGGAGGGGACATGTGG - Intronic
1148988829 17:51647544-51647566 CAGTGCTGGGGGATGGGTGGTGG + Intronic
1148993623 17:51688131-51688153 CAGTGCTGGCTGATGGCTGGAGG - Intronic
1149864001 17:60140234-60140256 CAGTGCCGGGACAGAGCATGGGG - Intergenic
1150009151 17:61488418-61488440 CAGGGCTGGGACTGGGCCGGTGG + Intergenic
1150154517 17:62840941-62840963 CCGGGCTGGGATAGGGCATGAGG + Intergenic
1150313172 17:64146162-64146184 CGGAGCTGGGAGGGGGCTGGCGG + Intergenic
1150390024 17:64784694-64784716 CACTGCTGGGACAGGGCCTGTGG - Intergenic
1150640855 17:66948506-66948528 CAGTGCCGAGAGAGGGCAGTTGG - Intergenic
1150722642 17:67626615-67626637 CAGTACTTTGAGAGGCCAGGTGG - Intronic
1151194991 17:72424973-72424995 CAGTGCAGGGAGAGAGGTGGAGG - Intergenic
1151335609 17:73437950-73437972 CAGTGCTGGGTGAGAGAGGGTGG - Exonic
1151380748 17:73724214-73724236 CAGTGCTAGGAGAGGGAGGCTGG + Intergenic
1151471686 17:74322313-74322335 CAGTGATGGGAGTGGAGAGGAGG + Intergenic
1151817440 17:76478240-76478262 CAGTGCTTTGAGGGGGCAGCAGG - Intronic
1151913458 17:77100244-77100266 CAGTGCTCGGAGGGTGCAGAAGG - Intronic
1152093074 17:78257638-78257660 CAGTGCTGGGACAGGGGTGGGGG - Intergenic
1152320981 17:79608807-79608829 CAGTCCTGGGGGAGGGGCGGGGG + Intergenic
1152554729 17:81047106-81047128 CCCTCCTGGGAGAGGCCAGGTGG + Intronic
1152555181 17:81049542-81049564 CAGTGCTGGGGCAGGGGATGGGG - Intronic
1152567786 17:81107880-81107902 CAGTGCTGGGAGAGCCAAGGAGG + Intronic
1152586721 17:81192642-81192664 CAGGGATGGGAGAGGTCAGCGGG + Intronic
1152648788 17:81482443-81482465 CAGTGCTGGGAGGGGGACTGAGG - Intergenic
1152844410 17:82591055-82591077 CAGTGCTGACAGATGGGAGGTGG + Intronic
1152935815 17:83136044-83136066 CAGGCCAGGGTGAGGGCAGGTGG - Intergenic
1153518421 18:5927497-5927519 CAGTGCTTGTTGAGAGCAGGAGG + Intergenic
1153717063 18:7860448-7860470 CAGTGAGGGAAGAGTGCAGGGGG + Intronic
1154134170 18:11761349-11761371 CTGTGCTCTGAGAGGGCATGGGG - Intronic
1154193840 18:12252057-12252079 GAGAGGTGGGAGAGGGCAGAGGG - Intergenic
1154503188 18:15006586-15006608 CAGAGGAGGCAGAGGGCAGGAGG - Intergenic
1155171143 18:23267586-23267608 CAGTGCAGGGAGTGGGCAGCCGG - Intronic
1155879681 18:31129600-31129622 AAATGCTTGGAGATGGCAGGTGG + Exonic
1156036840 18:32773582-32773604 CAGTGCTGGGGGTGGGGGGGAGG - Exonic
1156364197 18:36410168-36410190 CAGGGATTGGAGACGGCAGGGGG - Intronic
1156449640 18:37259640-37259662 CAGAGCAGGGGCAGGGCAGGAGG - Intronic
1156507149 18:37604844-37604866 GAGTCCTGGGAAAAGGCAGGGGG + Intergenic
1156522274 18:37731883-37731905 CAGGGCTGTGTGAAGGCAGGAGG - Intergenic
1157559531 18:48636794-48636816 GAGAGGTGGGAGAGGGGAGGGGG + Intronic
1157606832 18:48931150-48931172 AAGTGCTGGGGGAGGGGAGAAGG + Intronic
1157641051 18:49214912-49214934 CAGGGCTGGGAGAGCCCAGGAGG + Intronic
1157893212 18:51438635-51438657 CAGAGGCAGGAGAGGGCAGGAGG + Intergenic
1158334866 18:56405354-56405376 ATCAGCTGGGAGAGGGCAGGTGG - Intergenic
1158591980 18:58785505-58785527 CAGAGCTGGGAGAGAGGAGGCGG - Intergenic
1158796882 18:60856949-60856971 CGGTGGGGGGAGAGGGGAGGAGG - Intergenic
1158959856 18:62580514-62580536 CAGTGCTGTGGAAGGCCAGGTGG + Intronic
1158959867 18:62580558-62580580 CAGTGCTGTGGAAGGCCAGGTGG + Intronic
1158959889 18:62580646-62580668 CAGTGCTGTGGAAGGCCAGGTGG + Intronic
1158959922 18:62580778-62580800 CAGTGCTGTGGAAGGCCAGGTGG + Intronic
1158959996 18:62581086-62581108 CAGTGCTGTGGAAGGCCAGGTGG + Intronic
1158960040 18:62581262-62581284 CAGTGCTGTGGAAGGCCAGGTGG + Intronic
1158960177 18:62581834-62581856 CAGTGCTGTGGAAGGCCAGGTGG + Intronic
1158960188 18:62581878-62581900 CAGTGCTGTGGAAGGCCAGGTGG + Intronic
1158962975 18:62601666-62601688 CAGGGCGAGGAGAGGGCAGCTGG + Intergenic
1159306677 18:66652363-66652385 CAGTGCTGTGAGAGGGAAATGGG - Intergenic
1159827104 18:73226977-73226999 CAGTGAGGAGGGAGGGCAGGGGG - Intronic
1159960729 18:74554159-74554181 CAATGCTGGAAGAGGGCATGTGG - Intronic
1160039862 18:75335809-75335831 CAGTGCAGTGAGTGGGCAGTGGG - Intergenic
1160329606 18:77979351-77979373 CAGAGCTGTGTGTGGGCAGGTGG + Intergenic
1160344789 18:78123971-78123993 CTGTCCTGGCAGAGAGCAGGAGG - Intergenic
1160375798 18:78410577-78410599 CAGGGCAGGGAGAGGAGAGGTGG - Intergenic
1160754495 19:750600-750622 CAGGGCTAAGAGAGGTCAGGTGG + Intergenic
1160759009 19:773173-773195 CTGTTCTCGGATAGGGCAGGAGG - Intergenic
1160792054 19:927498-927520 CAGGGCTCGGAGCGGGCTGGTGG + Intronic
1160877192 19:1302202-1302224 TAGGGCTGGGAGGGGGCAGCTGG + Intergenic
1160924226 19:1535336-1535358 CTGTCCTGGGGGAGGGCTGGGGG + Exonic
1161249168 19:3271148-3271170 AGGTGCTGGGAGGGGGGAGGAGG + Intronic
1161435026 19:4258089-4258111 CAGCGCTGGGCATGGGCAGGGGG + Intronic
1162095567 19:8307952-8307974 CCATGCTGGGGGAGGGGAGGAGG - Intronic
1162534766 19:11256325-11256347 CAGAGGAGGGAGAGGGGAGGAGG + Intronic
1162858733 19:13489666-13489688 CAGTGCTGAGAAAGGAAAGGTGG - Intronic
1163346710 19:16747721-16747743 CTGCGCTGGGAGAGGGGAGATGG - Intronic
1163458708 19:17423879-17423901 CAGAGTTGGGAGAGGGAAGTAGG - Intronic
1163571614 19:18085372-18085394 CAGTCCAGGGAAAGGGAAGGAGG - Intronic
1163677807 19:18664061-18664083 AAGGGCTGGGGGAGGGGAGGGGG - Intronic
1163700191 19:18782960-18782982 GTCTGCAGGGAGAGGGCAGGCGG + Exonic
1163704684 19:18805313-18805335 CACTGCTGGGGGAGGTCTGGGGG - Intergenic
1163844321 19:19629839-19629861 CAATGCTGGGAGAGGTCCAGAGG - Exonic
1164210465 19:23093572-23093594 CCGGGCTGGGACAGGGCTGGGGG + Intronic
1164635266 19:29786957-29786979 CAGTGCTGAGACAAGGAAGGAGG + Intergenic
1164735097 19:30535462-30535484 CAGACCTGGGACAGGGCAGCTGG + Intronic
1165313003 19:35039921-35039943 CTGGGGTGGGAGGGGGCAGGGGG + Intronic
1165355256 19:35300075-35300097 CCGGGCTGGGAGAGGGCACTGGG + Intronic
