ID: 1167469250

View in Genome Browser
Species Human (GRCh38)
Location 19:49666258-49666280
Sequence GATTTGCCCTGAAACCTCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 105}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167469243_1167469250 21 Left 1167469243 19:49666214-49666236 CCTCACAGCAGGCTGCGCGGCGA 0: 1
1: 0
2: 0
3: 10
4: 78
Right 1167469250 19:49666258-49666280 GATTTGCCCTGAAACCTCTTGGG 0: 1
1: 0
2: 0
3: 11
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167469250 Original CRISPR GATTTGCCCTGAAACCTCTT GGG Intronic
904091479 1:27947976-27947998 GTTTTGCCCTGAAAACTCCCTGG - Intronic
906478051 1:46183186-46183208 GATTTGCCTTTAACCCTCTCAGG - Intronic
907071039 1:51535089-51535111 GATTTACCCTCAAATGTCTTAGG - Intergenic
907965645 1:59325935-59325957 GAGTTTCCATAAAACCTCTTAGG - Intronic
908776348 1:67644630-67644652 GATTTACCCTGAAATCTCACTGG - Intergenic
913538035 1:119793084-119793106 GACTTGCCCAGAACCCTCTTAGG + Intergenic
916487307 1:165271153-165271175 GATTTGCCCTTATTTCTCTTTGG - Intronic
1065246815 10:23767248-23767270 GCTTTGCTCTGAAAGCTCTGGGG + Intronic
1065880948 10:30037189-30037211 AATTTGCTCTGAAAGCTCTCTGG + Intronic
1066795557 10:39116275-39116297 GATTTTCCCTTAAACCTCTATGG - Intergenic
1071041771 10:81318014-81318036 GCTTAGCCCTGAAATGTCTTGGG + Intergenic
1072326246 10:94301522-94301544 GATGATCCATGAAACCTCTTGGG - Intronic
1078254180 11:9643183-9643205 GACTTTTCCTGAAACCTCATTGG + Intergenic
1078362577 11:10680585-10680607 GAAATGCCCTAAACCCTCTTAGG + Intronic
1080183685 11:29453787-29453809 TATTTTCCCTGAAACTTCTCAGG + Intergenic
1081005066 11:37726081-37726103 GATTGGCACTGACACCACTTTGG + Intergenic
1081444169 11:43114103-43114125 CATATGCCCTGATTCCTCTTTGG + Intergenic
1081619890 11:44613233-44613255 CATTTGCCCTGAAAGGTCTCTGG + Intronic
1088685293 11:112280048-112280070 GATTGGCTCTGAAACCTCAGTGG + Intergenic
1092112111 12:5971190-5971212 GATTTCTACTGAAACCTCCTTGG - Intronic
1093989304 12:25572054-25572076 GATTTGCACTGAAACGTATCTGG - Intronic
1096840064 12:54374629-54374651 CATTTTCCCTGAAGCCTCTGTGG + Intronic
1101545869 12:105712219-105712241 GATTTGCACTCAAAGCTCTCTGG - Intergenic
1103480934 12:121249262-121249284 GATTTGCCCTGGGACTTCCTAGG - Intronic
1104118021 12:125769068-125769090 GACTTGCCCTTCAGCCTCTTGGG + Intergenic
1106920309 13:34556226-34556248 TCTTTGCCCTGAAAGCTCTTTGG + Intergenic
1109319181 13:60788980-60789002 GTATTTCCCTGGAACCTCTTTGG - Intergenic
1112183503 13:97107435-97107457 GCTTTGGCCTCTAACCTCTTGGG - Intergenic
1115008915 14:28521084-28521106 AATATCACCTGAAACCTCTTAGG - Intergenic
1116952148 14:50888575-50888597 CATGTGCACAGAAACCTCTTGGG + Intronic
1117404238 14:55386472-55386494 GATTTCCCTAGAAACTTCTTAGG + Intronic
1117749422 14:58904429-58904451 CATGTGCCCTTAAACCTCTGAGG - Intergenic
1121101058 14:91250630-91250652 CATTTTCCCTGGAACCTCTGAGG - Intronic
1124823107 15:33067314-33067336 TATTTTCCCTGAAACCTCCTGGG + Intronic
