ID: 1167470384

View in Genome Browser
Species Human (GRCh38)
Location 19:49672461-49672483
Sequence TCTCTGAGCAGCGGAGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 274}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167470374_1167470384 30 Left 1167470374 19:49672408-49672430 CCCTGTGGTCACGGTGAGTGACA 0: 1
1: 0
2: 0
3: 19
4: 124
Right 1167470384 19:49672461-49672483 TCTCTGAGCAGCGGAGGGACAGG 0: 1
1: 0
2: 1
3: 21
4: 274
1167470375_1167470384 29 Left 1167470375 19:49672409-49672431 CCTGTGGTCACGGTGAGTGACAA 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1167470384 19:49672461-49672483 TCTCTGAGCAGCGGAGGGACAGG 0: 1
1: 0
2: 1
3: 21
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167470384 Original CRISPR TCTCTGAGCAGCGGAGGGAC AGG Intronic
900043975 1:492351-492373 TCTCTCAGCATGGGAGGGGCCGG + Intergenic
900402124 1:2476887-2476909 CCTCTGAGCGGCTGAGGGGCAGG - Intronic
900683477 1:3931980-3932002 TCTCTGAGCACGGGAGGGGAAGG - Intergenic
901318377 1:8324096-8324118 TCTCTGAGTAGGGAAGGCACTGG + Intronic
902742914 1:18452382-18452404 TCTCTGAGCCACTGAGGGAGGGG + Intergenic
905105062 1:35559059-35559081 TCCCTCTGCAGAGGAGGGACGGG - Intronic
905390095 1:37630673-37630695 CATCTGATCAGGGGAGGGACCGG - Intronic
907245450 1:53105700-53105722 TCTCTGGGCAGTGGAGGGGAGGG - Intronic
910718499 1:90258366-90258388 TCTGTGAGCAGGGCAGGGAAAGG - Intergenic
912208323 1:107532583-107532605 TCTCTGAACAGGGGAGCGAGTGG + Intergenic
916254562 1:162773474-162773496 TCTCTGTGAAGTGGAGGGAATGG + Exonic
917533099 1:175854744-175854766 TCTGTGAGCTGGGGAGGGATGGG - Intergenic
917974554 1:180230384-180230406 TCCCTGAGAAGCGGAGGGCCCGG + Exonic
920439847 1:205972623-205972645 TCTCAGAGGAGCCCAGGGACGGG - Intergenic
921101228 1:211931132-211931154 GCTCTGAGCAGTGGAGAGGCTGG - Intergenic
1062899322 10:1130482-1130504 TCACTCAGCAGTGGCGGGACTGG - Exonic
1063377714 10:5563969-5563991 TCTCTGAGCAACGGAAGGGAAGG - Intergenic
1066470394 10:35692184-35692206 TTTCTGAGAAGCGGATGGAAGGG - Intergenic
1067079522 10:43205264-43205286 TCTCTTAGCAGCAGTGGCACTGG - Intronic
1067748652 10:48955818-48955840 CCTCTGAGCAGGGAAGGGAGTGG + Intronic
1070647845 10:78213828-78213850 TCTCAGAGAAGTCGAGGGACTGG + Intergenic
1071482192 10:86073315-86073337 GCTCTGTGCAGCAGGGGGACTGG + Intronic
1071806983 10:89133267-89133289 TCTCTGAAGAGCGGAGGTAAGGG - Intergenic
1073517496 10:104090007-104090029 TCTCTGAGCAGCGTGAGTACAGG + Intergenic
1074872760 10:117590022-117590044 TCTTAGGGCAGCAGAGGGACAGG - Intergenic
1075471726 10:122696010-122696032 TCTCTGTGCAGCTTAGGGTCTGG + Intergenic
1076395024 10:130132104-130132126 GCTCTGAGCACTGGAGGGAAAGG - Intergenic