1165956164 19:39503331-39503353 GAGGGCTGGGAGAGGGAAGGGGG - Intronic
1166130855 19:40744778-40744800 CTGGCCTGGGAGAGGGGAGGGGG - Intronic
1166258105 19:41620145-41620167 CAGTGCAGGCTCAGGGCAGGGGG - Intronic
1166293979 19:41879942-41879964 CACTCCTGGGTGAGGGCAGGAGG - Intronic
1166415974 19:42595276-42595298 TGGGGATGGGAGAGGGCAGGGGG - Intronic
1166423152 19:42653717-42653739 TGGGGATGGGAGAGGGCAGGGGG + Intronic
1166685389 19:44793456-44793478 GAGTGCTGGGGGAGGTCGGGAGG - Exonic
1166718699 19:44985423-44985445 CAGTGCTCAGGGAGGGGAGGTGG - Intronic
1166871927 19:45876552-45876574 GAGAGCTGGGAGAGGGATGGAGG - Intergenic
1167106080 19:47430527-47430549 AAAGGCTGGGAGGGGGCAGGCGG - Intronic
1167122527 19:47527155-47527177 CAGTGCTGACTGAGGACAGGGGG + Intronic
1167464913 19:49645599-49645621 CAGTGCTGGGAGAGGGCAGGAGG + Intronic
1167529172 19:50004281-50004303 CAGGGTGGGGAGAGGGCAGGAGG - Intronic
1167699734 19:51035344-51035366 CAGTGCAGGGGAGGGGCAGGGGG + Intergenic
1167706935 19:51086674-51086696 CAGTGTGTGGAGAGGGTAGGAGG + Intergenic
1168453366 19:56483926-56483948 CAGTAATGGGAGGGGGCAGGGGG - Intergenic
1168474673 19:56667316-56667338 TGGTGCTGAGAGAGGGAAGGAGG + Intronic
1168630125 19:57949902-57949924 CAGTGCTGGCTGAGGGCAGGAGG + Intergenic
925140917 2:1549410-1549432 CAAGGGTGGGTGAGGGCAGGAGG - Intergenic
925182271 2:1825001-1825023 CAGAGAAGGGAGAGGACAGGAGG + Intronic
925216958 2:2104789-2104811 CATGGTTGGGGGAGGGCAGGAGG + Intronic
925580038 2:5401083-5401105 CAGTGCTGGCAGAGGACGGTGGG - Intergenic
926121553 2:10243762-10243784 GAGTGGGGGGAGAGGCCAGGGGG - Intergenic
926224887 2:10960776-10960798 CAGGGCTGGGTGAGGGGAGGTGG + Intergenic
926276968 2:11411394-11411416 TAGATCTGGGAAAGGGCAGGAGG - Intergenic
926395287 2:12435025-12435047 CACTGATGGGAGAGGGAAGCAGG - Intergenic
927109767 2:19856195-19856217 CATGGCTGGGAGAGAGCGGGAGG - Intergenic
927203555 2:20593072-20593094 CAGTGGGGGGACAGGGCTGGAGG - Intronic
927557890 2:24049029-24049051 CAGAGCTGGGGGAGGGAGGGAGG - Intronic
927571835 2:24166944-24166966 GAGTGCTGAGAGAGGGCGGGAGG + Intronic
927705350 2:25293288-25293310 ACATGCTGGGAGAGGGGAGGGGG - Intronic
927844052 2:26462240-26462262 CAGGGCTGGGATGGGGCAGGCGG + Intronic
928332244 2:30366614-30366636 CAGTGCTGAGCAAGGGCTGGTGG + Intergenic
928715665 2:34056757-34056779 CACTGCTGGGGGATGGCAGAGGG + Intergenic
928912285 2:36433927-36433949 TAGTGCTGGGAAAGTGCAGTGGG + Intronic
929463077 2:42119229-42119251 TTTTGCAGGGAGAGGGCAGGGGG + Intergenic
929489635 2:42384858-42384880 CAGAGCTGGGGGAAGGCAGGTGG - Intronic
929950698 2:46407515-46407537 CAGTGCCTGGGGAGGCCAGGTGG + Intergenic
930249873 2:49023156-49023178 CAGTGCTGGTAGAGTAAAGGAGG - Intronic
930701144 2:54457894-54457916 CAGTGCAGGCAGAGGGGAGCCGG + Intronic
931496155 2:62809353-62809375 CAGTTGGGGGAGAGGGGAGGAGG - Intronic
931869030 2:66439848-66439870 CAGTGCTAAGAGAGGGAAGAGGG - Exonic
932430245 2:71669894-71669916 CAGTGCTGGGACAGTGGAGGTGG - Intronic
932437467 2:71711087-71711109 CAGGGCAGGGAGAGGGCAGAAGG + Intergenic
932449165 2:71798703-71798725 CACTGCAGGGAGAGGACAGTGGG - Intergenic
932477094 2:72013131-72013153 CAGTGCTGGGGGAAGGGAAGCGG + Intergenic
932577864 2:72972633-72972655 CGGGGCTGGGAGAGTTCAGGCGG - Intronic
933036502 2:77406127-77406149 CAGTGGTGGTAGTGGGCTGGGGG + Intronic
933299939 2:80530227-80530249 CAGTGCCGGGGGTGGGCAGGAGG - Intronic
933420932 2:82044006-82044028 TGGTGCTGGCAGAGAGCAGGGGG - Intergenic
933707456 2:85302638-85302660 CAGTGCTGCTGCAGGGCAGGCGG + Intronic
934039030 2:88112365-88112387 CAGTGGTCTGAGAGGGAAGGAGG - Exonic
934554130 2:95278490-95278512 CAATGGTGGGAGAGGGATGGGGG + Intronic
934576629 2:95405846-95405868 CAGAGCGGGGAGGGTGCAGGGGG - Intronic
934750320 2:96789613-96789635 CAGTGCTTGGAAAGGGCTTGGGG + Intronic
934794800 2:97091397-97091419 CAGAGCGGGGAGGGTGCAGGGGG + Intronic
935163607 2:100550221-100550243 CAGTGATGGGTGGGGTCAGGCGG + Intergenic
936009508 2:108916517-108916539 CACAGCTGGCCGAGGGCAGGTGG - Intronic
936755989 2:115713203-115713225 CAGTCATGAGAGAGGGCAGCTGG + Intronic
937080726 2:119137773-119137795 CAGTGGCCAGAGAGGGCAGGTGG + Intergenic
937204082 2:120224522-120224544 CAGTGCTGTGAGGGTGCGGGAGG - Intergenic
937221457 2:120345125-120345147 CAGGGCCGGGAGAGAGCGGGCGG - Intergenic
937236984 2:120437028-120437050 CAGGGCTGGGGGAAGGCAGCAGG + Intergenic
937238468 2:120444884-120444906 CAGTGCTAGGTGTTGGCAGGAGG + Intergenic
937252618 2:120534120-120534142 CAGGGCTGGGAGCAGGCAGCTGG - Intergenic
937784049 2:125874341-125874363 CAGAGCTGGGAGGAGGCAGACGG + Intergenic
938502369 2:131836756-131836778 CAGAGGAGGCAGAGGGCAGGAGG - Intergenic
939685936 2:145200228-145200250 CAGTGCTGGGCGGGGGTAGACGG + Intergenic
941303448 2:163830956-163830978 CTCTGCTGGGAGTGGGCAGGGGG + Intergenic
941965643 2:171297722-171297744 CAGTAATGGGAGAGGAAAGGAGG + Intergenic
942731754 2:179067641-179067663 CAATGATGGCAGAAGGCAGGGGG - Intergenic
942870426 2:180728086-180728108 CAGTGGTGGGCGGGGGCTGGGGG - Intergenic
943247502 2:185473948-185473970 CAATGCTGACGGAGGGCAGGAGG - Intergenic
945444031 2:209914570-209914592 TGGTGCTGGGAGGGGGAAGGGGG - Intronic
946179987 2:217943180-217943202 TAGTGGTTGGAGAGGGCAGAGGG + Intronic
946200410 2:218068076-218068098 CAGACCTGGAGGAGGGCAGGGGG + Intronic
946208844 2:218130959-218130981 CTGTGCTGGGGGTGGGCTGGAGG - Intronic
946526919 2:220530614-220530636 CAGTGCTGGGAGTGGGCAGTGGG - Intergenic
946543031 2:220706840-220706862 CAGGGCTGGTAGAGGACAGAGGG - Intergenic
946803038 2:223441708-223441730 CAGAGTTGGGAGAGGGAATGGGG + Intergenic
947067102 2:226239980-226240002 CACTGGTGGGAGGGGGCAGGTGG + Intergenic
