ID: 1167469952

View in Genome Browser
Species Human (GRCh38)
Location 19:49670153-49670175
Sequence GGCCCTCTATTGGCTGGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 351}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167469943_1167469952 2 Left 1167469943 19:49670128-49670150 CCTGAACCGGGAAGCCACGCCTC 0: 1
1: 0
2: 0
3: 1
4: 90
Right 1167469952 19:49670153-49670175 GGCCCTCTATTGGCTGGCCCCGG 0: 1
1: 0
2: 0
3: 14
4: 351
1167469939_1167469952 28 Left 1167469939 19:49670102-49670124 CCTAGAACCTTAGCATCTAGAAC 0: 1
1: 1
2: 1
3: 11
4: 130
Right 1167469952 19:49670153-49670175 GGCCCTCTATTGGCTGGCCCCGG 0: 1
1: 0
2: 0
3: 14
4: 351
1167469940_1167469952 21 Left 1167469940 19:49670109-49670131 CCTTAGCATCTAGAACGATCCTG 0: 1
1: 0
2: 0
3: 10
4: 77
Right 1167469952 19:49670153-49670175 GGCCCTCTATTGGCTGGCCCCGG 0: 1
1: 0
2: 0
3: 14
4: 351
1167469945_1167469952 -4 Left 1167469945 19:49670134-49670156 CCGGGAAGCCACGCCTCCCGGCC 0: 1
1: 0
2: 1
3: 34
4: 251
Right 1167469952 19:49670153-49670175 GGCCCTCTATTGGCTGGCCCCGG 0: 1
1: 0
2: 0
3: 14
4: 351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167469952 Original CRISPR GGCCCTCTATTGGCTGGCCC CGG Intronic
900134040 1:1106727-1106749 GCCCCTCTCTGGGCTGGCCGAGG + Intronic
900463618 1:2813212-2813234 GCCCCTCTCTGGGCTGGCCGAGG + Intergenic
900991931 1:6102054-6102076 GGCCCCCTCTTAGCTGGGCCTGG + Exonic
902032080 1:13430501-13430523 GCCCCTCTCTGGGCTGGCCGAGG + Intergenic
902876859 1:19345599-19345621 AGGCCTCTACTGGCAGGCCCAGG + Intronic
903375339 1:22862276-22862298 TGCCCTCCTTAGGCTGGCCCTGG + Intronic
903595341 1:24489946-24489968 GCCCCTCTCTGGGCTGGCCGAGG + Intergenic
903651225 1:24923488-24923510 GGCTCTCTGAGGGCTGGCCCTGG + Intronic
904664524 1:32109507-32109529 GGCCCTCTAGTGGTTGGGCAGGG + Intronic
904773348 1:32893197-32893219 GGCCCTCCACTGTCGGGCCCCGG + Intronic
904948309 1:34215315-34215337 GGCCCTGTCTAGTCTGGCCCTGG - Intronic
905684771 1:39900905-39900927 GGCCCCCTCTTGGATGGCTCGGG + Intronic
906056035 1:42917409-42917431 GCCCCTCTCTGGGCTGGCCGAGG - Intergenic
906477061 1:46176388-46176410 GGCCAGGTATGGGCTGGCCCAGG - Exonic
906636318 1:47412763-47412785 GGCCCTCTTTTCACAGGCCCTGG - Intergenic
906795673 1:48694717-48694739 GGACCCCTAATGCCTGGCCCAGG - Intronic
906876095 1:49541272-49541294 GCCCCTCTCTGGGCTGGCCGAGG + Intronic
908299872 1:62753370-62753392 GTCCCTCTCTGGGCTGGCCAAGG + Intergenic
908301049 1:62761452-62761474 GCCCCTCTCTGGGCTGGCCAAGG + Intergenic
909081453 1:71117492-71117514 TGCTCTCTCTTGGTTGGCCCTGG - Intergenic
909782338 1:79561946-79561968 GCCCCTCTCTGGGCTGGCCAAGG - Intergenic
910334282 1:86110498-86110520 GGCCCTCTCCGTGCTGGCCCAGG + Intronic
910694225 1:89995046-89995068 GGCCTGCTATTGGCTGACGCGGG - Intergenic
911188666 1:94927185-94927207 GGCCCTCCATTGGTCGGGCCCGG - Exonic
911655268 1:100436208-100436230 GACCATCTAATGGTTGGCCCTGG - Intronic
911839307 1:102660434-102660456 GCCCCTTTATGGGCTGGCCAAGG - Intergenic
912312937 1:108641282-108641304 GCCCCTTTTTGGGCTGGCCCAGG - Intronic
913178702 1:116298409-116298431 GCCCCTCTCTGGGCTGGCCGAGG - Intergenic
915972967 1:160366994-160367016 AGCTCTCCATTGGCTGGCCCAGG - Intergenic
916991678 1:170251162-170251184 GCCCCTCTCTGGGCTGGCCGAGG - Intergenic
918002189 1:180508540-180508562 GCCCCTCTCTGGGCTGGCCAAGG + Intergenic
918154520 1:181832354-181832376 GCCCCTCTCTGGGCTGGCCGAGG + Intergenic