1076970273 11:128680-128702 TCTCTCAGCATGGGAGGGGCCGG + Intergenic
1077132112 11:978221-978243 TCACTGGGCTGCTGAGGGACCGG + Intronic
1077347753 11:2071977-2071999 GCTCTGAGCAGAAGAGGGACGGG - Intergenic
1080065085 11:28002105-28002127 GCTCTGTGCAGCCTAGGGACTGG + Intergenic
1080903268 11:36515622-36515644 GCTCAGAGCAGTGGAGGGGCAGG + Intronic
1081080499 11:38733861-38733883 TCCCTGTGCAGCCTAGGGACTGG - Intergenic
1081746039 11:45473184-45473206 CCTCTGCGCAGGGGAGGGAGAGG + Intergenic
1083764107 11:64833924-64833946 CCTCTGAGCTCCGGAAGGACAGG + Exonic
1084444693 11:69196825-69196847 GCGCAGAGCAGCAGAGGGACGGG + Intergenic
1085427817 11:76420595-76420617 TCTGTTAGCAGCGAAGGGGCAGG - Intergenic
1088613760 11:111602863-111602885 TCGGTGAGCAGCGAAGGGATCGG + Intronic
1088711354 11:112511708-112511730 TCTCTGAGCAGCTGAGGGCAAGG + Intergenic
1089617258 11:119701877-119701899 TCCTGGAGCAGTGGAGGGACAGG - Intronic
1089624354 11:119741721-119741743 TCTCTTTGTGGCGGAGGGACTGG - Intergenic
1090645216 11:128761646-128761668 TCTGAGAGCAGGGGAGGGAGTGG - Intronic
1096289128 12:50326061-50326083 ACTCTGTACAGCGGAGGGCCAGG - Intergenic
1096464303 12:51839774-51839796 TGGCTGAGCAGCGGAGGGAATGG - Intergenic
1096599706 12:52720898-52720920 CCTCTGAGGAGACGAGGGACGGG + Intergenic
1101372516 12:104142167-104142189 TTTTTGAGCAGTGGAGTGACAGG - Intergenic
1102479143 12:113208840-113208862 TGTCTGAGCAGGACAGGGACAGG + Intronic
1102524220 12:113499799-113499821 TGTTTGAGCAGGGGAGGAACTGG + Intergenic
1102651078 12:114442875-114442897 TCACTGGGCAGCAGAGGAACAGG - Intergenic
1105796852 13:23863304-23863326 GCACTGAGCAGGGGAGGGGCAGG + Intronic
1106615206 13:31320162-31320184 CCTCTGAGCAGAGGGGAGACAGG - Intronic
1107480876 13:40785346-40785368 TCTCTGAGCATCTGAGAGATAGG + Intergenic
1107869575 13:44734684-44734706 CCTCTCAGCAGCCGAGGGAAGGG - Intergenic
1108623701 13:52207792-52207814 TCTCTGAGCATCTGAGAGATAGG + Intergenic
1108663015 13:52603239-52603261 TCTCTGAGCATCTGAGAGATAGG - Intergenic
1112802590 13:103129310-103129332 TCTTTCAGCAGAAGAGGGACAGG - Intergenic
1114533016 14:23407163-23407185 TCTCTGACTTGCGGAGGTACTGG + Exonic
1117546078 14:56795582-56795604 TCTCTGAGTAGCAGAGGTTCTGG - Intergenic
1119165338 14:72487870-72487892 TCTATGAGAAGGGGAGAGACTGG - Intronic
1121970080 14:98347928-98347950 TCTGTGAGGAGCAGAGGGAAGGG - Intergenic
1122108580 14:99480225-99480247 TCCCCGAGCAGCGGGGTGACGGG + Intronic
1122288619 14:100667628-100667650 TCCCTGGGCAGCAGAGGGTCTGG + Intergenic
1122388866 14:101366712-101366734 TCTCTCAGGAGCAGAGGGAGGGG + Intergenic
1122819484 14:104334264-104334286 TCTCTGGGCCGGGGAGGCACCGG + Intergenic
1122834588 14:104424551-104424573 GCTCTTGGCAGGGGAGGGACGGG + Intergenic