947914166 2:233820952-233820974 CAGTGCTGGGTGGGGGTAAGGGG + Intronic
948236560 2:236395124-236395146 CAGCGCTGGGGGTGGGAAGGGGG + Intronic
948397450 2:237657057-237657079 CAGTGGTGGGAAAAGGCTGGCGG + Intronic
948461924 2:238133984-238134006 CAGGGCTGGCAGAGGGCAAGGGG + Intergenic
948524242 2:238560423-238560445 GTGTGCTGGGAGAGGGAGGGTGG - Intergenic
948664148 2:239524030-239524052 CAGGGCTGGGGGTGGGCAGGGGG - Intergenic
948693930 2:239723256-239723278 CAGTTCTAGGACAGAGCAGGAGG - Intergenic
1169143119 20:3237207-3237229 CAGGGCTGGGTGAGGACAGAGGG + Intronic
1169366975 20:5000504-5000526 CAGTGCTGGGAGACGGGCGGGGG - Intronic
1169729114 20:8767411-8767433 AAGTGCTGGGAGATGGCAGCTGG - Intronic
1170564802 20:17592777-17592799 CTGGACTGGGAGAGGGGAGGTGG - Intronic
1170614754 20:17939520-17939542 GAGGGCGGGGAGAGGGGAGGTGG + Intergenic
1170703087 20:18721873-18721895 CTGTCCTGGAAGAGGACAGGTGG + Intronic
1171167707 20:22986547-22986569 CAGAGCCGGGGGAGGGCAGGGGG + Intergenic
1171193739 20:23180666-23180688 CTGTGCTGGGTGAGGGGTGGAGG + Intergenic
1171278574 20:23878643-23878665 CTGTGCAGGGAGAGGGCTGCAGG + Intronic
1171364773 20:24616399-24616421 CAGAGCTGGGAGGATGCAGGTGG - Intronic
1171391198 20:24802735-24802757 CAGGGCTGGGTGGGGTCAGGCGG - Intergenic
1171462042 20:25303464-25303486 CCAGGCTGGGAGTGGGCAGGCGG - Intronic
1171483063 20:25468452-25468474 CAGTCGGGGGACAGGGCAGGGGG - Intronic
1171557605 20:26092364-26092386 CAGAGGAGGCAGAGGGCAGGAGG + Intergenic
1172092948 20:32446574-32446596 GACTGCTGGGAGATGGCAGCCGG - Exonic
1173158056 20:40631567-40631589 CTGTGCTGGGAGGTGGGAGGAGG - Intergenic
1173180538 20:40803426-40803448 CTGTGTTGGGAGTGGGCAGGGGG - Intergenic
1173226272 20:41164019-41164041 CAGGGCTGGGGGAGGGAAGATGG + Intronic
1173659871 20:44725569-44725591 CAGAGCCGGGAGAGGAAAGGTGG + Intronic
1174180197 20:48669571-48669593 ATGTGATGGGAGAGGGGAGGAGG + Intronic
1174588223 20:51625112-51625134 CAGTGCAGGGAGATCACAGGGGG - Intronic
1174949523 20:55028971-55028993 CAGTGGTGGGAGTGGTCATGTGG + Intergenic
1175221326 20:57418407-57418429 CAGAGCTGGGGGTGGGGAGGTGG - Intergenic
1175652283 20:60735839-60735861 GAGATCTGGGAGATGGCAGGAGG - Intergenic
1175828828 20:61951115-61951137 CAGGGCTGGGGGAGGGGAGAGGG - Intergenic
1175828847 20:61951150-61951172 CAGGGCTGGGGGAGGGGAGAGGG - Intergenic
1175874808 20:62224310-62224332 CCGAGGTGGGAGAGTGCAGGAGG + Intergenic
1175952615 20:62591376-62591398 AAGCGCTGGGAGAGGTGAGGGGG + Intergenic
1176031414 20:63014812-63014834 CTGTGCTGACTGAGGGCAGGCGG - Intergenic
1176037135 20:63045107-63045129 CTGAGGTGGGAGAGGGGAGGAGG - Intergenic
1176099835 20:63359960-63359982 CAGGGGTGGGAGAGAGCCGGAGG - Intronic
1176187932 20:63791659-63791681 CAGCACTGGGACAGGGCAGGAGG + Intronic
1176195447 20:63834764-63834786 CAGTGAGGGTGGAGGGCAGGTGG - Intergenic
1176235858 20:64053195-64053217 CAACTCTGGGAGAGGGCAGGTGG + Intronic
1176239009 20:64067381-64067403 AAGTGCCGGGAGAGGGGAAGCGG + Intronic
1176249709 20:64114684-64114706 CAGTGCTGGGAGGTGGCACCTGG + Intergenic
1176273192 20:64247115-64247137 GAGTGCTGAGACAGGGCAGGGGG + Intergenic
1176415663 21:6473296-6473318 CAGAGCTGGGTGAGACCAGGCGG + Intergenic
1179101770 21:38360652-38360674 ATGTTGTGGGAGAGGGCAGGTGG + Intergenic
1179179132 21:39030565-39030587 GAGTGATGGGAGAGGCCAGAGGG - Intergenic
1179691163 21:43081628-43081650 CAGAGCTGGGTGAGACCAGGCGG + Intergenic
1179724681 21:43335511-43335533 CTGGGGTAGGAGAGGGCAGGAGG + Intergenic
1179798300 21:43798459-43798481 GGGGGCTGGGAGAGGCCAGGAGG - Intronic
1179987026 21:44927723-44927745 CAGGGCTGGCAGAGGGGAGGAGG + Intronic
1180106772 21:45623762-45623784 CAGTGATGAGAGAGGGAAGAAGG - Intergenic
1180619788 22:17153431-17153453 CACAGCTGGGAGCTGGCAGGAGG - Intronic
1180749443 22:18114020-18114042 CAGTGATGGGGGTGGGCAGGAGG + Intronic
1180793770 22:18592018-18592040 GAGGCCTTGGAGAGGGCAGGGGG - Intergenic
1180945118 22:19688486-19688508 CCGGGCAGGGAGAGGGCAGTGGG - Intergenic
1180949532 22:19714886-19714908 CAGGGCTGGGTGAGGGCCGGCGG - Intronic
1181033899 22:20160876-20160898 CAGTGCAGGGCCAGGGAAGGGGG + Intergenic
1181084867 22:20435307-20435329 CAAGGCTGGGATAGGGAAGGAGG - Intronic
1181227970 22:21403302-21403324 GAGGCCTTGGAGAGGGCAGGGGG + Intergenic
1181236639 22:21451062-21451084 CCGGGGTGGGAGAGGGCAGAGGG - Exonic
1181250683 22:21531537-21531559 GAGGCCTTGGAGAGGGCAGGGGG - Intergenic
1181275171 22:21683499-21683521 CGGTGCTGTCAGTGGGCAGGTGG + Intronic
1181278113 22:21699454-21699476 CACTCCTGGTGGAGGGCAGGTGG + Exonic
1181278768 22:21703656-21703678 CAGTGATGGGACAGGCTAGGGGG + Intronic
1181509456 22:23382527-23382549 CAGTGCAGGGCCAGGGGAGGGGG - Intergenic
1181542562 22:23581271-23581293 CTGGGCTGGGAGAGGACCGGGGG - Intergenic
1181807806 22:25385585-25385607 CTGGGCTGGGAGAGGGCAGGTGG - Intronic
1181855089 22:25775544-25775566 CAGCGAGGGAAGAGGGCAGGAGG - Intronic
1181947482 22:26529451-26529473 CAGGGAGGGGAGAAGGCAGGTGG - Intronic
1181983563 22:26783343-26783365 CATTGGTGGGAGGGGGCATGGGG + Intergenic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1182254802 22:29030733-29030755 CAGGGCTGGTGGAGGGGAGGAGG + Intronic
1182488425 22:30653672-30653694 CAGTGCTTAGAGAAGGGAGGCGG - Intronic
1182537672 22:31017352-31017374 CAGTGCTTGGGGAGGCCAAGGGG - Intergenic
1182624753 22:31637784-31637806 CAGTGCCGGGTGAGGGGAGCGGG - Intronic
1182697270 22:32205819-32205841 CACTGCTGGCAGTGGGGAGGGGG + Intergenic
1182712831 22:32333270-32333292 CTGTGCTGGAAGTGGGCAGCAGG + Intergenic
1182864228 22:33588679-33588701 CACTGCTGTGAGGGTGCAGGAGG + Intronic
1182937685 22:34241207-34241229 CAGTACATGGAGAGGGCATGTGG + Intergenic
1183060705 22:35334831-35334853 CAGTGCAGGGAGGGGGGCGGGGG - Intronic