918542758 1:185649349-185649371 GCCCCTCTCTGGGCTGGCCAAGG - Intergenic
918951952 1:191151364-191151386 GCCCCTTTCTTGGCTGGCCAAGG + Intergenic
920096339 1:203488691-203488713 CACCCTCCATTGCCTGGCCCAGG + Exonic
921983736 1:221286076-221286098 GGCCCTTTCTGGGCTGGCCAAGG - Intergenic
922166193 1:223117357-223117379 GGCCCTCTCTGGGCTGGCTGAGG - Intronic
922417018 1:225431304-225431326 GCCCCTCTCTGGGCTGGCCGAGG + Intergenic
922546798 1:226464136-226464158 GCCCCTCTCTGGGCTGGCCGAGG + Intergenic
922986581 1:229870568-229870590 TGCCCTCTCTGGGCTGGCACAGG + Intergenic
923386017 1:233465971-233465993 GCCCCTCTCTGGGCTGGCCGAGG + Intergenic
924633374 1:245763039-245763061 GGCTCTCTGCTGTCTGGCCCAGG - Intronic
1063848656 10:10160842-10160864 GCCCCTCTCTGGGCTGGCCGAGG + Intergenic
1064666137 10:17653868-17653890 GTATCTCTATTGGCTGGTCCTGG + Intronic
1065284840 10:24177119-24177141 GCCCCTCTCTGGGCTGGCCAAGG - Intronic
1065965892 10:30769841-30769863 GCCCCTCTCTGGGCTGGCCAAGG - Intergenic
1066568643 10:36748252-36748274 GCCCCTCTCTGGGCTGGCCGAGG + Intergenic
1066590613 10:36989711-36989733 GCCCCTCTCTGGGCTGGCCGAGG - Intergenic
1066648451 10:37634409-37634431 GCCCCTCTCTGGGCTGGCCGAGG + Intergenic
1068211279 10:53924121-53924143 GCCCCTCTCTGGGCTGGCCAAGG + Intronic
1068555012 10:58448677-58448699 GCCCCTCTCTGGGCTGGCCGAGG - Intergenic
1068821022 10:61377292-61377314 GCCCCTCTCTGGGCTGGCCAAGG - Intergenic
1069280894 10:66651863-66651885 GCCCCTCTCTGGGCTGGCCGAGG - Intronic
1071611063 10:87031386-87031408 GCCCCTCTCTGGGCTGGCCGTGG - Intergenic
1073262547 10:102201290-102201312 GCCCCTCTCTGGGCTGGCCGAGG - Intergenic
1075255564 10:120923763-120923785 GCCCCTTTCTTGGCTGGCCAAGG + Intergenic
1076835635 10:133019688-133019710 GGTCCCCCACTGGCTGGCCCAGG - Intergenic
1077341585 11:2028650-2028672 GGCCCTCCTTAGGCTGGCTCGGG + Intergenic
1079027362 11:16960040-16960062 TGCCCTCCTTTCGCTGGCCCAGG + Intronic
1079300735 11:19276812-19276834 TGACCTCTATTGCCTGGCCCTGG - Intergenic
1079803116 11:24896227-24896249 GCCCCTCTGTGGGCTGGCCGAGG + Intronic
1080223477 11:29934152-29934174 GCCCCTCTCTGGGCTGGCCAAGG + Intergenic
1080521203 11:33069000-33069022 GCCCATCTGTTGGGTGGCCCTGG - Intronic
1081046459 11:38279022-38279044 GACCCTCTCTGGGCTGGCCGAGG - Intergenic
1081136209 11:39442484-39442506 GCCCCTCTCTGGGCTGGCCGAGG - Intergenic
1081603527 11:44512072-44512094 TGTCCTCTATTGGCTGCCTCTGG + Intergenic
1081691858 11:45083661-45083683 GGCCCTCTGCTGGCTGAGCCCGG - Intergenic
1082734862 11:56845122-56845144 GCCCCTCTCTGGGCTGGCCGAGG + Intergenic
1083683995 11:64365300-64365322 GGGCCTCGATTGGGTGGCTCTGG + Exonic
1083686833 11:64381527-64381549 GGCCCACTAGTGGCTCACCCAGG - Intergenic
1083784393 11:64935412-64935434 GGTCCTCTATCTGCTGGTCCTGG - Exonic
1084039032 11:66530995-66531017 GGCGCTCTATTCCCTGCCCCGGG + Exonic
1084704143 11:70806197-70806219 GGCCCTCCAATGGCAGGGCCCGG + Intronic
1084904293 11:72334266-72334288 GCCCCTGTGCTGGCTGGCCCAGG - Intronic
1085447301 11:76609451-76609473 GCCCCTTTATGGGCTGGCCAAGG - Intergenic
1085687637 11:78638786-78638808 GCCCCTCTCTGGGCTGGCCAAGG + Intergenic
1086200418 11:84195007-84195029 GCCCCTCTCTGGGCTGGCCGAGG - Intronic
1087400949 11:97667021-97667043 GCCCCTCTCTGGGCTGGCCAAGG + Intergenic
1087441236 11:98185640-98185662 GCCCCTCTCTGGGCTGGCCTAGG - Intergenic