1122868529 14:104622072-104622094 TCTCTGAGAAGAGAAGGGAAAGG - Intergenic
1124368758 15:29091416-29091438 TGTCTGAGCAGGTGAGGGAGGGG + Intronic
1124913279 15:33944296-33944318 TCTCTGATCTGCTCAGGGACAGG - Intronic
1127287666 15:57545390-57545412 GCTCTGAGAAGGGGAGTGACTGG - Intronic
1128311046 15:66631979-66632001 TCTCTGTGCAGAGGAAGGAAGGG + Intronic
1129661111 15:77553669-77553691 TCTAGGAGCAGCGGTGGGAGGGG - Intergenic
1129686563 15:77689428-77689450 CCTCTGGGCAGCTGGGGGACAGG - Intronic
1129849735 15:78786270-78786292 TATCTGAGCAGAGGAGACACAGG + Intronic
1131153540 15:90061656-90061678 TCTAGGAGCAGAGGAGGGTCGGG - Intronic
1132654259 16:1035290-1035312 TCTCTGGGGAGGGGATGGACAGG + Intergenic
1132680927 16:1141483-1141505 TTTCTGACCAGGGGAGGGGCAGG + Intergenic
1132739032 16:1401781-1401803 TCTCTGTGCAGTGGTGGGAGGGG - Intronic
1133778838 16:8920714-8920736 CCTCTAAGCAGGGGAGGGGCTGG + Intronic
1137547860 16:49416535-49416557 TCTCTGAGCGGCGCAGGGCTGGG + Intergenic
1137788553 16:51155463-51155485 CCTCCGGGCAGGGGAGGGACTGG - Intergenic
1140759227 16:78096417-78096439 TCTCTGACCTGCAGAGGGGCTGG + Intergenic
1141222611 16:82085225-82085247 CCACTGAGCAGCTGAGAGACTGG - Intronic
1141948217 16:87324579-87324601 CCTCTGAGCCGCGGAGGTCCTGG - Intronic
1142296801 16:89229250-89229272 TCTTTGAGCAGCGTAGGCTCTGG + Exonic
1142296829 16:89229566-89229588 TCTGTGAGCAGCGTAGGCTCTGG + Exonic
1142808424 17:2383911-2383933 TTTCAGAGCGGCGGAGGCACCGG + Intergenic
1143611517 17:8020493-8020515 TCTCTGAGCAGAGGAGTTCCTGG - Intergenic
1146910000 17:36642164-36642186 TCTCCGAGCAGCCGAGGCAAAGG - Intergenic
1150391113 17:64790480-64790502 TCTCTCAGCAGGGCAGGGATGGG + Intergenic
1150474629 17:65465540-65465562 TCTCTGAAGAGCAGAGGGGCAGG + Intergenic
1151457438 17:74234328-74234350 GCTCTGAGAACAGGAGGGACAGG - Intronic
1151752243 17:76046226-76046248 ACTCAGAGAAGCGGAGGAACTGG + Intronic
1151891778 17:76955399-76955421 ACTCTGAACAGTGGAGGGAAGGG + Intergenic
1152039143 17:77891998-77892020 TCTGAGAGCAGAGGAGGGAGGGG - Intergenic
1153520134 18:5943895-5943917 TATCCCAGCAGCAGAGGGACTGG + Intergenic
1157006808 18:43592558-43592580 TCTCTGAGAAGCTGAGGAAAGGG + Intergenic
1157292128 18:46417282-46417304 TATCTGAGCAGAGAAGTGACAGG - Intronic
1157866891 18:51196022-51196044 TTTCTCAACAGCGGAGGGGCAGG + Intronic
1160201698 18:76801763-76801785 TTTGAGAGCAGCTGAGGGACTGG + Intronic
1160647348 19:199662-199684 TCTCTCAGCATGGGAGGGGCCGG + Intergenic
1160647359 19:199711-199733 TCTCTCAGCATGGGAGGGGCCGG + Intergenic
1161213361 19:3079886-3079908 GCTGTGAGCCGAGGAGGGACAGG + Intergenic
1161226122 19:3146799-3146821 GCTGTGGGCAGAGGAGGGACTGG - Intronic
1161237020 19:3203397-3203419 TCTCTGAGCCCAGGAGGAACCGG - Intronic
