ID: 1167471932

View in Genome Browser
Species Human (GRCh38)
Location 19:49680266-49680288
Sequence TCCCCTGGATGGTGCTCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 1, 2: 0, 3: 20, 4: 169}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167471932 Original CRISPR TCCCCTGGATGGTGCTCTGG GGG Intronic
900651126 1:3730565-3730587 TCCCCTGGAAGGTCCTCATGTGG + Intronic
901280260 1:8027664-8027686 TTCCCTGGCTGGTCCTCTGTTGG + Intergenic
902730683 1:18366798-18366820 TCCCTGGGTTGGTGCTCTGTGGG - Intronic
903031391 1:20466556-20466578 TTCCCAGGATGGTGCTGGGGTGG + Intergenic
904416022 1:30361679-30361701 TACACTGGCTGGGGCTCTGGGGG - Intergenic
905211068 1:36374499-36374521 TGCCCTGGATTCTGCTCTGGTGG - Intronic
913322926 1:117601975-117601997 ACCCCTTCATGCTGCTCTGGTGG + Intergenic
915461757 1:156074804-156074826 CTCCCTGGCTGGTGTTCTGGAGG + Exonic
918802150 1:188986139-188986161 TCCCTTGGATGGGGCTTTTGTGG + Intergenic
921094615 1:211875648-211875670 TCCCCTGAATGGATCTCAGGTGG - Intergenic
922046715 1:221952201-221952223 TGTCCTGGATGCTGGTCTGGTGG - Intergenic
1063144981 10:3288685-3288707 TCCCCTGGATCTGGCTCTGATGG - Intergenic
1065512378 10:26492226-26492248 GCCCATGGATGGGGCTCTTGGGG + Intronic
1065683870 10:28264431-28264453 TCCTCAGGATGGGGCGCTGGTGG + Intronic
1065687389 10:28300210-28300232 TCCACTAGATGGTGCACTGGGGG - Intronic
1065811381 10:29447048-29447070 TCCCCAGGATGGTGCCCAGAGGG + Intergenic
1065954774 10:30684053-30684075 TCCTCTGGAAGGGGGTCTGGGGG - Intergenic
1070376670 10:75838991-75839013 TACAATGGATGGTGCTCTGAAGG + Intronic
1073076278 10:100827318-100827340 TCCCCTGGAGGGTGCGCAGCCGG + Intronic
1074539160 10:114350690-114350712 ACTCTTGGATGGTGCTCTGATGG + Intronic
1076236717 10:128869160-128869182 CCATCTGGATGGTGCTCCGGCGG + Intergenic
1077299723 11:1841326-1841348 TCCCCTGCATGGCACCCTGGAGG - Intronic
1077530447 11:3092452-3092474 TGCCCAGGAAGGTGGTCTGGCGG + Exonic
1078623460 11:12931186-12931208 GCCCCTGGATGGTTCTATGTGGG + Intronic
1080187411 11:29506426-29506448 TTCCCTGGATGGTTCTCTTAGGG + Intergenic
1082780534 11:57284163-57284185 TCCACTGGGTAGTGCTCTAGTGG - Intergenic
1084332192 11:68436825-68436847 TGCCCTGCATGGTGGGCTGGGGG + Intronic
1084450272 11:69232770-69232792 TCCCCAGGAGGGGGCTTTGGAGG - Intergenic
1085417680 11:76330129-76330151 TCGCCTGCAGGGAGCTCTGGGGG + Intergenic
1088425048 11:109693403-109693425 GCCCCTGGATGGTGCACATGGGG - Intergenic
1089680637 11:120117168-120117190 TCCCCTGCCAGGTGCTCTGTGGG + Intronic
1094169732 12:27479357-27479379 GCCCCAGGATGGTGCTCAGGTGG + Intronic
1096529987 12:52236385-52236407 TCCACAGGAAGGTGCTCTGAGGG - Intronic
1097161277 12:57048296-57048318 TCTCCTGGAAGGTTCTGTGGGGG - Exonic