1183311465 22:37112158-37112180 CAGGGCTGGGCCAGGGCAGGAGG + Intergenic
1183383715 22:37503225-37503247 GAGGGCAGGGAGGGGGCAGGAGG + Intronic
1183530179 22:38349043-38349065 GAGTGATGGGAGAGGTCAGCGGG + Intronic
1183536414 22:38404216-38404238 CAGTGCTAGGGGAGGGCGGGAGG - Intergenic
1183668302 22:39257528-39257550 CCCTGCTGGCAGAGGGAAGGGGG - Intergenic
1184302743 22:43572034-43572056 CACTGATGGGACAGGGCAGGAGG + Intronic
1184453090 22:44594448-44594470 TAGGGGTGGGAGGGGGCAGGAGG - Intergenic
1184679621 22:46063279-46063301 CACTGCTGAGAGAGGGGTGGCGG - Intronic
1184981534 22:48099281-48099303 CAGTTCTGGGAGAGGGCAGGTGG - Intergenic
1185314793 22:50174337-50174359 CAGGACTGGGGGAGGGCCGGGGG + Intronic
1185324351 22:50218398-50218420 CAGGGCTGGCGGAGGGCAGAAGG + Exonic
950249659 3:11453796-11453818 CAGTGATGGGGGAGTGCAAGGGG + Intronic
950266246 3:11575213-11575235 CTGTGGTGCGAGAGGGAAGGCGG + Intronic
950267412 3:11584895-11584917 GGGTGCTGGGAGAGGGCAGAAGG - Intronic
950431661 3:12954421-12954443 CAGGGCTGGGAGAGGCCCTGGGG + Intronic
950450884 3:13064853-13064875 CAGAGCTGCCAGAGGGCATGTGG - Intronic
950637524 3:14325217-14325239 CAGAGCAGGGAGAGGGCTGGAGG - Intergenic
950696293 3:14703609-14703631 CATTGCTGGGCAGGGGCAGGAGG - Intronic
951567229 3:24023333-24023355 CAGTGATGGGAGGGGACAGACGG + Intergenic
951688283 3:25369047-25369069 CAGTGGTGGGAGAGAGGAGTAGG + Intronic
952187765 3:30989022-30989044 CAGTGCTGGGAGGGAGAAAGAGG - Intergenic
952250530 3:31648717-31648739 CAGTGCTGGTAGTGGCCTGGTGG - Intergenic
952382519 3:32816550-32816572 GAGTGCTGGGAGGGGGCTGGGGG - Intergenic
953191858 3:40695147-40695169 CAGAGCAGGGGCAGGGCAGGAGG + Intergenic
953635567 3:44660918-44660940 AAGTGATGGGAGAGGGGAGGTGG + Intergenic
953902851 3:46853000-46853022 GAGGGGTGGGAGGGGGCAGGGGG - Intergenic
953981068 3:47413235-47413257 CTCTGCTGGGTGTGGGCAGGTGG - Exonic
954246951 3:49339745-49339767 CAGCTCTGGGAAAGCGCAGGCGG - Intronic
954294336 3:49665867-49665889 CAGCTCAGGGAGAGGGCAGAAGG + Intronic
954304941 3:49720647-49720669 CAGAGCTGTGAGTGGGCTGGTGG + Exonic
954630987 3:52047501-52047523 CAGGCCTGGGCGAGGGCAGCAGG + Intergenic
954639346 3:52088850-52088872 GAGGGCTGGGAGATGGCGGGAGG - Intronic
954714979 3:52522481-52522503 GGGTACTGGGAGTGGGCAGGGGG - Intronic
954718217 3:52537722-52537744 CAGTGCTGTGAGAAGGAAGTGGG + Intronic
955333368 3:58065695-58065717 GAGTGATGGGTGAAGGCAGGAGG - Intronic
956172521 3:66443920-66443942 CAGTGCTAGGAAAGGGCAATGGG + Intronic
956519204 3:70085027-70085049 CAGTGATGGCAGAGGGGAGAGGG + Intergenic
956851663 3:73233656-73233678 CAGCGCTGGGAGAGAGGAGTTGG + Intergenic
956981638 3:74645592-74645614 CAGGGCTGGGTGGGAGCAGGAGG - Intergenic
957494572 3:80975296-80975318 CAGTGATGGGGGAAGGCAAGGGG + Intergenic
958459130 3:94371552-94371574 ATGTGCTGGGAGGGGGCGGGTGG + Intergenic
958593427 3:96190138-96190160 TGGCGCTGGCAGAGGGCAGGAGG - Intergenic
959254927 3:103997296-103997318 CAGTGCAGAGAGAAGGCAGAAGG + Intergenic
960041683 3:113156229-113156251 CAGGGCTGGGAGTGGGAATGGGG + Intergenic
960480408 3:118180886-118180908 CAGGACTGGAAGAGGGCATGGGG + Intergenic
961017487 3:123479108-123479130 CAGTGCTGGGGCAGGCCAGGGGG + Intergenic
961211528 3:125129465-125129487 GAGTGCAGTGAGGGGGCAGGGGG + Intronic
961244144 3:125436789-125436811 CACTGCTGGGGGAGGGCTAGGGG + Intergenic
961332933 3:126153657-126153679 CAGGGCTGGGAGAGGGAGAGGGG + Intronic
961622721 3:128237598-128237620 CAGAGCTGGGAGAGGGGAGCAGG - Intronic
961624248 3:128248932-128248954 TGGTGCTGGATGAGGGCAGGAGG - Intronic
963237223 3:142967675-142967697 GAGGGCTGGGAGAGAGCAGTGGG + Intronic
963843614 3:150132755-150132777 CTGTGCAGGAAGAGGGAAGGGGG + Intergenic
964368193 3:155971387-155971409 CATTGCTGGGAGAGGTCACTTGG + Intergenic
964584531 3:158282081-158282103 CAGGGCTGGGGGTGGGGAGGTGG - Intronic
964639381 3:158892419-158892441 CACTGGAGGGATAGGGCAGGAGG - Intergenic
964717790 3:159741001-159741023 CAGTGTTGGGAAAGGGGAGTTGG - Intronic
964932962 3:162048171-162048193 TAGTGTTGGGAGAGGGAAGCTGG + Intergenic
965634735 3:170769552-170769574 CAGGTCTAGGGGAGGGCAGGAGG + Intronic
965773927 3:172209245-172209267 TAGTGCTGGCAGAGGGCGGGAGG + Intronic
966448046 3:180025555-180025577 CATTGCTGGGAGAGGGGTGGTGG + Intronic
966509777 3:180748897-180748919 CTGGGCAGGGAGAGGGAAGGAGG + Intronic
966881771 3:184354690-184354712 CAGTGGAGGGGGAGGGCAGGGGG + Intronic
967130882 3:186469712-186469734 AGGTGCTCGGAGAAGGCAGGAGG - Intergenic
967267091 3:187700327-187700349 CAGTGCTGGGTGAGAGCTGCAGG + Intronic
967853368 3:194098527-194098549 GAGTGCTGGGGCAGGGGAGGAGG - Intergenic
968024907 3:195433087-195433109 TAGTGCAGGGGGTGGGCAGGGGG - Intronic
968530931 4:1091237-1091259 CAGAGCTGGCAGAGGCCTGGTGG + Intronic
968606582 4:1538342-1538364 CAGTGGTGGGAGGGGAGAGGTGG + Intergenic
968684071 4:1944520-1944542 CTGTGCTTGGAGAGGGGAGGTGG + Intronic
968863703 4:3193852-3193874 GAGGGCTTGGAGAGGGCACGTGG + Intronic
968899734 4:3425658-3425680 CAGTGCAGGGGAGGGGCAGGTGG + Intronic
968913351 4:3486588-3486610 CAGCCCTGGGAGTGGGGAGGTGG + Intronic
968967231 4:3775287-3775309 ATGTGCCGGGAGAGGGCAGGAGG + Intergenic
969036095 4:4255153-4255175 CAGTACTGAGAAAGGGAAGGGGG + Intergenic
969050324 4:4368518-4368540 CAGCCCTGGGAGTGGGGAGGTGG - Intronic
969135815 4:5027880-5027902 CAGAGCTGGGAGATGGATGGAGG + Intergenic
969310317 4:6349160-6349182 CATTGCTGTGAGAGGGGAGAGGG - Intronic
969418687 4:7077203-7077225 CAGTGCTGGGGCAGAGCTGGAGG - Intergenic
969421186 4:7097102-7097124 CGGGGCTGGGGGAGGGCAGCTGG + Intergenic
969448700 4:7260379-7260401 CATTCCTGGGAGGGGGGAGGTGG - Intronic
969633116 4:8349978-8350000 CACTTCTGGGAGGGGCCAGGAGG + Intergenic