1087682396 11:101231757-101231779 GCCCCTCTCTGGGCTGGCCGAGG - Intergenic
1088737795 11:112742582-112742604 AGCCCTCTACTGGCTTCCCCTGG + Intergenic
1088844018 11:113649735-113649757 GACCCTCTCTGGGCTGGCCGAGG - Intergenic
1090558196 11:127898989-127899011 GCCCCTCTCTGGGCTGGCCGAGG - Intergenic
1090586243 11:128215693-128215715 GCCCCTCTCTGGGCTGGCCAAGG - Intergenic
1202824571 11_KI270721v1_random:83839-83861 GGCCCTCCTTAGGCTGGCTCGGG + Intergenic
1093443828 12:19230776-19230798 GCCCCTCTCTGGGCTGGCCAAGG - Intronic
1094108733 12:26839117-26839139 GCCCCTCTCTGGGCTGGCCGAGG + Intergenic
1095700173 12:45183434-45183456 TGCCCTCTATTGAATTGCCCTGG - Intergenic
1098469095 12:70823787-70823809 GGCCCTCTCTTGGCTGCTGCTGG - Intronic
1099190909 12:79561479-79561501 GCCCCTCTCTGGGCTGGCCAAGG + Intergenic
1104198710 12:126566999-126567021 GACCCTCTCTGGGCTGGCCAAGG + Intergenic
1104373822 12:128247186-128247208 GCCCCTCTCTGGGCTGGCCGAGG + Intergenic
1106555331 13:30804043-30804065 TGCCCTCCTTGGGCTGGCCCAGG + Intergenic
1108362350 13:49678700-49678722 GCCCCTCTCTGGGCTGGCCGCGG - Intronic
1109534137 13:63693965-63693987 GCCCCTCTCTGGGCTGGCCAAGG - Intergenic
1109854359 13:68108137-68108159 GCCCCTCTCTGGGCTGGCCGAGG - Intergenic
1110103128 13:71634514-71634536 AGCCCTCTATGTCCTGGCCCCGG + Intronic
1113458807 13:110467554-110467576 GGGCTTCTATCTGCTGGCCCAGG + Intronic
1115174649 14:30547939-30547961 GCCCCTCTCTGGGCTGGCCGAGG - Intergenic
1115284196 14:31700484-31700506 GCCCCTCTCTGGGCTGGCCAAGG + Intronic
1115520434 14:34228218-34228240 GGCCCTGGATTGGGTGGCTCTGG - Intronic
1115533286 14:34346221-34346243 GCCCCTCTCTGGGCTGGCCAAGG - Intronic
1116310953 14:43326543-43326565 GCCCCTCTCTGGGCTGGCCGAGG + Intergenic
1116756510 14:48955357-48955379 GTCCCTCTATTGACTGGAGCTGG - Intergenic
1117727392 14:58687674-58687696 GCCCCTCTCTGGGCTGGCCAAGG - Intergenic
1118853775 14:69605626-69605648 GTCCCTCTTTTGGCTGGCCAGGG - Intergenic
1121145319 14:91577891-91577913 GCCCCTCTCTGGGCTGGCCAAGG + Intergenic
1122434924 14:101689020-101689042 GCCCCTCTCTGGGCTGGCCGAGG + Intergenic
1122859774 14:104577356-104577378 GGCCCTTTCTTCTCTGGCCCAGG + Intronic
1122894877 14:104751907-104751929 GCCCCTCTCTGGGCTGGCCGCGG - Intergenic
1126165584 15:45651426-45651448 GCCCCTCTATGGGCTGGCAGGGG - Intronic
1126997527 15:54462394-54462416 GCCCCTCTCTGGGCTGGCCAAGG + Intronic
1127916381 15:63459003-63459025 GCCCCTCTCTGGGCTGGCCGAGG + Intergenic
1129530265 15:76259612-76259634 GCCCGTCAAGTGGCTGGCCCTGG - Intronic
1131005029 15:88971009-88971031 GCCCCTCTCTGGGCTGGCCGAGG - Intergenic
1131912531 15:97224186-97224208 GCCCCTCTCTGGGCTGGCCGAGG + Intergenic
1132740200 16:1408315-1408337 CGCCCGCGATTGGCTGTCCCGGG - Intronic
1134018569 16:10906428-10906450 GGCCTTGTGGTGGCTGGCCCTGG + Intronic
1135470257 16:22723363-22723385 GCCCCTCTCTGGGCTGGCCGAGG - Intergenic
1136172743 16:28498315-28498337 GGCCTTCTCCTGGCTGGCACCGG - Exonic
1136356587 16:29748297-29748319 GCCCCTCTCTGGGCTGGCCGAGG + Intergenic
1138335988 16:56253136-56253158 GGCCCCCTCTTGCCTGGCCCAGG + Intronic
1138551849 16:57752756-57752778 GGCCATCTCTCGCCTGGCCCAGG + Exonic
1138889936 16:61129202-61129224 GGCACTCTCTGGGCTGGCCGAGG - Intergenic
1139518299 16:67464810-67464832 GGCCAGCTCTTGCCTGGCCCTGG - Intronic
1141034071 16:80612769-80612791 GGCCATCAATGGGCCGGCCCTGG - Exonic