1161277437 19:3426566-3426588 GCTGTGCGCAGAGGAGGGACGGG - Intronic
1161534699 19:4811889-4811911 GCTGTGGGCAGAGGAGGGACAGG - Intergenic
1161599200 19:5170546-5170568 GCTGTGGGCAGAGGAGGGACAGG + Intronic
1161618710 19:5287031-5287053 TCTTAGAGCAGGGCAGGGACAGG - Intronic
1161621387 19:5299151-5299173 GCTGTGGGCAGAGGAGGGACGGG - Intronic
1161624677 19:5319533-5319555 GCTGTGGGCAGAGGAGGGACAGG - Intronic
1161654298 19:5504346-5504368 GCTATGGGCAGAGGAGGGACAGG - Intergenic
1161664177 19:5565025-5565047 GCTGTGGGCAGAGGAGGGACGGG - Intergenic
1162792934 19:13072337-13072359 CCTCTGAGCAGCTGTGGCACCGG + Intronic
1162913155 19:13860842-13860864 GTTCTGAGCAGAGGAGGGACTGG + Intergenic
1163216756 19:15884900-15884922 TGTTTGAGCAGTGTAGGGACAGG - Intronic
1163229562 19:15991983-15992005 TGCTTGAGCAGGGGAGGGACAGG - Intergenic
1163648494 19:18503652-18503674 TGTCTGAGCAGTGGTGGGAAGGG + Intronic
1164860802 19:31560846-31560868 TCCCTGAGCAGCAGGGAGACTGG + Intergenic
1165175825 19:33929142-33929164 TCACTGAGCAGAGCAGGCACAGG - Intergenic
1166053263 19:40273839-40273861 GTCCTGAGCAGGGGAGGGACAGG - Intronic
1166288649 19:41847889-41847911 TCTCTGACCAGCGATGGGGCAGG + Intronic
1166535415 19:43571068-43571090 GCTCCGAGCAGAGGAGGGACAGG - Intronic
1166551619 19:43669299-43669321 CCTCTGAGAAACGGGGGGACAGG - Intronic
1166658128 19:44627171-44627193 GTTCTGAGCAGGGGAGGAACAGG + Intronic
1166689709 19:44815066-44815088 ATTCTGAGCAGAGGAGGGTCAGG - Intronic
1166728201 19:45041673-45041695 GCTCTGAGCAACGAAGGGACAGG - Intronic
1166728299 19:45042254-45042276 GCTCTGAGCAATGAAGGGACAGG + Intronic
1166788295 19:45382599-45382621 TCACCGTGCTGCGGAGGGACGGG - Exonic
1166990984 19:46692597-46692619 GTTGTGAGCAGAGGAGGGACAGG - Intronic
1167159137 19:47756110-47756132 GTTCCGAGCAGGGGAGGGACAGG - Intronic
1167339661 19:48907715-48907737 GCTCTGGGCAGAGGAGGGACGGG - Intronic
1167423143 19:49415417-49415439 GCTCTGAGGAGCAGAGGAACTGG - Intronic
1167470384 19:49672461-49672483 TCTCTGAGCAGCGGAGGGACAGG + Intronic
1167506272 19:49872730-49872752 GCTCAGAGCAGGGAAGGGACTGG + Intronic
1167555588 19:50193191-50193213 TGTCTGAGCAGAGGAGGGACAGG + Intronic
1167569960 19:50280731-50280753 GCTGTGAGCAGAGGAGGGACAGG - Intronic
1167631977 19:50631019-50631041 GCTGTGAGCAGGGGAGGGGCAGG - Intronic
1167668543 19:50836781-50836803 GCTGTGAGCAGGGGAGGGGCGGG - Intronic
1168098464 19:54128571-54128593 GCTCTAAGCAGCGGAGACACAGG - Intronic
1168251487 19:55144842-55144864 ATTCTGAGCAGAGGAGGGGCAGG + Intronic
925158088 2:1662425-1662447 TCTCTGAGCAGGGAAGACACTGG - Intronic
925898922 2:8494713-8494735 TCTCTGAGGAGAGGAGCCACTGG - Intergenic