970538585 4:17055211-17055233 CAGTGTTGAGAGAGGGCTGGGGG - Intergenic
971038817 4:22727187-22727209 TAGTACTGGGAGGGGGAAGGGGG + Intergenic
971296876 4:25401603-25401625 CAGTGCACGGAGAGGGCAGCTGG - Intronic
971384733 4:26132565-26132587 CAGTGCAGCGGGAGGGCAGGTGG - Intergenic
973772254 4:54217716-54217738 CAGTGCTGGGGGAGGGGAGGAGG - Intronic
974220352 4:58961361-58961383 CAGTGCTATGGGAGGGCTGGAGG - Intergenic
974651096 4:64755092-64755114 CAGTCCTGGGACAGTGCAGCAGG - Intergenic
974761773 4:66285545-66285567 CAGTGCTGATGGAGGGCAGGAGG + Intergenic
975428496 4:74259077-74259099 CTGTGCTGGTAGAGGATAGGTGG - Intronic
975901145 4:79154721-79154743 AAGTGCTAGGAGAGGACAGAGGG - Intergenic
976591223 4:86851483-86851505 CAGTGCTGATAGAGGGGAGGGGG + Intergenic
976775117 4:88698750-88698772 CAGTGCGGGGGAGGGGCAGGAGG - Intronic
977027293 4:91834991-91835013 CAGTGATGGGAGAGGTAAGCTGG + Intergenic
978301142 4:107270529-107270551 GGGAGCTGGGAGCGGGCAGGAGG - Intronic
979541612 4:121890150-121890172 CAGAAGTTGGAGAGGGCAGGGGG + Intronic
979724312 4:123942379-123942401 CAGTGCTGGCAGAGGGTGGGAGG - Intergenic
981000401 4:139823640-139823662 CAGAGCGGGGTGAGGGAAGGCGG - Intronic
982878930 4:160686206-160686228 CAATGGTGGCACAGGGCAGGGGG - Intergenic
983258820 4:165432860-165432882 CAGTGCTTGGTGAGGGCTGGAGG - Intronic
983406451 4:167337112-167337134 CAAGGCTGGGAGTGGGCATGGGG - Intergenic
984732230 4:183078755-183078777 CAAAGCTGGGAGAGCGAAGGCGG - Intergenic
984824278 4:183910499-183910521 CAGGGCTGGGGGAGGGGAGAGGG - Intronic
984912366 4:184686260-184686282 CAGGGCTGGGAGAAGGCTGTGGG + Intronic
985184284 4:187298439-187298461 CTCTGCTGGGCGAGGGCAGGAGG + Intergenic
985254285 4:188054438-188054460 CAGTGCCGAGAGAGGGCCCGGGG - Intergenic
985295295 4:188431409-188431431 CAGGGCTGAGAGAGGGAATGGGG + Intergenic
985863707 5:2495164-2495186 CAGTGCTGAGGCTGGGCAGGAGG + Intergenic
985894863 5:2743070-2743092 GAGTGGTGGGAGAGGGCTCGGGG - Intergenic
986161156 5:5230504-5230526 CAGTGTTGGGAGAGAGAAAGTGG + Intronic
986244903 5:5998377-5998399 CAGAGCTGGGAGAGTCAAGGAGG - Intergenic
986302181 5:6486424-6486446 CTGTGGTGGGAGAGGACAAGGGG - Intronic
986357795 5:6945612-6945634 GAGTGATGAGGGAGGGCAGGAGG - Intergenic
986597654 5:9440203-9440225 CCTTGCTGGGAGAGGACACGGGG - Intronic
986755023 5:10827400-10827422 CTGTGCTGGGAGAGGTGACGAGG - Intergenic
986822497 5:11482863-11482885 GAGTGAGGGGAGAGAGCAGGGGG + Intronic
987120186 5:14760053-14760075 CAGGTCGGGGAGAGTGCAGGAGG + Intronic
988965727 5:36415836-36415858 CAGTGGTTGTATAGGGCAGGAGG + Intergenic
989125012 5:38044603-38044625 CAGGGCTGGGGGAGGGGGGGTGG - Intergenic
990525569 5:56623775-56623797 TATTGCTGGCAGAGAGCAGGTGG + Intergenic
990597934 5:57329936-57329958 CAGAGCTGGGAATGGGAAGGAGG - Intergenic
991592350 5:68266157-68266179 TAGTATTAGGAGAGGGCAGGGGG - Intronic
991967473 5:72107368-72107390 CGGCGCTGGGAGAGGGCGGAGGG + Exonic
992708239 5:79420483-79420505 AAGTGAGGGAAGAGGGCAGGCGG - Intronic
992944847 5:81799962-81799984 CAGTGCAGAGAGTGGGGAGGTGG + Intergenic
992996549 5:82339726-82339748 CAGTCCTGGGAGAAGGTAGGAGG + Intronic
994286855 5:97979695-97979717 CATTTCTTGGAGGGGGCAGGGGG + Intergenic
996692108 5:126351569-126351591 CACTGCAGGGAGAGACCAGGCGG + Intergenic
996932830 5:128911231-128911253 GCCTGCTGGGGGAGGGCAGGGGG - Intronic
997381388 5:133440784-133440806 AAGTGGTGGGTGAGGGCTGGGGG - Intronic
997381512 5:133441487-133441509 CTGTGATGGGTGAGGGCTGGAGG - Intronic
997524550 5:134543984-134544006 CAGTTCTGGGAGAGACCTGGAGG + Intronic
998152580 5:139765613-139765635 CAGTGCTCGCAGCGGCCAGGAGG + Intergenic
998170439 5:139869522-139869544 CTGTGCTGGAGAAGGGCAGGGGG - Intronic
998211538 5:140202770-140202792 AACTGCTGGGAGGGGTCAGGAGG + Intronic
998351567 5:141505315-141505337 GAGCCCTGGGAGAGGACAGGAGG + Intronic
998353107 5:141513781-141513803 CAGTGCTTCGAGGAGGCAGGCGG - Intergenic
998486434 5:142506510-142506532 CAATGCTGGAGGAGAGCAGGAGG + Intergenic
998976004 5:147648731-147648753 CAGGGCAGGGAGAGTGCAGAGGG + Intronic
999175583 5:149629554-149629576 CAGTGACAGGAGAGGGCAGGAGG + Intronic
999177226 5:149640000-149640022 CAGCCCTGGGGGAGGGGAGGAGG + Intergenic
999452866 5:151691506-151691528 GAGTGGTTGGAGAGGGCAGTGGG - Intergenic
1001620919 5:173084526-173084548 TAGTACTGGGAGGGGGAAGGGGG + Intronic
1001714627 5:173805017-173805039 CAGGGCTGGGCGAGGGGACGTGG + Intergenic
1002107490 5:176887357-176887379 CAGTGCCGGGATAGGGCTTGTGG + Intronic
1002180712 5:177429677-177429699 CTGGCCTGGGTGAGGGCAGGTGG - Intronic
1002284104 5:178150850-178150872 CAGTGCTGAGCAAGGTCAGGGGG + Intronic
1002290059 5:178194292-178194314 CTGTGCAGGGAGAAGGGAGGTGG + Intergenic
1002419961 5:179140273-179140295 CAGAGCTGCTAGAAGGCAGGAGG - Intronic
1002467093 5:179413008-179413030 CCGTGCTGGGGGAGGGCGGAAGG - Intergenic
1002635041 5:180603125-180603147 CAGGGCGGGCAGAGGGCTGGAGG - Exonic
1002682771 5:180981362-180981384 CACTGCTGGGAGAGGGAGGATGG + Intergenic
1002717286 5:181235465-181235487 GAGTGCTGGAAAAGGGAAGGGGG - Exonic
1002869204 6:1150706-1150728 GAGTGCTTGGGGAGGGCAGAGGG - Intergenic
1003424381 6:5987907-5987929 CAGTGCTGGCTGTTGGCAGGAGG + Intergenic
1003462793 6:6347240-6347262 TAGTTCTGGGAGAGGGGATGAGG - Intergenic
1004062274 6:12209155-12209177 GAGTGCTGGGGGATGGTAGGAGG - Intergenic
1004541055 6:16550258-16550280 CAGAGCTGAGAGGGTGCAGGAGG - Intronic
1005282755 6:24291914-24291936 CAATGGGGTGAGAGGGCAGGAGG + Intronic
1005436964 6:25822961-25822983 CAGTGGTGGGGGAGGGCAGGAGG - Intronic
1005930635 6:30481525-30481547 CAGGGATTGGAGATGGCAGGGGG + Intergenic
1006174554 6:32114152-32114174 CAGTAATGGGTGAGGGCAGTGGG + Intronic
1006455504 6:34129698-34129720 CAGGCCTGGGAGAGGGCACCCGG + Intronic