1097178035 12:57154674-57154696 TGCCCTGGATGATGGTCTGGCGG - Exonic
1098917005 12:76267832-76267854 TGCCCTTGATGGTGTTCTTGAGG + Intergenic
1101209615 12:102522999-102523021 TCCCATGGCTGGGGCTCTGATGG + Intergenic
1104677015 12:130718006-130718028 TCCCCAGCATGGTGCTCTCAAGG - Intergenic
1104880950 12:132069741-132069763 TGCACTGGGTGGTGCACTGGAGG + Intronic
1108798812 13:54067524-54067546 CCCCCTAGATGCTGCTGTGGGGG + Intergenic
1109346912 13:61125716-61125738 TCCACTAGGTGGTGCTGTGGTGG + Intergenic
1110392624 13:74993163-74993185 TCCCCTCTATGCTTCTCTGGGGG - Intergenic
1112225295 13:97533606-97533628 TCCTCTGGATCGTGCACAGGAGG + Intergenic
1112563729 13:100534794-100534816 CCCTCTGGGTGGTGCACTGGGGG - Intronic
1114227548 14:20752788-20752810 TCCCCTGGACAGTGCCCTGTGGG - Intergenic
1114367538 14:22046284-22046306 TCCTCTGGGTGAAGCTCTGGTGG - Intergenic
1117464140 14:55975500-55975522 TGTCCAGAATGGTGCTCTGGTGG + Intergenic
1118898870 14:69970074-69970096 TCCCCTGGGATGTTCTCTGGTGG - Intronic
1119652501 14:76393608-76393630 TCCCCTGGTCGGTGCCCAGGTGG + Intronic
1121112393 14:91321203-91321225 GCCCCTGGATGGTGCTCTGGAGG + Exonic
1121338193 14:93089841-93089863 CCCCCTGCATGGGGCTCTGAGGG - Intronic
1122788897 14:104176229-104176251 TGCCCTGGATGGTTCCCTGGGGG + Exonic
1122803649 14:104245595-104245617 TCGTCAGGATGGTGCTCAGGTGG - Intergenic
1123468195 15:20531366-20531388 TCCCCTGGAAGCAGCTCTGAGGG + Intergenic
1123649920 15:22469698-22469720 TCCCCTGGAAGCAGCTCTGAGGG - Intergenic
1123728511 15:23126576-23126598 TCCCCTGGAAGCAGCTCTGAGGG + Intergenic
1123740323 15:23278517-23278539 TCCCCTGGAAGCAGCTCTGAGGG - Intergenic
1123746675 15:23324041-23324063 TCCCCTGGAAGCAGCTCTGAGGG + Intergenic
1124278943 15:28347357-28347379 TCCCCTGGAAGCAGCTCTGAGGG + Intergenic
1124303756 15:28564251-28564273 TCCCCTGGAAGCAGCTCTGAGGG - Intergenic
1126846623 15:52766377-52766399 TCCCCAGGATGGTGAAATGGGGG + Intronic
1127641037 15:60916080-60916102 TCCACTGGGTGGGGCACTGGAGG + Intronic
1128751321 15:70152188-70152210 TCCCCAGCACAGTGCTCTGGAGG + Intergenic
1129031031 15:72617834-72617856 TCCCCGGGAGGGAGCTCTGTTGG - Intergenic
1129479106 15:75808804-75808826 TCCCATGGAGGGAGCTCTGTTGG - Intergenic
1129960563 15:79680885-79680907 TCCCCTGCTGGGTGCTCTGGAGG - Intergenic
1130090707 15:80818908-80818930 TCCCCAGGATGGATCTCTGTAGG - Intronic
1130114221 15:80992328-80992350 TAACCTAGATGGTGCTGTGGCGG - Intergenic
1132894669 16:2223181-2223203 ACCCCTGGTTGGAGCTGTGGCGG + Intergenic
1133100121 16:3474388-3474410 TCCCCAGGGTGGTTCTCTGCTGG - Intronic
1134213582 16:12298343-12298365 TCCCCTGGATGGTTTTCTGCAGG + Intronic
1136479343 16:30532248-30532270 TTCCCTGTATGGAGGTCTGGGGG + Intronic
1136522522 16:30806016-30806038 TTCCCAGGCTGGTGCTCGGGAGG - Intergenic