1135149145 16:19990241-19990263 GATTCTCCATGAAACATCTTTGG + Intergenic
1140667960 16:77244921-77244943 AATTTGCCCTAAAACATCTGTGG + Intergenic
1141186460 16:81791027-81791049 GTTTTGCTCTGAACCCTGTTTGG + Intronic
1142522179 17:512721-512743 TTTTTGCCATGAAAACTCTTCGG - Exonic
1142522189 17:512819-512841 GTTTTGCCATGAAAACTCTTTGG - Exonic
1142941958 17:3386861-3386883 GATTTGCCCTCACGCCTCTTGGG - Intergenic
1144028105 17:11296388-11296410 GTTTTGCCTTGAAATCTATTTGG - Intronic
1144715440 17:17432064-17432086 ACTTGGCCCTGAAGCCTCTTTGG - Intergenic
1146589082 17:34112723-34112745 GATGCTCCCTGAAGCCTCTTAGG + Intronic
1148246651 17:46035775-46035797 CACTTTCCCTGAAACTTCTTGGG + Intronic
1156208098 18:34907680-34907702 GATTTGCCCAGAACACTCTGTGG + Intergenic
1156635629 18:39025674-39025696 GATGTGCCTTCAAACCTCCTGGG + Intergenic
1158108631 18:53914561-53914583 GATTTCACCTGATACCTATTGGG - Intergenic
1160356399 18:78230915-78230937 GCTTTGCCATGAAACTTGTTTGG - Intergenic
1167469250 19:49666258-49666280 GATTTGCCCTGAAACCTCTTGGG + Intronic
930365699 2:50436587-50436609 TATCTGCCCTGAAACCTATCTGG - Intronic
931929262 2:67110720-67110742 TATTTGCCCTGAGATCTATTGGG - Intergenic
936045280 2:109182983-109183005 GATGAGCTCTGAAACCTGTTAGG - Intronic
938587300 2:132703857-132703879 GATTTGCCCAGAATACTATTAGG - Intronic
939222460 2:139319970-139319992 TATTGACCCTGAAATCTCTTGGG + Intergenic
940377016 2:152968544-152968566 GGTTTCCCCTGGAATCTCTTTGG + Intergenic
941708675 2:168688097-168688119 GAATTGCCATGCAACCTCCTAGG + Intronic
942615204 2:177784738-177784760 GGTTTGCCCTGTGACATCTTTGG + Intronic
944618981 2:201492739-201492761 TATTTCCCCTGAAAACTGTTTGG + Exonic
944681954 2:202085269-202085291 CCTTTGCCCTGTAACCTCTCAGG - Intronic
947620919 2:231590593-231590615 GGTTTGCCCTGTGACCTCTGAGG + Intergenic
947712115 2:232322183-232322205 CATTTGCTCTGAACCCTCTGAGG - Intronic
948387491 2:237590717-237590739 ACTTTGCCCTGAAACCTTCTGGG - Exonic
1169414560 20:5404918-5404940 AATTTGCCCTGAAACCCCAGAGG - Intergenic
1171107903 20:22453250-22453272 GATTTTCCCTGAAAGTTCTAAGG - Intergenic
1173522607 20:43710887-43710909 GATTTGCCCTCACACCTGTTTGG - Intronic
1177747166 21:25231277-25231299 GATTTGCACTAAAATCACTTGGG + Intergenic
1182862320 22:33570774-33570796 GATTAGCCATGCAACCTTTTGGG + Intronic
1183868661 22:40724006-40724028 GAATTGCCCCGAAAGCTCTTAGG + Intergenic
953960544 3:47262763-47262785 GTCTTGCCCTGAAGCATCTTTGG + Intronic
957527426 3:81395129-81395151 AATGTGCTCTCAAACCTCTTGGG + Intergenic
958942720 3:100333235-100333257 GGTTGACCCTGAAACCTCATAGG + Intergenic
959969611 3:112394626-112394648 GATTTGCCCTGAATTCTTTCTGG - Intergenic
960589286 3:119349981-119350003 TATTAGCACTGAAATCTCTTTGG - Intronic
961024215 3:123539086-123539108 GATTTTCCCTGAAAACTTTGGGG + Intronic
962197019 3:133372846-133372868 GATTTGCACTCAAAACTCCTTGG + Intronic