1006470751 6:34227373-34227395 CACTGGTGGGAGAGCGGAGGAGG - Intergenic
1006509159 6:34512425-34512447 CAGGGCTGGGGGCCGGCAGGTGG + Intronic
1006802133 6:36766048-36766070 CAGAGCTGGGAGGAGGGAGGTGG + Intronic
1006906234 6:37535664-37535686 TAGAGCTGGGGGAGGGGAGGCGG + Intergenic
1007112649 6:39321888-39321910 ATGAGCTGGGAGAGGGCAGAAGG + Intronic
1007384698 6:41512789-41512811 CAGGGCTGGGGGAGAGCAGAGGG - Intergenic
1007618110 6:43194246-43194268 CTGTCCCGGGAGAGGCCAGGAGG + Intronic
1007742552 6:44021749-44021771 TGGTGCTGGGGGAGGGAAGGGGG - Intergenic
1007743123 6:44024968-44024990 TGGTGCTGGGGGAGGGAAGGGGG - Intergenic
1007784014 6:44270290-44270312 CAGGGCTGGGAGCGGGGAAGAGG + Intergenic
1007790199 6:44304343-44304365 GCGTCCTGGGTGAGGGCAGGGGG + Intronic
1007904931 6:45450278-45450300 CAGTGGTGGGACAGGGTTGGGGG - Intronic
1008604855 6:53130438-53130460 GAGGGCGGGGAGGGGGCAGGCGG + Intronic
1008966908 6:57322043-57322065 CAGTGGTTGGAGAAGGAAGGTGG + Intronic
1009488723 6:64259617-64259639 AAGTACTGGGAGAGAGTAGGGGG - Intronic
1010489059 6:76452550-76452572 CTGCGCTGGCAGAGGGCAGGAGG + Intergenic
1011352292 6:86435655-86435677 CAGTGCAGGGTGAGGTGAGGTGG - Intergenic
1011930121 6:92701088-92701110 CACTGCTGGCAGAGGGCAGGAGG + Intergenic
1012100795 6:95083846-95083868 GAGTGCGGGGGGAGGGGAGGAGG + Intergenic
1013030208 6:106325545-106325567 CAGTGCGGGGAGCCGGAAGGAGG - Exonic
1013062608 6:106651070-106651092 CAGGGCTGGGAGAGGGTTGAAGG - Intronic
1013507426 6:110814731-110814753 GAGTGCTCGGAGACGGCGGGGGG - Intronic
1013603893 6:111730563-111730585 AATTGGTGGGAGAGGGAAGGGGG + Intronic
1015156432 6:130101607-130101629 CAGGGCCTGGAAAGGGCAGGGGG + Intronic
1016682689 6:146849160-146849182 CTGTGCTTGGAGGGGGCAAGTGG + Intergenic
1016932396 6:149424189-149424211 CAGAGTTGGGAGAGGACAGCAGG - Intergenic
1016990248 6:149923479-149923501 CAACGCAGGGAGAGGGAAGGCGG - Intergenic
1017074686 6:150606888-150606910 CAGAGTTGGGAGAGGGTGGGAGG - Intronic
1017852202 6:158314490-158314512 CAGTGCAGGGAGAGGACAGCAGG - Intronic
1017877481 6:158536654-158536676 CAGTGCTGGGAGAAGAGAGGGGG + Exonic
1017886280 6:158602083-158602105 CAGGGATGGGAAAGGACAGGAGG - Intronic
1018378182 6:163232908-163232930 CAGAGTTGGGAGAGGGCTGAGGG - Intronic
1018607547 6:165613969-165613991 CAGTTTTGGGTGTGGGCAGGTGG - Intronic
1018659075 6:166068337-166068359 TAATGCAGGGAGAGGGCAAGTGG + Intergenic
1018710776 6:166496958-166496980 GAGTGGTGGGTGAGGGCAGCGGG - Intronic
1018733860 6:166673014-166673036 GAGGGCTGGGAGAGGGCTCGGGG - Intronic
1018740044 6:166721613-166721635 CAGTGCTGGGTGATCGCAGTGGG + Intronic
1019287339 7:230273-230295 CAGAGCTGGGAGAGGCAAGAAGG + Intronic
1019726498 7:2605813-2605835 GAGTGCTGGGAGCCAGCAGGGGG + Intronic
1019732349 7:2634976-2634998 GGGAGCTGTGAGAGGGCAGGGGG + Intronic
1019737500 7:2657974-2657996 CCCTCCTGGGAGAGTGCAGGAGG - Intronic
1019776586 7:2915203-2915225 GAGTGGTGGGAGGGGCCAGGCGG + Intronic
1019803141 7:3103263-3103285 CGGTGCTGGGAGAGGTGAGGTGG + Intergenic
1019851137 7:3558599-3558621 AAGAGCTGGGAGGGGGCAGAGGG + Intronic
1019999940 7:4749917-4749939 CAGTGCAGGGAGACTGCAGAGGG - Intronic
1020009241 7:4799497-4799519 CAGAGGTGGGGGTGGGCAGGAGG + Intronic
1020014905 7:4825184-4825206 CAGTTCTAGAAGAGGGCAGAGGG + Intronic
1020139978 7:5606751-5606773 CAGTGCTGGGAGTGTGCAGTGGG + Intergenic
1020241993 7:6402201-6402223 CAGGGCTGGGAGCCGGCAGAAGG + Intronic
1020282362 7:6656070-6656092 CAGGGCTGGGGGCGGGTAGGAGG + Exonic
1020440140 7:8208783-8208805 CAGTGTTGGGTGGGGGTAGGGGG + Intronic
1022417989 7:30194801-30194823 CAGGGCTGGGTGGGGGCAGCAGG + Intergenic
1022974746 7:35546842-35546864 CAGGGCAGGGAGAGTGCAGAGGG - Intergenic
1023165019 7:37335286-37335308 GAGAGCTGGGAGAAGGCAGGGGG + Intronic
1023340507 7:39214332-39214354 GAGTGCTGGGGCAGGGGAGGAGG - Intronic
1023723474 7:43118762-43118784 CAATGCTGGGGGTAGGCAGGGGG - Intronic
1023724129 7:43124679-43124701 CAGTGCTGGGATAGGGGACTGGG + Intronic
1024100380 7:46026720-46026742 GGGTGCTGGGATAGGGCTGGTGG + Intergenic
1024767617 7:52679109-52679131 CTGTGCTGGGAGATGGAAGGTGG - Intergenic
1025036289 7:55594310-55594332 AGGTGCTGGGAGAAGGCAGCCGG - Intergenic
1025068472 7:55878331-55878353 TAGTCCTGGGAGGGGGAAGGGGG - Intergenic
1025141461 7:56470283-56470305 AAATGCTGGGAGAGTCCAGGAGG + Intergenic
1025223127 7:57133164-57133186 CAGGGCAGGGACCGGGCAGGAGG + Intronic
1025633926 7:63304830-63304852 CAGGGCAGGGACCGGGCAGGAGG + Intergenic
1025648771 7:63443338-63443360 CAGGGCAGGGACCGGGCAGGAGG - Intergenic
1026954839 7:74370613-74370635 CAGGGCTGGGACAAGGCAGGGGG - Intronic
1027223275 7:76227547-76227569 CAAGGCTGGGAGGGAGCAGGAGG - Intronic
1027236317 7:76300178-76300200 CAGTGCTGAGAGGGGCCAGGAGG - Intergenic
1027569554 7:79847234-79847256 CAGAGCTGGAAGAGGGATGGAGG - Intergenic
1028030458 7:85905613-85905635 CAGTGGTGGGAGGTGGCAGAGGG - Intergenic
1028239896 7:88406948-88406970 CAGGGCTGAGAGAGGGAGGGGGG - Intergenic
1028398306 7:90396757-90396779 TAGTACTGGGAGAGGGAAGGTGG - Intronic
1028761875 7:94506445-94506467 CAGTTTTGGGAAAGGGGAGGAGG + Intergenic
1029114239 7:98229170-98229192 GAAGGATGGGAGAGGGCAGGTGG + Intronic
1029164214 7:98575168-98575190 CTGGGCTGTCAGAGGGCAGGGGG - Intergenic
1029203912 7:98857169-98857191 CAGTGCTTTGAGAGGCCAAGAGG - Intronic
1029545831 7:101210157-101210179 CAGTCCTGTGAGAGGGTGGGGGG + Exonic
1029610605 7:101624702-101624724 CAGCTCTGGGACAGGGCAAGAGG - Intronic
1029672086 7:102040324-102040346 CAGAGCTGGGAAAGAGCAGCAGG + Intronic
1029813980 7:103075229-103075251 CAGCGCCGGGCCAGGGCAGGAGG - Exonic
1030657713 7:112186035-112186057 GAGTGCTGGGCTAGGCCAGGGGG + Intronic
1031977423 7:128102983-128103005 GAGTCCTGGCAGAGGGCATGGGG + Intergenic