1139180492 16:64742122-64742144 ACCCCTGGAATGGGCTCTGGTGG + Intergenic
1141555940 16:84836789-84836811 ACACCTGGTTGGTGCTATGGGGG + Intronic
1141659481 16:85434257-85434279 TGCCCTAGATGGTGCTCATGGGG - Intergenic
1142434453 16:90047701-90047723 TGCCCAGGAAGGTGCGCTGGTGG + Intergenic
1144061165 17:11583951-11583973 TCCCCAGACTGCTGCTCTGGGGG - Intergenic
1146951674 17:36910850-36910872 TACCCTGTGTGGTGCTATGGGGG + Intergenic
1148791394 17:50175269-50175291 TCCCGTGGATGGTGCAGTGGTGG - Exonic
1150718520 17:67593963-67593985 TCCAGTGGATGGTGCCTTGGTGG + Intronic
1151419588 17:73988421-73988443 TACCCTGGATGTTGCTGTGCAGG - Intergenic
1153014103 18:567736-567758 TAAACTGGATGGTGCTCTGTAGG + Intergenic
1155492021 18:26408773-26408795 TTCCCTGGATGTAGCTCAGGTGG + Intergenic
1156092406 18:33487561-33487583 CTCCCTGGATGTTGCTCTTGGGG + Intergenic
1158216238 18:55103395-55103417 TCCAGTGGATGGTGATATGGTGG + Intergenic
1158974893 18:62702669-62702691 TCCCCTGAATGTGGCTCTTGTGG - Intergenic
1160245784 18:77158434-77158456 TTCCATGGATGGGGGTCTGGGGG + Intergenic
1161777343 19:6270744-6270766 TCACCTGGACGGTGCACTGGAGG + Exonic
1162175061 19:8824184-8824206 TCTCCTGGATGTTGCTCTAGAGG + Exonic
1163443114 19:17331518-17331540 TCCCCTGGAAAGAGCTCTAGAGG - Intronic
1163536306 19:17878653-17878675 TCCCCTGGGAGATGCTCAGGAGG + Intronic
1165954033 19:39490503-39490525 TCCCCAGGAGGGTACTCAGGAGG - Exonic
1166719748 19:44990197-44990219 CCGCCTGTCTGGTGCTCTGGGGG + Intronic
1167471932 19:49680266-49680288 TCCCCTGGATGGTGCTCTGGGGG + Intronic
1168135999 19:54352251-54352273 TCCCCTGGGGTGTGCCCTGGCGG - Exonic
1168643519 19:58045371-58045393 TCTCCTGGATGGTGTCCTGGAGG - Intronic
925385546 2:3459469-3459491 TCCCCTGGGAGCTGCCCTGGGGG - Intronic
925731610 2:6922963-6922985 TCACCTGGCTGGTGATCTGGTGG + Intronic
929865434 2:45713458-45713480 TGCCCTGGATGGTTCTCTGTGGG - Intronic
938262592 2:129906224-129906246 TGGCCTGGATGGTCCTCTGAGGG - Intergenic
938483268 2:131679643-131679665 TCCCCTTGATGGTTGTGTGGAGG - Intergenic
943320242 2:186435818-186435840 GGGCCTGGATGGTGCTCTGCTGG - Intergenic
946375202 2:219303738-219303760 TCCCTTGGACGGGGCTCTGGGGG + Exonic
946394533 2:219436504-219436526 TCCCCTGGGTGCTGCTGTGTAGG + Intronic
947848333 2:233263628-233263650 TCGCCTGGATGGTGGTCTTACGG + Intronic
948586101 2:239020741-239020763 TCTCCAGGAGGCTGCTCTGGGGG - Intergenic
948789845 2:240371578-240371600 TCCCCTGGAAGGGGCCCTGCAGG + Intergenic
1169112795 20:3044493-3044515 TCCCATGGCTGGTACCCTGGAGG + Exonic
1171296054 20:24018222-24018244 TCCCCTGGCTGGTTCTCTCTTGG + Intergenic
1172883596 20:38217193-38217215 TCCCCTGGCTGGGGCTATGGTGG - Intronic
1173136440 20:40443236-40443258 TCCCCTGGGTGGGGCTGTGGAGG - Intergenic