925981878 2:9183943-9183965 TCTCTGTGCGGGGGAGGGGCGGG - Intergenic
927159364 2:20242977-20242999 CCTGTGAGCAGAGGAGGGAGGGG - Intergenic
928078153 2:28284250-28284272 TCTATGAGCATGGGTGGGACAGG - Intronic
931179241 2:59883211-59883233 TCTCTGACCAGTGGATGGTCTGG + Intergenic
932486147 2:72085444-72085466 ACTCTGAGCAGAGGTGGGTCTGG - Intergenic
933557392 2:83848166-83848188 TCTCTGAGAAGAGAAGAGACTGG - Intergenic
934616350 2:95773613-95773635 GTTTTGAGCAGTGGAGGGACAGG - Intergenic
934644546 2:96050947-96050969 GTTCTGGGCAGTGGAGGGACAGG + Intergenic
934837962 2:97607037-97607059 GTTCTGGGCAGTGGAGGGACAGG + Intergenic
934966114 2:98724090-98724112 CCTTTGAGCAGCTCAGGGACTGG - Intronic
935287054 2:101574334-101574356 TCTCTAAGCAGCAGAGAGCCAGG + Intergenic
935778486 2:106492028-106492050 TCTAGGGGCAGTGGAGGGACAGG + Intergenic
944140028 2:196446151-196446173 TCTAGGAGCAGCAGTGGGACTGG - Intronic
945277336 2:208001253-208001275 TCTGTCAGCGTCGGAGGGACCGG - Exonic
945556700 2:211285567-211285589 TCTCTGGGCAGGGAAGTGACTGG - Intergenic
946015245 2:216599063-216599085 GCTTTGAGCAGGGGAGCGACAGG - Intergenic
1168833104 20:858177-858199 AATCTGAGCAGAGGTGGGACAGG + Intergenic
1169001784 20:2173150-2173172 TTTCTGAGCAAGAGAGGGACAGG + Intronic
1173524297 20:43720267-43720289 TCTCAGAGCAAGGCAGGGACTGG + Intergenic
1173798161 20:45877194-45877216 TCTCTGGGAAGCGGATGAACAGG - Exonic
1173824754 20:46041033-46041055 CCTCTGAGCAGTGGATGGAGTGG - Intronic
1173953412 20:47011385-47011407 GATCTGAGCAGAGGAGAGACAGG - Intronic
1174074056 20:47919596-47919618 TCTCAGAGCAGGGGAGGGTAGGG + Intergenic
1174111596 20:48201411-48201433 TTTCTGTGCAGAGGATGGACAGG + Intergenic
1174114558 20:48218113-48218135 GCTCTGAGCAGGGGAGGGCACGG - Intergenic
1174169544 20:48607422-48607444 TTTCTGTGCAGAGGATGGACAGG - Intergenic
1174196076 20:48773797-48773819 GTTCTGAGCAGGGGAAGGACAGG + Intronic
1174292975 20:49522016-49522038 GTTCTGAGCAGAGGAGGGACAGG - Intronic
1174397839 20:50258972-50258994 GCTCTGAGCAGGGGTGGGACAGG - Intergenic
1175405582 20:58723811-58723833 CCTCTGAGCAGCGCATGCACTGG + Intergenic
1175736728 20:61392239-61392261 CCTCTGGGCTGGGGAGGGACAGG + Intronic
1175899689 20:62355113-62355135 CCTGTGAGCAGAGGAGGGGCTGG - Intronic
1176382662 21:6120962-6120984 TCTCTGAGCTGCTGAGAAACCGG + Intronic
1179740807 21:43417277-43417299 TCTCTGAGCTGCTGAGAAACCGG - Intronic
1181317076 22:21977908-21977930 TATGGGAGCAGGGGAGGGACAGG + Intronic
1181726291 22:24813325-24813347 ATTCTGAGCAGGGGAGGAACAGG + Intronic
1182736967 22:32537657-32537679 TGTCAGAGCACAGGAGGGACTGG + Intronic
1182792147 22:32961721-32961743 TCATTGAACAGCGGAGGGCCGGG + Intronic
1183361121 22:37384072-37384094 CCTGTGAGCAGGGGAGGCACGGG - Intronic