1144960838 17:19043075-19043097 GCCCCTGTATTGGCCCGCCCTGG - Intronic
1144974322 17:19131449-19131471 GCCCCTGTATTGGCCCGCCCTGG + Intronic
1145035509 17:19537759-19537781 AGCCCTCTATGGCCTGGCCCTGG + Intronic
1145050361 17:19654737-19654759 GCCCCTCTCTGGGCTGGCCAAGG - Intronic
1145223097 17:21105257-21105279 GCACCTCCAGTGGCTGGCCCAGG + Intergenic
1145982024 17:29018550-29018572 AGCCCTTTATGTGCTGGCCCAGG - Intronic
1146278736 17:31531510-31531532 TGCCCTCTATTGTCAGGCACTGG + Intronic
1147661305 17:42118453-42118475 GTCCCTCTGCTGCCTGGCCCAGG - Intronic
1147669717 17:42169938-42169960 TGCCCACTATGTGCTGGCCCTGG - Intronic
1148653467 17:49266262-49266284 GGCCATGTATTGGCTGGGCATGG - Intergenic
1151840705 17:76615331-76615353 GCCCCTCTCTGGGCTGGCCGAGG - Intergenic
1151983238 17:77526487-77526509 GCCCCTCTCTGGGCTGGCCGAGG - Intergenic
1153868639 18:9296788-9296810 GCCCCTCTCTGGGCTGGCCGTGG + Intergenic
1154231204 18:12557565-12557587 GCCCCTCTCTGGGCTGGCCAAGG - Intronic
1154294163 18:13135089-13135111 GCCCCTCTCTGGGCTGGCCGAGG - Intergenic
1154410738 18:14140853-14140875 TGCCCTCTGTGGGGTGGCCCAGG + Intergenic
1156243096 18:35272046-35272068 GCCCCTCTCTGGGCTGGCCGAGG - Intronic
1156629108 18:38944824-38944846 GCCCCTCTCTGGGCTGGCCAAGG - Intergenic
1156651893 18:39235286-39235308 GCCCCTCTCTAGGCTGGCCGAGG + Intergenic
1156657772 18:39309032-39309054 GCCCCTCTCTGGGCTGGCCGAGG + Intergenic
1157130148 18:44999268-44999290 AGCCCTATAGTGGCTGACCCAGG + Intronic
1157639649 18:49201585-49201607 GGCCCTCGAGAGTCTGGCCCTGG + Intronic
1157935237 18:51864788-51864810 GCCCCTCTCTGGGCTGGCCGAGG - Intergenic
1159109753 18:64042925-64042947 GCCCCTCTCTGGGCTGGCCGAGG + Intergenic
1160824816 19:1074631-1074653 GTCCATCTACTCGCTGGCCCTGG + Exonic
1161442895 19:4302474-4302496 GGACGTCTGTTGTCTGGCCCTGG - Intergenic
1161849828 19:6732504-6732526 GGCCTTCGATGGGGTGGCCCTGG + Exonic
1162091143 19:8280773-8280795 GTCCCTCTCTGGGCTGGCCGAGG - Intronic
1162093377 19:8295611-8295633 GTCCCTCTCTGGGCTGGCCGAGG - Intronic
1162262998 19:9547761-9547783 GCCCCTCTCTGGGCTGGCCAAGG + Intergenic
1162523078 19:11193353-11193375 GGCCCGCTGTGGGGTGGCCCAGG + Exonic
1162584592 19:11551340-11551362 GGCCCTTTACTGACTGGCACAGG + Intronic
1163368620 19:16889706-16889728 CGCCCTCTATGGGCTGGTCCTGG + Exonic
1164078843 19:21845320-21845342 GGCCCCCTGTGGGCAGGCCCAGG + Intronic
1164294458 19:23897399-23897421 GGCCCTCTGTTGAAAGGCCCAGG - Intergenic
1165396895 19:35569408-35569430 TGCCCTGCATTGCCTGGCCCAGG + Intergenic
1166333243 19:42090717-42090739 TGCCCTGTCTTCGCTGGCCCAGG + Exonic
1167469952 19:49670153-49670175 GGCCCTCTATTGGCTGGCCCCGG + Intronic
1167793682 19:51695547-51695569 GGCCTTCTCCAGGCTGGCCCTGG - Intergenic
1168076125 19:53981808-53981830 GGCCCACTCTTAGCTGGCCCAGG - Intronic
924967324 2:90931-90953 GCCCCTTTATGGGCTGGCCGAGG + Intergenic
925099029 2:1230016-1230038 GCCCCTCTCTGGGCTGGCCAAGG - Intronic
925532924 2:4884166-4884188 GACCCTCTCTGGGCTGGCCGAGG + Intergenic
926437720 2:12854491-12854513 GCCCCTCTCTGGGCTGGCCGAGG - Intergenic
927250089 2:20989365-20989387 TGCCCTCCCTTGGCTGGGCCTGG - Intergenic
928599241 2:32886988-32887010 GACCCTCTCTGGGCTGGCCGAGG - Intergenic
928688502 2:33775288-33775310 GCCCCTCTCTGGGCTGGCCAAGG + Intergenic
929311782 2:40434062-40434084 GGCTTTTTCTTGGCTGGCCCAGG - Intronic