962829481 3:139127563-139127585 CCTTTGCCATGAAACCTGTTTGG - Intronic
964290282 3:155170819-155170841 GATATGGCCTGAAAACTCTCAGG + Intronic
969425237 4:7120481-7120503 GATTTTCCCTTACACCTCATTGG + Intergenic
972506641 4:39726048-39726070 GATTGCCTCTGAAACCTCTGGGG + Intronic
973151312 4:46891776-46891798 GTATTGCCCTGAAACATCTGTGG - Intronic
975317380 4:72970176-72970198 GCTTCTCCCTGAAACCTCTCAGG + Intergenic
976831166 4:89316191-89316213 GTTTTGCACTGAAACTGCTTAGG + Intergenic
981490200 4:145331360-145331382 GATTAGTCCTAAAACCCCTTTGG + Intergenic
983008377 4:162514668-162514690 GATTTGTCATGGAACCTCGTGGG + Intergenic
993773894 5:91966692-91966714 GATTTTCCCAGATATCTCTTGGG + Intergenic
1000475346 5:161700063-161700085 GATTTGCCATGAAACTTACTGGG - Intronic
1004413373 6:15402109-15402131 CCTTTGCCCTGAAACCTCTCTGG - Intronic
1004826226 6:19424468-19424490 GGTTTGCCCTGCTACCTCATGGG - Intergenic
1006973512 6:38073203-38073225 CATTAGTCCTGAAGCCTCTTAGG + Intronic
1007055816 6:38883442-38883464 GATTTCACCTGAAACATCATTGG - Exonic
1007639825 6:43329357-43329379 GATTTATCCTGAAAACTATTAGG - Intronic
1016370822 6:143372120-143372142 AATTTGCTCTAAAAACTCTTCGG - Intergenic
1018357947 6:163037595-163037617 GCTGTGACCTGAAACTTCTTCGG + Intronic
1020587110 7:10082450-10082472 GCTTTGCCTTTAAACCGCTTGGG + Intergenic
1022097709 7:27151236-27151258 GATTTGCCCCGAGAACTCCTCGG - Intronic
1022186627 7:27975480-27975502 CATTTGCCTTGAGACCTCTAGGG - Intronic
1024570949 7:50722365-50722387 TCTTTGCCCTGACACTTCTTTGG - Intronic
1025114625 7:56246980-56247002 GAATTGCCTTGAAATATCTTTGG - Intergenic
1030585525 7:111414004-111414026 GACTTGCCAGGAAACCACTTGGG - Intronic
1031211603 7:118835961-118835983 AATTTACCCTGAGACTTCTTGGG - Intergenic
1034220898 7:149445501-149445523 ATTTTACCCAGAAACCTCTTGGG + Intronic
1035775250 8:2182660-2182682 GTTGTGCCCTGATACCTCCTTGG + Intergenic
1039945163 8:42122606-42122628 GACTTGCCCTGAATTCTTTTTGG - Intergenic
1044927492 8:97222060-97222082 GACTTGCCGTGAATCCTCTGGGG - Intergenic
1046021455 8:108670346-108670368 GATTTGCCCTGCAATGTCTTTGG + Intronic
1048653941 8:136514360-136514382 GATCTGCCCTGTATCCACTTTGG + Intergenic
1049226860 8:141457486-141457508 GATTTGAACCCAAACCTCTTTGG + Intergenic
1051206135 9:14691278-14691300 CATTTTCCCGAAAACCTCTTTGG - Intronic
1055084431 9:72299570-72299592 GATCTGCCAGGAAACCACTTTGG - Intergenic
1060863461 9:126975529-126975551 GATTTGACCTGAAAGCTCAGAGG - Intronic
1187058933 X:15767330-15767352 TATTTACCCTGAAAGTTCTTGGG - Intronic
1187894645 X:23969031-23969053 AAACTGCCCTGAAAACTCTTCGG - Intergenic
1188224235 X:27577082-27577104 GATTTACCCTGAAATATCCTGGG - Intergenic
1189381048 X:40502410-40502432 GATTTGCACTGAAATCTCTCTGG + Intergenic
1199447678 X:147944775-147944797 GATTACCCCTGAAACGTCTCTGG + Intronic
1199655296 X:149988744-149988766 CCTTTGCTCTGAAACCTTTTAGG + Intergenic
1202098721 Y:21282308-21282330 GATTTACCTTGAAGCCACTTTGG + Intergenic