1183673870 22:39289275-39289297 TTGCTGAGCAGCAGTGGGACAGG - Intergenic
1183989086 22:41586083-41586105 TCGCTGAGCAGCTGGGTGACGGG - Exonic
1184769670 22:46589864-46589886 TCTCTGAGGGGCTGAGGGAGGGG - Intronic
1184945129 22:47797211-47797233 TCTCAGGGCAGTGGAGGGATGGG + Intergenic
949281233 3:2349959-2349981 TCTCTGAGCCTGTGAGGGACAGG + Intronic
949325557 3:2859636-2859658 TCTGAGAGCAGAGGAGAGACAGG + Intronic
953862880 3:46560307-46560329 CCCCTGAGCTGCTGAGGGACTGG - Intronic
954147093 3:48639908-48639930 GCTCTGAGCAGCTGCGGGAGTGG + Exonic
955838419 3:63084485-63084507 TCTATGAGCAGAGTAGGGACAGG + Intergenic
958195351 3:90235967-90235989 GCTCTCAGCAGAGGAGGGCCTGG - Intergenic
958418763 3:93907362-93907384 GCTCTCAGCAGAGGAGGGCCTGG - Intronic
959147274 3:102564599-102564621 TCTCTGAGGAGAGAAGGGATTGG - Intergenic
960193405 3:114734800-114734822 TATCTCAGCAGCTCAGGGACTGG + Intronic
962236823 3:133713894-133713916 ACTGGGAGCAGGGGAGGGACAGG - Intergenic
963079608 3:141378725-141378747 TCTCTGAGAAGCAGAGGGTGCGG - Intronic
963314922 3:143748646-143748668 TCTTTGAACAGAGGACGGACTGG + Intronic
966350696 3:179030872-179030894 TGTCTCACCTGCGGAGGGACTGG + Exonic
966891132 3:184408501-184408523 TCTCTGAGCATGGGTGGGACTGG - Intronic
968370410 3:198220152-198220174 TCTCTCAGCATGGGAGGGGCCGG - Intergenic
968612670 4:1564211-1564233 GATCTGAGCAGGGGAGGGGCAGG + Intergenic
968642672 4:1722169-1722191 GCTCTGGGCAGAGAAGGGACCGG - Intronic
968810791 4:2798879-2798901 TCTCTGGGCAGGGCAGGGACAGG + Intronic
969685961 4:8674449-8674471 GCTCAGAGCAGGGGCGGGACGGG - Intergenic
969710385 4:8840041-8840063 GCTCTGGGCAGCTGAGGCACAGG - Intergenic
969895925 4:10304404-10304426 TCTTTGAGCAGGAAAGGGACAGG + Intergenic
970014294 4:11495745-11495767 TCTATGAGCATCTGTGGGACAGG + Intergenic
970209668 4:13696316-13696338 TCTCTGAGTAGCAGATAGACTGG + Intergenic
970923763 4:21425968-21425990 CCTTTGAGCAGGGGAGGGAGAGG + Intronic
972174346 4:36385149-36385171 TCTCTGACCACAGGTGGGACAGG - Intergenic
974260483 4:59518770-59518792 TCCCCGAGCAGCGGAGGCTCTGG + Intergenic
982854391 4:160362631-160362653 GCTCTGTGCAGCCTAGGGACTGG - Intergenic
985777412 5:1852026-1852048 TCGCAGAGTTGCGGAGGGACTGG + Intergenic
985999582 5:3619996-3620018 TCTCTGAGCAGGGGAAGGAAAGG + Intergenic
986441575 5:7787190-7787212 TCTGTGTGCAGGGGAGGAACAGG - Intronic
994222225 5:97208890-97208912 TTTCTGGGCAGTGGAGGAACAGG + Intergenic
996550445 5:124724900-124724922 GCTTTGCGCAGAGGAGGGACAGG - Intronic
997658697 5:135574061-135574083 TTTCTGGGCAGCAGAGGGAGTGG + Intronic
998134643 5:139668319-139668341 GCCCTGAGCCGCGGCGGGACGGG - Intronic
1002094467 5:176822927-176822949 TCTCTGAGCTGGGGAGTGACAGG + Intronic