929375457 2:41281621-41281643 GGCCCTCTCCTGCCTGCCCCAGG + Intergenic
930420939 2:51152041-51152063 GCCCCTCTCTGGGCTGGCCGAGG - Intergenic
932303753 2:70686986-70687008 CGCCCTCTCCTGGCTGGCCTAGG - Intronic
932866946 2:75353665-75353687 GGCCCTCTAGTTGTTGGACCTGG - Intergenic
935922500 2:108031502-108031524 GCCCCTCTCTGGGCTGGCCGAGG + Intergenic
938035017 2:128028110-128028132 TCCCGTCTATTGGCTGGCGCAGG + Intronic
938597298 2:132801055-132801077 TGCCCTTTCTTGCCTGGCCCAGG + Intronic
939085621 2:137715736-137715758 GCCCCTCTCTGGGCTGGCCAAGG + Intergenic
941878660 2:170460045-170460067 GCCCCTCTCTGGGCTGGCCGAGG - Intronic
942170313 2:173283009-173283031 GCCCCTCTCTGGGCTGGCCAAGG - Intergenic
942619968 2:177835612-177835634 GCCCCTCTCTGGGCTGGCCAAGG + Intronic
945664277 2:212721484-212721506 GCCCCTCTCTGGGCTGGCCAAGG - Intergenic
945744258 2:213701496-213701518 GCCCCTCTCTGGGCTGGCCAAGG + Intronic
945869094 2:215207813-215207835 GCCCCTCTCTGGGCTGGCCAAGG + Intergenic
946180180 2:217944146-217944168 GGCCCACTGCTGGCTGGCTCCGG - Intronic
946339427 2:219058400-219058422 GGCCCCCCATTGGGCGGCCCTGG - Intronic
946929089 2:224655237-224655259 GCCCCTCTCTGGGCTGGCCGTGG + Intergenic
948648711 2:239425520-239425542 GGCCCTCCAGTGGCGTGCCCAGG + Intergenic
949072311 2:242033107-242033129 TGCCCTCTCTTGGGTGACCCCGG - Intergenic
1168785707 20:538290-538312 GATTCTCTATTGGCTGGACCAGG + Intronic
1169988664 20:11474557-11474579 AGCCCACTGTTGGCTGCCCCAGG - Intergenic
1170160189 20:13302816-13302838 GGCCCTCTAGTGGCTGCACATGG + Intergenic
1171339663 20:24417572-24417594 CGCCCTTTATTGTCTGTCCCAGG + Intergenic
1173313394 20:41920918-41920940 GGCTCTCTCTTGGCAGACCCAGG + Intergenic
1173473347 20:43340284-43340306 GGCCTTCTATTGGGAGGCCGAGG - Intergenic
1176033672 20:63026035-63026057 GACCCTCACTAGGCTGGCCCGGG + Intergenic
1176862325 21:14017565-14017587 TGCCCTCTGTGGGGTGGCCCAGG - Intergenic
1176872306 21:14093391-14093413 GCCCCTTTCTTGGCTGGCCGAGG - Intergenic
1177565885 21:22819261-22819283 GGCCCTTTCTGGGCTGGCCAAGG - Intergenic
1179321935 21:40300537-40300559 GGCCCTCTCTTTGCTGTCTCAGG + Intronic
1181585074 22:23848736-23848758 GGCCCTGTGTTGGCTGGGCGCGG + Intergenic
1181800936 22:25347328-25347350 GCCCCTCTCTGGGCTGGCCGAGG - Intergenic
1181851432 22:25752770-25752792 GCCCCTCTCTAGGCTGGCCGAGG + Intronic
1183380056 22:37486168-37486190 GGCACTGCATTGGTTGGCCCTGG + Exonic
949281434 3:2352333-2352355 GCCCCTCTCTGGGCTGGCCGAGG + Intronic
949292703 3:2484853-2484875 GCCCCTCTCTGGGCTGGCCGAGG + Intronic
951203666 3:19902640-19902662 GGATCTCTATTGGCTGGGCATGG - Intronic
951323252 3:21272042-21272064 GCCCCTCTCTGGGCTGGCCAAGG - Intergenic
951415385 3:22416891-22416913 GCCCCTCTCTGGGCTGGCCGAGG + Intergenic
953096223 3:39779689-39779711 GCCCCTCTCTGGGCTGGCCGAGG + Intergenic
953422982 3:42769652-42769674 GACCCTCTCTGGGCTGGCCAAGG + Intronic
954302364 3:49706686-49706708 GGCCCTCTAGTGCCTGGAGCAGG - Intronic
957209486 3:77240505-77240527 GCCCCTCTCTGGGCTGGCCGAGG - Intronic
959422685 3:106148566-106148588 GCCCCTTTCTTGGCTGGCCAAGG + Intergenic
960487264 3:118269621-118269643 GGCCTTCTCTGGGCTGGCCGAGG + Intergenic
961268724 3:125671617-125671639 GCCCCTCTCTGGGCTGGCCGAGG + Intergenic
961700854 3:128743344-128743366 GCCCCTCTCTGGGCTGGCCAAGG - Intronic
961932371 3:130547483-130547505 GCCCCTCTCTAGGCTGGCCAAGG - Intergenic