1032076406 7:128838205-128838227 CAGTCCTGAGAGGGGGCAGAGGG - Intronic
1032401326 7:131626331-131626353 CAGTGCTGTGAGTGTGCAGGTGG + Intergenic
1032462224 7:132120519-132120541 CATTGATGGGAGAGGGCGAGTGG + Intergenic
1032706405 7:134424035-134424057 CTGTGAGGGAAGAGGGCAGGTGG + Intergenic
1032999957 7:137492950-137492972 CAGTGGTGGGAGGGTGCGGGTGG - Intronic
1034087320 7:148331889-148331911 AAGTTGTGTGAGAGGGCAGGAGG + Intronic
1034149321 7:148901408-148901430 CAGGGCTGTGAGAGGGTAAGAGG - Intergenic
1034215840 7:149404974-149404996 CACTGCTGACAGAGGGCGGGAGG + Intergenic
1034297896 7:149990392-149990414 CAGTGCAGGGACAGAGCAGTGGG + Intergenic
1034348635 7:150402678-150402700 CAGTCCTGGGAGATGGGAGATGG + Intronic
1034398846 7:150848181-150848203 CTGTGCTGAGGAAGGGCAGGTGG - Intronic
1034422069 7:150995646-150995668 CAGGGGTGGGAGAGGGAAGAGGG - Intronic
1034422278 7:150996170-150996192 CAGGGGTGGGAGAGGGGAGAGGG - Intronic
1034422439 7:150996664-150996686 AAGTGCTGGGGGAGGGCGGGAGG - Intronic
1034544124 7:151778546-151778568 CAGGGCTTGGAGAAGGCATGGGG - Intronic
1034808128 7:154106461-154106483 CAGTGCAGGGACAGAGCAGTGGG - Intronic
1035003900 7:155640977-155640999 CAGGGCTGGGAGAGGTGGGGAGG - Intronic
1035117159 7:156534163-156534185 CAGTGCCGGGAGTGGGATGGTGG - Intergenic
1035370933 7:158378493-158378515 CACTGTGGGGAGAGGACAGGGGG - Intronic
1035450615 7:158974616-158974638 CAGAGATGGGGGAGGCCAGGCGG + Intergenic
1035486755 7:159232068-159232090 CTGTGCTGTGTGAAGGCAGGTGG + Intergenic
1036646507 8:10614120-10614142 CTGTGCTGGGTGTGGGCATGAGG - Intronic
1037663938 8:20951580-20951602 CACTTCTGGGAGAGGGGAAGGGG - Intergenic
1037716752 8:21407568-21407590 CAGTGCTGGGAGTGGGGTTGGGG - Intergenic
1037917472 8:22781343-22781365 CGGGGCTGGGAGTGGGGAGGAGG + Intronic
1037987290 8:23297935-23297957 CCGGGCTGGGTGAGGGCACGTGG + Exonic
1038259600 8:25981296-25981318 CAGTGCTAGGTGAGGGAAGATGG - Intronic
1038395635 8:27243649-27243671 CCATGTTGGGTGAGGGCAGGGGG + Intronic
1038529456 8:28306140-28306162 GAGTGGGGGCAGAGGGCAGGTGG - Intergenic
1038598384 8:28911801-28911823 CAGGGTTGGGGGAGGGCAGAGGG + Intronic
1038614013 8:29076414-29076436 GAGGGCTGGGAGAAGGGAGGTGG - Intronic
1039442003 8:37601591-37601613 CAGTGGTGGGACGGGGCAGGAGG - Intergenic
1039476780 8:37842953-37842975 CAGTCCTGGGGGAGGGGAGTGGG + Exonic
1039476817 8:37843123-37843145 GAGTAGAGGGAGAGGGCAGGTGG + Exonic
1039546440 8:38414329-38414351 TTGTGCTGGGGGAGGGGAGGCGG - Intronic
1039884071 8:41645643-41645665 GGGTGCAGGGAGAGGGGAGGCGG - Exonic
1039912475 8:41835946-41835968 CAGGGAGGGGAGAGGGCAGGGGG + Intronic
1040414555 8:47184558-47184580 GAGTGCTGGGGGAGGGGAAGAGG - Intergenic
1041020680 8:53635088-53635110 CAATGCTGTGTGAGGACAGGTGG - Intergenic
1041046772 8:53895018-53895040 CTGTGCGGGGAGAGGGAAGGAGG + Intronic
1041151848 8:54943577-54943599 CAGTGCTTGGAGTGGCCAGCTGG - Intergenic
1042177829 8:66054872-66054894 CTGTGCTGGGGTAGGGGAGGTGG + Intronic
1042202934 8:66299376-66299398 CAGAGGTGGGAAAGGACAGGAGG + Intergenic
1042247203 8:66720052-66720074 CAGGGCTGGGGCATGGCAGGTGG - Intronic
1043125476 8:76389255-76389277 GAGGGCAGGGAAAGGGCAGGTGG - Intergenic
1044793521 8:95872499-95872521 CAGTATTGGCACAGGGCAGGGGG - Intergenic
1044861672 8:96529924-96529946 TAAAGCTGGGAGAGGGAAGGCGG - Intronic
1044961078 8:97530870-97530892 CCCTGCTGGGAGATGTCAGGAGG - Intergenic
1045337459 8:101221045-101221067 CAGAGGTGGGAAATGGCAGGAGG + Intergenic
1045459021 8:102411584-102411606 GATTGCTGGGAGCGGGCGGGGGG - Intronic
1045912938 8:107431535-107431557 CATTCCTGGAAGAGGGCATGTGG - Intronic
1047310818 8:123690350-123690372 CTGTGCTGGGAGGCGGGAGGTGG + Intronic
1047381969 8:124372415-124372437 CAGCGCCCGGAGAGGGCGGGCGG + Exonic
1047537045 8:125729568-125729590 CAGGGCTTGGAAAGGACAGGGGG - Intergenic
1047543866 8:125796989-125797011 CAGTGCATGTGGAGGGCAGGAGG + Intergenic
1047718787 8:127619809-127619831 CAGGGCTGAGAGAGGGTAAGGGG - Intergenic
1048216393 8:132499551-132499573 CAGCTCTGGGGGAGGACAGGAGG - Intergenic
1048351996 8:133623916-133623938 CAGTGCTGGGAGAGGGGTCTAGG - Intergenic
1048522723 8:135171504-135171526 CACTGGTGAGAGAGGACAGGAGG + Intergenic
1048547075 8:135397241-135397263 GAGTCCTGGCAGAGGGCAAGAGG + Intergenic
1048548039 8:135405103-135405125 CAGAGCGGAGAGAGGCCAGGCGG + Intergenic
1048918422 8:139205599-139205621 CAAAGCTGGGAGAGAGAAGGAGG + Intergenic
1049060497 8:140272724-140272746 CAGTGAGGGGAGAGGGGAGGAGG + Intronic
1049105186 8:140608471-140608493 TAGCGCTGGGAGGGGGCATGGGG - Intronic
1049150989 8:141035446-141035468 CAGTGGGGAGCGAGGGCAGGAGG - Intergenic
1049386796 8:142346977-142346999 CAGTGCTGTCTGGGGGCAGGAGG - Intronic
1049400907 8:142426792-142426814 CTGCTCTGGGAGAGAGCAGGGGG + Intergenic
1049527666 8:143136532-143136554 CAGTGCAGGGGCCGGGCAGGCGG - Intergenic
1049692846 8:143970128-143970150 CAGTGCTGGCTGAGGGCCTGGGG - Intronic
1049798162 8:144505805-144505827 CAGTGCTGGGTGAGCCAAGGGGG - Intronic
1049798918 8:144508891-144508913 CAGTGCTGGGCGCGGGCCGAGGG + Intergenic
1051349591 9:16186437-16186459 GAGTGCTGGCAGAGTCCAGGTGG + Intergenic
1052316020 9:27117294-27117316 CAGAGCTGGAAGAGAGCAGCTGG + Intronic
1052796931 9:32931467-32931489 CAGGGCTGTGTGAGGCCAGGAGG - Intergenic
1052857754 9:33417632-33417654 CAGAGGTGAGAGAGGGCAGGAGG - Intergenic
1052914463 9:33913721-33913743 CAATGCTGGGAAAGGACATGAGG + Intronic
1053120830 9:35546603-35546625 CAGTGCTGTGGAGGGGCAGGTGG + Exonic
1053122040 9:35554968-35554990 CAGAGATGGGAGAGGGGAGAGGG - Intronic
1054449908 9:65398206-65398228 CCGGGCTGGGGGAGGGGAGGCGG + Intergenic
1054800176 9:69339877-69339899 CAGTGCTGGGATATGGCTAGGGG - Intronic