1002334688 5:178469675-178469697 TCTCTGAAGAGGGGAGGTACTGG - Intronic
1002711462 5:181197636-181197658 GCTCTGAGCAGAGGAGGGCCTGG + Intronic
1003097862 6:3156645-3156667 GCACTGACCACCGGAGGGACTGG + Intronic
1003101591 6:3180200-3180222 GCACTGACCACCGGAGGGACTGG + Intergenic
1003461273 6:6330965-6330987 CCTCTGAGCAGTGTAGGCACAGG + Intergenic
1007409268 6:41652422-41652444 GGTCTGAGCAGAGGAGGGCCAGG + Intronic
1017047153 6:150357412-150357434 ACTCTGAGGAGCAGAGGGAAAGG - Intergenic
1018706306 6:166465780-166465802 TCTGTGAGCAGCTGGAGGACGGG + Intronic
1018787411 6:167118989-167119011 TCTGTGGGCCGTGGAGGGACAGG - Intergenic
1019212510 6:170418043-170418065 TCACTCAGCAGAGGAGGCACTGG + Intergenic
1019472041 7:1226286-1226308 TGTCTGAACTGCGGAGGGAAAGG + Intergenic
1019475293 7:1241447-1241469 TCACTTAGCGGTGGAGGGACTGG + Intergenic
1019513673 7:1430400-1430422 GGGCTGAGCAGGGGAGGGACAGG - Intronic
1021527409 7:21604427-21604449 TTTCTGAGCAGAAAAGGGACTGG - Intronic
1024042110 7:45563913-45563935 TGACTGAGCGGCGGAGGGAGAGG + Intergenic
1024074523 7:45811781-45811803 TCTCTCAGCATGGGAGGGGCCGG - Intergenic
1024074852 7:45813141-45813163 TCTCTCAGCATGGGAGGGGCCGG - Intergenic
1027245088 7:76361408-76361430 TCTCTGAGCACTGGAGAGAAAGG + Intergenic
1027442857 7:78238792-78238814 TGTCTGAGCAGAGGAGTGATAGG - Intronic
1029580632 7:101434820-101434842 TGTCTGAGCAGTGAAGGGCCAGG + Intronic
1029935368 7:104419262-104419284 ATTCTGAGCAGCAGAGTGACAGG + Intronic
1030063779 7:105643525-105643547 TAGCTGAGCAGCGGGGGGAGGGG - Intronic
1034466906 7:151235185-151235207 TCACTGGGCAGCGGGGGGCCCGG + Exonic
1034481053 7:151320752-151320774 CCTCTGAGCACCGGAGAAACAGG + Intergenic
1034501203 7:151452125-151452147 TCCCAGAGGAGCAGAGGGACTGG + Intergenic
1035276008 7:157748316-157748338 TCTCTGAGCAGAGGGGTGTCCGG + Intronic
1035276038 7:157748480-157748502 TCCCTGAGCTGCGGAGTGTCTGG + Intronic
1035950000 8:4009803-4009825 TCTCTGAGAACAGGAGGGAGGGG - Intronic
1037538590 8:19850962-19850984 TCTCTGAGGGGCAGAGGGAGTGG - Intronic
1037885236 8:22592567-22592589 TCTCTGCACAGCAGGGGGACTGG - Intronic
1038010175 8:23469327-23469349 CCTCTCAGCAGCTGGGGGACAGG + Intergenic
1040757085 8:50789791-50789813 TTTTTGAGCAGAGGAGTGACAGG - Intronic
1042813577 8:72853170-72853192 ACTCTGAGCAGTTGAGGGAGTGG - Intronic
1044391714 8:91660376-91660398 AATCTGGGCAGTGGAGGGACTGG - Intergenic
1044750213 8:95408467-95408489 TCTCTCAGCAGCTGAGAGGCAGG - Intergenic
1044795636 8:95894516-95894538 TCTCTCAGAAGCAGAGGGAAAGG + Intergenic
1045391294 8:101717445-101717467 TTTCTGAGTCGTGGAGGGACGGG + Intronic
1045463159 8:102444171-102444193 TCTGTGAGCAGGGGAAGGAAAGG - Intergenic