961957093 3:130815253-130815275 GCCCCTCTCTGGGCTGGCCAAGG - Intergenic
963397827 3:144756825-144756847 GCCCCTCTCTGGGCTGGCCAAGG + Intergenic
963554602 3:146772285-146772307 GCCCCTCTCTGGGCTGGCCGAGG + Intergenic
963583285 3:147154026-147154048 GCCCCTCTCTGGGCTGGCCGAGG + Intergenic
964138413 3:153370180-153370202 GCCCCTCTCTGGGCTGGCCGAGG - Intergenic
965586936 3:170327381-170327403 GCCCCTCTCTGGGCTGGCCGAGG + Intergenic
965744267 3:171907471-171907493 GCCCCTCTCTGGGCTGGCCAAGG - Intronic
966186208 3:177228981-177229003 GCCCCTCTCTGGGCTGGCCGGGG - Intergenic
967106620 3:186259695-186259717 AGCCCTCTACTGGCCGGCCCCGG - Intronic
967594973 3:191317422-191317444 GCCCCTCTGTGGGCTGGCCAAGG - Intronic
968540773 4:1167299-1167321 GGCCCTCTGGTGGCCGGCACGGG - Exonic
968907574 4:3461801-3461823 GGCCCCCAAGGGGCTGGCCCAGG - Intergenic
969613632 4:8240272-8240294 GGCCCTCCATGGGCCGGGCCAGG - Intronic
970408688 4:15787126-15787148 GACCCTCTCTGGGCTGGCCCAGG - Intronic
970615816 4:17767227-17767249 GCCCCTCTCTGGGCTGGCCCAGG - Intronic
971722521 4:30264629-30264651 GCCCCTCTCTGGGCTGGCCAAGG + Intergenic
972890418 4:43551153-43551175 GCCCCTCTCTGGGCTGGCCAAGG + Intergenic
974089937 4:57300590-57300612 GCCCCTCTCTGGGCTGGCCGAGG - Intergenic
974147361 4:57965364-57965386 GCCCCTTTCTTGGCTGGCCAAGG + Intergenic
974147655 4:57967134-57967156 GCCCCTCTCTGGGCTGGCCGAGG + Intergenic
974439514 4:61898543-61898565 GGCCCAAGATTGGCTGGACCAGG + Intronic
975754770 4:77561827-77561849 GCCCCTCTCTGGGCTGGCCGAGG + Intronic
976690662 4:87864085-87864107 GCCCCTCTCTGGGCTGGCCAAGG - Intergenic
977416626 4:96742517-96742539 GCCCCTCTCTGGGCTGGCCGAGG + Intergenic
977641114 4:99359618-99359640 GCCCCTCTCTGGGCTGGCCAAGG + Intergenic
977915306 4:102585953-102585975 AGCCCTCTTTAGCCTGGCCCTGG - Intronic
978030538 4:103936717-103936739 GCCCCTCTCTGGGCTGGCCGAGG + Intergenic
978809032 4:112830746-112830768 GCCCCTCTCTGGGCTGGCCAAGG + Intronic
978886494 4:113772275-113772297 GCCCCTCTCTGGGCTGGCCAAGG + Intergenic
979295388 4:119027006-119027028 GGCCCTTTAGTGGCTCTCCCGGG + Exonic
979865162 4:125744931-125744953 GCCCCTCTCTGGGCTGGCCGAGG + Intergenic
983752788 4:171298208-171298230 GCCCCTTTATGGGCTGGCCAAGG + Intergenic
983835449 4:172377960-172377982 GCCCCTCTCTGGGCTGGCCGAGG - Intronic
984862427 4:184252879-184252901 GTCCCTCTCTGGGCTGGCCGAGG + Intergenic
985409219 4:189665161-189665183 GCCCCTCTCTGGGCTGGCCGAGG - Intergenic
985590838 5:764326-764348 GTCCCTCTCTGGGCTGGCCGAGG + Intronic
986782092 5:11075642-11075664 GCCCCTCCACTGGCTGCCCCGGG - Intronic
987488879 5:18552117-18552139 GCCCCTCTCTGGGCTGGCCAAGG - Intergenic
987709768 5:21492316-21492338 TGCCCTTCACTGGCTGGCCCTGG - Intergenic
990510808 5:56487737-56487759 GCCCCTCTCTGGGCTGGCCGAGG + Intergenic
990512205 5:56499076-56499098 GCCCCTCTCTGGGCTGGCCAAGG - Intergenic
992050304 5:72935178-72935200 GCCCCTCTCTGGGCTGGCCGAGG + Intergenic
994570247 5:101505967-101505989 GCCCCTCTCTGGGCTGGCCGAGG + Intergenic
995206707 5:109488223-109488245 GTCCCTCTCTGGGCTGGCCGAGG - Intergenic
995396048 5:111688378-111688400 GGCCTTCAACTGCCTGGCCCTGG + Intronic
995582578 5:113617257-113617279 GCCCCTCTCTGGGCTGGCCCAGG + Intergenic
995678854 5:114695395-114695417 GCCCCTCTCTGGGCTGGCCGAGG + Intergenic
996394977 5:123004648-123004670 GGCCCTCTGTGGCCTGCCCCAGG + Intronic
996482998 5:123996935-123996957 GATCCTCTGTTGCCTGGCCCTGG - Intergenic