1179545715 21:42111244-42111266 TCCCCTGGCTGGTGCTCCTCTGG - Exonic
1179545749 21:42111349-42111371 TCCCCTGGCTGGGGCTCTCCTGG - Exonic
1179980288 21:44891981-44892003 TCACCTGGAAGGTGATCTGCAGG + Exonic
1181410268 22:22713506-22713528 ACCCCTGGATGGTCATATGGTGG + Intergenic
1181741331 22:24924098-24924120 GCCCCTGGAGGCTTCTCTGGGGG - Intronic
1181766233 22:25094269-25094291 CCCTCTGGAGGGAGCTCTGGAGG - Intronic
1183566208 22:38617012-38617034 TTCCCTGGGTGGTGCTGGGGAGG + Intronic
1184091931 22:42297486-42297508 GCCCTTGGAGGGTGCTCAGGAGG - Intronic
1185044748 22:48523308-48523330 TCCCCTGGATGGTGTTTAAGTGG - Intronic
1185131949 22:49044305-49044327 TGCCCTGGCAGGTGCACTGGGGG + Intergenic
949430708 3:3972592-3972614 CCCCATGGATGGAGTTCTGGTGG - Intronic
950579677 3:13854038-13854060 GCCCCAGGATGGTGTCCTGGGGG - Intronic
953381728 3:42477414-42477436 TCTCCTGGATGGAGCTCTGTAGG - Intergenic
953862963 3:46561126-46561148 TACTCCGGATGGTTCTCTGGGGG - Intronic
954445643 3:50545380-50545402 TCCTCTGGATGGAGGTCAGGAGG + Intergenic
955337231 3:58096840-58096862 TCTCCTTGGAGGTGCTCTGGAGG + Intronic
957143330 3:76389251-76389273 TCCCCTGAAGGGAGCTCTTGAGG - Intronic
957381889 3:79442223-79442245 TCCCCTGAATTGTGTTTTGGTGG + Intronic
961617347 3:128193290-128193312 TCCCTTGGAGGCTGGTCTGGAGG - Intronic
961658467 3:128456040-128456062 TCCACTGGATGCTTCCCTGGTGG - Intergenic
963141913 3:141953305-141953327 TCCCATGGGCTGTGCTCTGGAGG - Intronic
966787910 3:183636732-183636754 CCCCCTTGAAGGTGATCTGGAGG + Intronic
967978996 3:195054253-195054275 TTCCTTGCAGGGTGCTCTGGTGG + Intergenic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
970543919 4:17107321-17107343 TCCCATGGATGGGGCGCAGGAGG + Intergenic
971346419 4:25815705-25815727 TCCGTTGGATGGTTGTCTGGAGG - Intronic
974969618 4:68807787-68807809 TCCACTAGGTAGTGCTCTGGTGG - Intergenic
975000582 4:69220411-69220433 TCCACTGGGTAGTGCTCTGGTGG + Intergenic
975005188 4:69274784-69274806 TCCACTGGGTAGTGCTCTGGTGG - Intergenic
975013598 4:69383771-69383793 TCCACTAGGTAGTGCTCTGGTGG - Intronic
978733148 4:112054627-112054649 TCCACTAGATGATGCTATGGTGG + Intergenic
979658369 4:123223631-123223653 TCCCCTTGGTGCTGCTCTTGTGG - Intronic
982094546 4:151909887-151909909 TCCCCTGGATGCAGCTTAGGAGG - Intergenic
987118871 5:14747891-14747913 TCCCCTTCTTGCTGCTCTGGTGG + Intronic
991513649 5:67409300-67409322 TTCCCTGCTTGGAGCTCTGGAGG - Intergenic
997606181 5:135177177-135177199 TGCCCTGCCTGGTGCCCTGGGGG - Intronic
999375200 5:151081466-151081488 TGCCCTGGACGGAACTCTGGGGG - Intronic
1002884414 6:1281136-1281158 TCCCCTGGAGGGCCCTCTTGGGG - Intergenic
1002928282 6:1617601-1617623 TCCCCCAGATGGTGCAGTGGAGG - Intergenic
1006638334 6:35475679-35475701 CCTCCTGGATGGTGCTGTTGAGG + Exonic