1055101372 9:72469081-72469103 CAGTGCTGGGTTAGGGAGGGAGG + Intergenic
1055656281 9:78453057-78453079 CAGTGCCAGGGCAGGGCAGGGGG + Intergenic
1056198503 9:84251784-84251806 CAGGGAAGGGGGAGGGCAGGAGG - Intergenic
1056596382 9:88011172-88011194 CAGTACTGAGAGTTGGCAGGTGG + Intergenic
1056756478 9:89385113-89385135 GAGTTCTGGGAGATGGCGGGTGG + Intronic
1056891168 9:90494241-90494263 CGGCACTGGGAGGGGGCAGGAGG + Intergenic
1056928786 9:90857713-90857735 GAGAGCTGGGAGAGGGGAAGAGG - Intronic
1057860154 9:98634567-98634589 CAGAGCTGGAAGAGGCAAGGAGG + Intronic
1058005591 9:99910826-99910848 GAGTGATGGGAAGGGGCAGGAGG - Intronic
1058704591 9:107627927-107627949 CCCTGCTGAGGGAGGGCAGGAGG + Intergenic
1059214738 9:112550591-112550613 CAGTGCAGGGAAAAGGCAGACGG + Intronic
1059312291 9:113396831-113396853 CAGGGCAGGAAGAGGGCAGTGGG + Intronic
1059490117 9:114659894-114659916 GAGTGCTGGGAGCAGGGAGGAGG - Intergenic
1060264221 9:122101030-122101052 GGGTGCTGGGTGTGGGCAGGAGG + Intergenic
1060398819 9:123335500-123335522 CTGTGAGGGCAGAGGGCAGGTGG - Intergenic
1060407608 9:123380657-123380679 CAGAGCTGGATGAGGGCTGGGGG + Exonic
1060413780 9:123416658-123416680 CCGAGCTGGGCCAGGGCAGGAGG + Intronic
1060589981 9:124810516-124810538 CAGGGCTGGGACTGGGCATGAGG + Exonic
1060725598 9:126003711-126003733 CAGTGATGGGAAAGCCCAGGAGG + Intergenic
1060980180 9:127786955-127786977 CAGTTATGGGTGAGGCCAGGAGG + Intronic
1061095945 9:128456770-128456792 CCGGGCTGGGAGGGGGCGGGCGG - Intronic
1061181132 9:129025978-129026000 TGGGGGTGGGAGAGGGCAGGAGG - Intronic
1061182077 9:129030274-129030296 CAGGGCTGGGAGAGGGAACAGGG - Intergenic
1061297526 9:129685056-129685078 CAGCCCAGGGAGAGGGCAGGAGG - Intronic
1061363214 9:130156828-130156850 CAGTGCTGGGACAGGCCAGATGG + Intergenic
1061396398 9:130346152-130346174 CAGCGCTGGCGGAGGTCAGGGGG + Intronic
1061464014 9:130763619-130763641 CAGTGCTGGCAGTTGACAGGAGG + Intronic
1061792014 9:133063888-133063910 CTGTGCAGGGAGATGGGAGGAGG + Intronic
1061864470 9:133485270-133485292 CCGTGCAGGGGGAGGGCAGCTGG + Intergenic
1061928666 9:133820832-133820854 CAGGGCAGTGACAGGGCAGGAGG + Intronic
1061941600 9:133887024-133887046 CACTGCTGAGGGAGAGCAGGAGG - Intronic
1061990524 9:134156291-134156313 CGGTGCTGGGATAGAGCAGGCGG + Intronic
1062021345 9:134320851-134320873 AAGAGCTCGGAGCGGGCAGGAGG + Intronic
1062178869 9:135179968-135179990 CAGTGCTGGGATGGGGCAGGTGG - Intergenic
1062267321 9:135693105-135693127 CTGGGCTGGGAGAGGACAGCAGG + Intergenic
1062331935 9:136048761-136048783 CAGTGCTGGTTGGGGGCAGAGGG - Intronic
1062519284 9:136950948-136950970 CAGGGCTGGATGAGGGGAGGAGG + Intronic
1062520259 9:136954674-136954696 CAGGGATGGGTGAGGGGAGGAGG - Intronic
1062520556 9:136955954-136955976 CAGGCCTGGGAGAGGGGAGGCGG + Intronic
1185459786 X:328784-328806 GAGGGCAGGGAGAGGGGAGGGGG - Intergenic
1185482837 X:460490-460512 CTTTGCCGGGATAGGGCAGGGGG - Intergenic
1186202833 X:7171348-7171370 GAGAGCTGAGAGAGGGCAGGTGG - Intergenic
1186250450 X:7660331-7660353 CAGTGGTGGGAGAGGGAGGGTGG + Intergenic
1186484453 X:9923300-9923322 CAGGCCTGGAAGAGGGCAGTGGG + Intronic
1186634092 X:11383443-11383465 AAGTGATGGGAGAGAGAAGGGGG - Intronic
1186688115 X:11946803-11946825 CACTGATGGCTGAGGGCAGGAGG - Intergenic
1187011352 X:15283605-15283627 CAGAGCTGGGAAAGAGCAGGTGG + Exonic
1187179670 X:16932016-16932038 CAGTGGTGGGGGAGGACAGCAGG + Intergenic
1187796473 X:23008945-23008967 AGGTGATGGGAGAGGGAAGGTGG - Intergenic
1188007589 X:25026761-25026783 CAGAGCTAAAAGAGGGCAGGTGG + Intergenic
1188640936 X:32503805-32503827 CAGTGCTGGGGTGGGGCGGGGGG + Intronic
1189516769 X:41720330-41720352 CACTTCCTGGAGAGGGCAGGGGG + Intronic
1189532758 X:41903267-41903289 TAGTGTTGGGAGACGGCAGAAGG + Intronic
1190005709 X:46735892-46735914 GGGTGCGGGGAGAGGGCAGGGGG - Intronic
1190047342 X:47123272-47123294 CAGTGATTGTGGAGGGCAGGGGG + Intergenic
1190437040 X:50435814-50435836 CAGTGGTAGGTGAGAGCAGGAGG + Intronic
1190515189 X:51216513-51216535 CAGAGCTTAGGGAGGGCAGGGGG - Intergenic
1190744327 X:53312543-53312565 CTGTGCTGTGGGAGGACAGGAGG - Intronic
1191061739 X:56305213-56305235 GAGTGGTGAGAGAGGGCAAGAGG + Intergenic
1192050390 X:67719132-67719154 CAGGGTTGGGAGAGGGCAGCTGG - Intronic
1192244557 X:69361788-69361810 CAGGGGTGGGAGATGGGAGGAGG + Intergenic
1192343651 X:70283724-70283746 CAGTGCTGGTAGGGGGCAGAGGG - Intronic
1192962511 X:76145366-76145388 GGGTGCTGGGGGAGGGCTGGCGG + Intergenic
1192963022 X:76149721-76149743 GGGTGCTGGGGGAGGGCTGGCGG - Intergenic
1193056727 X:77160082-77160104 CAGTGATGGGAGAGAGCAGATGG - Intergenic
1195447674 X:104972396-104972418 TAGTGGTGGGGGAGTGCAGGTGG + Intronic
1195766209 X:108298727-108298749 AAATGCAGGGAGGGGGCAGGCGG + Intronic
1196425209 X:115562134-115562156 CTGTGCGGGGAAAGGGCGGGGGG - Intronic
1197754551 X:129984428-129984450 AGGTGCTGGGAGAAGGAAGGGGG + Intronic
1197766386 X:130061848-130061870 CAGTTATGGGAGAGGGCTAGAGG - Intergenic
1197799345 X:130333419-130333441 AAGGGCTGGGAGAGGGGAGAGGG + Intergenic
1197805849 X:130397919-130397941 CAGACCAGGGAGGGGGCAGGGGG - Intergenic
1198314453 X:135452120-135452142 CAGAACTGGGAGAGGGCTTGAGG - Intergenic
1198934982 X:141895712-141895734 CATTGCTGGGGGAGGGGTGGAGG + Intronic
1200000956 X:153059485-153059507 CTGAGCTGGGAGATGACAGGGGG + Intronic
1200063071 X:153492159-153492181 CAGGGCTGGGAGGAGGCAGGGGG - Intronic
1200132277 X:153857143-153857165 CAAGGCTGTGAGAGAGCAGGAGG + Intergenic
1200139109 X:153889096-153889118 CAGTGGTGGCCAAGGGCAGGGGG - Intronic
1200316808 X:155142014-155142036 GAGTGGAGGGAGAGGGGAGGAGG + Intronic
1200708707 Y:6464939-6464961 TAATCCTGGGAGAGGGCAAGTGG - Intergenic
1201025405 Y:9699770-9699792 TAATCCTGGGAGAGGGCAAGTGG + Intergenic