998252123 5:140560514-140560536 GGCCCTCTAGTGACTAGGCCTGG - Intronic
1000085811 5:157886796-157886818 GCCCCTCTCTGGGCTGGCCGAGG + Intergenic
1002556572 5:180046260-180046282 GCCCCTCTCTGGGCTGGCCGAGG - Intronic
1002567648 5:180120706-180120728 GGGCCTCGTTTGGCTGGCTCGGG - Intronic
1004354024 6:14915929-14915951 GGCCCTCTCTGAGCTGGCCGAGG + Intergenic
1004483277 6:16040738-16040760 GCCCCTCTCTGGGTTGGCCCAGG - Intergenic
1004607418 6:17206823-17206845 GCCCCTCTCTGGGCTGGCCAAGG - Intergenic
1005114328 6:22318824-22318846 GCCCCTCTCTGGGCTGGCCGAGG - Intergenic
1006007767 6:31016732-31016754 GACCCTCTCTGGGCTGGCCGAGG + Intronic
1006348427 6:33502659-33502681 GCCCCTCTCTGGGCTGGCCGAGG + Intergenic
1006458160 6:34143734-34143756 CGTCCACCATTGGCTGGCCCCGG + Intronic
1006497951 6:34437426-34437448 GCCCCTCTCTGGGCTGGCCGAGG - Intergenic
1008253471 6:49268870-49268892 GGCCTCCTATTGGCTGGGCACGG + Intergenic
1009739232 6:67722993-67723015 GACCCTCTCTGGGCTGGCCGAGG + Intergenic
1011129381 6:84037862-84037884 GCCCCTCTCTGGGCTGGCCGAGG - Intronic
1011200000 6:84825684-84825706 GGAACTCAATTGGCTGACCCAGG + Intergenic
1011931752 6:92723438-92723460 GCCCCTCTCTGGGCTGGCCAAGG + Intergenic
1012144971 6:95669982-95670004 GCCCCTCTCTGGGCTGGCCGAGG + Intergenic
1013582622 6:111551218-111551240 AGCCCTCAGCTGGCTGGCCCTGG + Intergenic
1013957190 6:115855137-115855159 GCCCCTCTCTGGGCTGGCCAAGG + Intergenic
1014462339 6:121711633-121711655 GGAGCTCTATGGGCTGTCCCTGG - Intergenic
1014586255 6:123201898-123201920 GCCCCTCTCTGGGCTGGCCGAGG + Intergenic
1014798259 6:125749474-125749496 GGCTCGCGATTGGCTGGGCCAGG - Intronic
1015682180 6:135820511-135820533 GCCCCTCCATTGGCTGGTGCCGG + Intergenic
1016184638 6:141183456-141183478 GCCCCTCTCTGGGCTGGCCGAGG + Intergenic
1016722966 6:147323915-147323937 GACCCTCTAAAGTCTGGCCCTGG + Intronic
1018047634 6:159979294-159979316 GGCACTCTATTTGCAGGCCAGGG - Intronic
1018109453 6:160520687-160520709 GCCCCTCTCTGGGCTGGCCGAGG - Intergenic
1018898922 6:168041291-168041313 GGCCCACTCTGGGCTGGCCAGGG - Intronic
1019086173 6:169479976-169479998 GCCCCTCTCTGGGCTGGCCAAGG + Intronic
1019395674 7:816591-816613 GGCCCGCGATTGGCTGGCGTGGG + Intergenic
1019618407 7:1977538-1977560 GCCCCTCTCTGGGCTGGCCGAGG - Intronic
1019965804 7:4497346-4497368 GCCCCTTTATGGGCTGGCCAAGG - Intergenic
1020662253 7:10995947-10995969 GCCCCTCTCTGGGCTGGCCGAGG - Intronic
1021133823 7:16942929-16942951 GCCCCTCTCTGGGCTGGCCATGG + Intergenic
1021567334 7:22028620-22028642 GCCCCTCTCTGGGCTGGCCAAGG + Intergenic
1021567939 7:22032744-22032766 GCCCCTCTCTGGGCTGGCCAAGG - Intergenic
1021788311 7:24174655-24174677 TGCTCTCTATTGGGAGGCCCAGG + Intergenic
1023377943 7:39577383-39577405 GCCCCTCTCTGGGCTGGCCGAGG + Intronic
1024748256 7:52431659-52431681 GCCCCTCTCTTGGCTGGCCGAGG - Intergenic
1026098391 7:67364931-67364953 GCCCCTCTCTGGGCTGGCCGAGG - Intergenic
1026923616 7:74174094-74174116 GGCCCATTATGTGCTGGCCCTGG - Intergenic
1027668697 7:81071049-81071071 GTCCCTCTCTGGGCTGGCCGAGG + Intergenic
1028727119 7:94100833-94100855 GCCCCTCTCTGGGCTGGCCTAGG + Intergenic
1028857156 7:95605346-95605368 GCCCCTCTCTGGGCTGGCCGAGG + Intergenic
1032253499 7:130278215-130278237 CCCCCTCTAGTGGCTGGCTCAGG - Intronic
1033779269 7:144650360-144650382 GCCCCTCTCTGGGCTGGCCGAGG + Intronic