1006796514 6:36735663-36735685 TCCCCAGGCTGGGGCTCTGCAGG + Intergenic
1011302603 6:85892245-85892267 TCCCCGGGATGGAGCACTAGGGG - Intergenic
1015713480 6:136166625-136166647 TCCCCTTGATGCTGTTCTTGTGG - Intronic
1016767784 6:147814586-147814608 TGCTTTGAATGGTGCTCTGGAGG - Intergenic
1018051870 6:160016279-160016301 TCCCCAGAATGTTGCCCTGGAGG + Intronic
1018137475 6:160791550-160791572 TCCCCTGGGTGGTGCTGAGCAGG + Intergenic
1018466016 6:164045864-164045886 TATCCTGGTTGGTGCTTTGGTGG + Intergenic
1019209273 6:170391984-170392006 TCCCCTGTTTGGAGCTCTGAGGG + Intronic
1019313091 7:372209-372231 TCCCCTGCGTGCTGCTCGGGTGG + Intergenic
1019779214 7:2929792-2929814 TGCCCCGGATGGCACTCTGGAGG + Intronic
1019997511 7:4734349-4734371 TCCCCTGGCTGTGGCTCTTGTGG + Intronic
1021598292 7:22340262-22340284 TCTCCTGGAGGCTTCTCTGGTGG - Intronic
1022479452 7:30733467-30733489 GCCCCTGGATGGTGCTAGGTGGG - Intronic
1024323609 7:48092094-48092116 TCCCCTGCCTGGTTCACTGGGGG + Intronic
1025204704 7:56985507-56985529 TCCCCAGGAGGGTGGTGTGGGGG - Intergenic
1025667233 7:63591428-63591450 TCCCCAGGAGGGTGGTGTGGGGG + Intergenic
1031883197 7:127219798-127219820 TCCCCTGGGTGGAGCTTTTGGGG - Intronic
1033546470 7:142405756-142405778 TGCCCTGGATGGTGGACAGGAGG + Intergenic
1034330069 7:150274888-150274910 TCTCCTGGATGACGTTCTGGCGG + Intronic
1034667985 7:152834970-152834992 TCTCCTGGATGACGTTCTGGCGG - Intronic
1035466598 7:159083567-159083589 TGCCCTGGCTGTGGCTCTGGTGG - Intronic
1036270298 8:7297574-7297596 CTCCCTGGATGGTGCTTTCGGGG - Intergenic
1036490323 8:9219215-9219237 TCCCCTGCAGGCTGCTCTGATGG - Intergenic
1037673467 8:21035269-21035291 TACACTGGAGGGTGCACTGGAGG - Intergenic
1041506416 8:58603371-58603393 TCCGCCACATGGTGCTCTGGGGG + Exonic
1041723401 8:60996669-60996691 TCCTTTGTGTGGTGCTCTGGTGG + Intergenic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1045210863 8:100098171-100098193 TCCACTGGATTGTGAACTGGAGG + Intronic
1045357778 8:101404756-101404778 CCACCTGGGTGGAGCTCTGGAGG - Intergenic
1052515170 9:29471312-29471334 TCTCCTGGATGGTACTCTGAAGG + Intergenic
1053014993 9:34656862-34656884 GACCCTGGATGGTGCACTTGGGG + Exonic
1061391748 9:130320718-130320740 TGCCCTGGGTGGTTGTCTGGGGG - Intronic
1062193135 9:135257807-135257829 TCCCCTGGGAGGTACTCTGAGGG - Intergenic
1062337692 9:136079630-136079652 GCCCCAGGAAGGAGCTCTGGGGG - Intronic
1062396836 9:136355997-136356019 TTCCCGGGATGCTGCTCTGTGGG - Intronic
1190379480 X:49826058-49826080 TCTCATGGATGGTGCTCATGGGG + Intergenic
1196167981 X:112555896-112555918 TCCCTGGGATGGAGCCCTGGGGG + Intergenic
1200069685 X:153521992-153522014 TCTTCAGGATGGTTCTCTGGGGG - Intronic
1200734935 Y:6784044-6784066 TCCCCTGGGTGGTGCTAAGTAGG + Intergenic