1045508492 8:102795234-102795256 GCTCTGAGGAGCAGAGGGCCGGG - Intergenic
1047770836 8:128028502-128028524 TCTCTGAGGAGAGGCAGGACTGG + Intergenic
1047790480 8:128198635-128198657 TCTCTGAGGAGCCAGGGGACTGG - Intergenic
1048295280 8:133209484-133209506 TCCCTGGGCAGAGGAGGGAAGGG - Intronic
1048877565 8:138849054-138849076 CCTCGGAGCAGCGGAGGAACTGG - Intronic
1048879873 8:138863455-138863477 TCCCTGAGCAGAGGTGGGGCTGG - Intronic
1048922300 8:139242236-139242258 CCTCAGAGCAGCGGAGGAACTGG - Intergenic
1049614618 8:143570703-143570725 GCACTGGGCAGCAGAGGGACAGG + Intronic
1051741642 9:20258300-20258322 TCTTTGAACAGAGGAGGGATAGG - Intergenic
1053151240 9:35744581-35744603 TCTCTGAGCAGAGCAGAGATGGG + Intronic
1053398168 9:37794286-37794308 TCTCTGAAAAGAGAAGGGACGGG + Intronic
1053420149 9:37972268-37972290 TCTCTGGGCATGGGAGGAACTGG - Intronic
1053518230 9:38750782-38750804 TCGCTGAGCAGGGGAGGAGCAGG - Intergenic
1055944045 9:81676817-81676839 TCTCTGAGCAGTGGGGACACTGG + Intronic
1056326128 9:85480399-85480421 TTCCTGAGCAGAGGGGGGACAGG - Intergenic
1057725400 9:97564728-97564750 TCCCGGGGCAGGGGAGGGACAGG + Intronic
1058545131 9:106053011-106053033 ACTCTGAGCAACGGAAGGAAAGG + Intergenic
1060187949 9:121575273-121575295 TCTCAGAGCCTCGGAGGGATGGG + Intronic
1061347650 9:130040112-130040134 TCTCTGACCACCGGAGAAACTGG + Intronic
1061416504 9:130450151-130450173 TCACTGAGCAGAGGAGGTCCAGG - Intronic
1062087483 9:134656245-134656267 ACTCTGAGCAGAGGAGGGTGGGG + Intronic
1062183282 9:135202607-135202629 TCTCTGAGCACCTGAGGGAATGG + Intergenic
1062343491 9:136104065-136104087 CCTCTGTGCAGTGGAGGGATGGG + Intergenic
1203760783 EBV:12370-12392 TCTCTGCCCCCCGGAGGGACCGG - Intergenic
1203761712 EBV:15442-15464 TCTCTGCCCCCCGGAGGGACCGG - Intergenic
1203762641 EBV:18514-18536 TCTCTGCCCCCCGGAGGGACCGG - Intergenic
1203763570 EBV:21586-21608 TCTCTGCCCCCCGGAGGGACCGG - Intergenic
1203764499 EBV:24658-24680 TCTCTGCCCCCCGGAGGGACCGG - Intergenic
1203765428 EBV:27730-27752 TCTCTGCCCCCCGGAGGGACCGG - Intergenic
1203766357 EBV:30802-30824 TCTCTGCCCCCCGGAGGGACCGG - Intergenic
1203767286 EBV:33874-33896 TCTCTGCCCCCCGGAGGGACCGG - Intergenic
1203578006 Un_KI270745v1:22524-22546 TCTCTCAGCATGGGAGGGGCCGG - Intergenic
1203578030 Un_KI270745v1:22621-22643 TCTCTCAGCATGGGAGGGGCCGG - Intergenic
1185466143 X:355461-355483 TGTCGTAGCAACGGAGGGACCGG + Intronic
1194695507 X:97044768-97044790 TCTCTGAGAAGCAGAGAGATAGG - Intronic
1195936205 X:110127754-110127776 TCTCTGATCAGGGGAGAGACAGG + Intronic
1195965745 X:110428642-110428664 TGTTTGAGCAGGGGAGGGATAGG - Intronic
1197385016 X:125791661-125791683 TCTCTAAACAGAGGATGGACAGG + Intergenic
1200763842 Y:7063808-7063830 TCTCTGGGCAGGAGAGGCACGGG - Intronic