1034270908 7:149803070-149803092 TGCCCTCTCTTGGGAGGCCCCGG - Intergenic
1035325363 7:158062511-158062533 GCCCCTCTCTGGGCTGGCCAAGG + Intronic
1036928710 8:12931722-12931744 GCCCCACTTTGGGCTGGCCCAGG - Intergenic
1037239560 8:16760926-16760948 GCCCCTCTCTGGGCTGGCCAAGG - Intergenic
1037958124 8:23074554-23074576 AGCTCTTTAGTGGCTGGCCCTGG + Intergenic
1040000817 8:42575155-42575177 GCCCCTCTCTGGGCTGGCCGAGG + Intergenic
1040003752 8:42600482-42600504 GCCCCTCTCTGGGCTGGCCAAGG - Intergenic
1040794119 8:51271163-51271185 GGCCCTCTCTGGGCTGGCCAAGG + Intergenic
1040806890 8:51405199-51405221 GCCCCTTTCTGGGCTGGCCCAGG - Intronic
1040952835 8:52953753-52953775 GCCCCTCTCTGGGCTGGCCGAGG + Intergenic
1041588315 8:59547061-59547083 GCCCCTCTCTGGGCTGGCCGAGG + Intergenic
1041623502 8:59999804-59999826 GCCCCTCTCTGGGCTGGCCGAGG + Intergenic
1042169529 8:65978200-65978222 GCCCCTCTCTGGGCTGGCCAAGG - Intergenic
1042877003 8:73449079-73449101 AGGCCGCTGTTGGCTGGCCCAGG - Intronic
1043844865 8:85152613-85152635 GCCCCTCTCTGGGCTGGCCGAGG + Intergenic
1044123724 8:88431317-88431339 GGGCCTATAATGGCTGGCCAAGG - Intergenic
1044459703 8:92429650-92429672 GCCCCTCTCTGGGCTGGCCAAGG - Intergenic
1045096164 8:98800527-98800549 GCCCCTCTCTGGGCTGGCCAAGG + Intronic
1046497715 8:115036648-115036670 GCCCCTCTCTGGGCTGGCCGAGG + Intergenic
1046521449 8:115330984-115331006 GCCCCTCTCTGGGCTGGCCAAGG - Intergenic
1047631764 8:126715056-126715078 GCCCCTCTCTGGGCTGGCCAAGG - Intergenic
1048072824 8:131040045-131040067 GCCCCTCTACTCGCTGGGCCCGG - Exonic
1048593359 8:135842093-135842115 GGCTCTCTATGGCCTGGTCCAGG + Intergenic
1049309195 8:141924396-141924418 GGCCCTGTCATGGCTGCCCCAGG - Intergenic
1049749572 8:144276850-144276872 GGCCCTCTGCTGGCTGGACTGGG - Intronic
1049944568 9:581195-581217 GCCCCTCTCTGGGCTGGCCGAGG - Intronic
1055925568 9:81507314-81507336 GCCCCTCTCTGGGCTGGCCGAGG + Intergenic
1055985558 9:82054753-82054775 AGCCCTCTCTGGGCTGGCCGAGG - Intergenic
1056024602 9:82480245-82480267 GGCCCTATATTGGATGGACAAGG + Intergenic
1056239697 9:84632205-84632227 GGCCCTACATAGGCTGGACCTGG + Intergenic
1058309458 9:103483653-103483675 GCCCCTCTCTGGGCTGGCCACGG + Intergenic
1058365128 9:104200534-104200556 GCCCCTCTCTGGGCTGGCCAAGG + Intergenic
1060311438 9:122466113-122466135 GGCCCAATATTGAATGGCCCAGG + Intergenic
1060437195 9:123604113-123604135 GGCCCTGGATGGGCTGGGCCTGG + Intronic
1061167904 9:128934947-128934969 GGCTCTCTACTGCCTGGCCTGGG + Intronic
1061367937 9:130182223-130182245 GGCCATCGATTGGCTGGCTGGGG - Intronic
1061931195 9:133833998-133834020 GCCAGTCTAATGGCTGGCCCGGG - Intronic
1062103865 9:134742094-134742116 GTGCCTCCACTGGCTGGCCCTGG + Intronic
1062611029 9:137373500-137373522 GGCCCTCTCCCCGCTGGCCCCGG + Exonic
1062668412 9:137691893-137691915 GGCCCTGTGTTTCCTGGCCCTGG + Intronic
1188263147 X:28040797-28040819 GCCCCTCTTGTGGCTGCCCCAGG - Intergenic
1189376880 X:40473544-40473566 GGCTGTCTAGTGGCTGGCCCTGG - Intergenic
1192022415 X:67408600-67408622 GCCCCTCTCTGGGCTGGCCGAGG + Intergenic
1193719928 X:84974834-84974856 GCCCCTCTCTGGGCTGGCCGAGG + Intergenic
1194444712 X:93973752-93973774 GCCCCTCTCTGGGCTGGCCAAGG + Intergenic
1199094897 X:143726638-143726660 GCCCCTCTCTGGGCTGGCCGAGG - Intergenic
1200213976 X:154359366-154359388 GGCCCTCTACAGCCAGGCCCAGG + Exonic
1201499638 Y:14627721-14627743 GCCCCTCTCTGGACTGGCCCAGG - Intronic