ID: 1167476897

View in Genome Browser
Species Human (GRCh38)
Location 19:49706439-49706461
Sequence GGATTCTCGGGTGCCACATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 55}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167476897_1167476906 21 Left 1167476897 19:49706439-49706461 CCAGATGTGGCACCCGAGAATCC 0: 1
1: 0
2: 0
3: 5
4: 55
Right 1167476906 19:49706483-49706505 GACAGTAGACAGCCAGACCCTGG 0: 1
1: 0
2: 1
3: 15
4: 161
1167476897_1167476900 -8 Left 1167476897 19:49706439-49706461 CCAGATGTGGCACCCGAGAATCC 0: 1
1: 0
2: 0
3: 5
4: 55
Right 1167476900 19:49706454-49706476 GAGAATCCAGTATCAGACCTAGG 0: 1
1: 0
2: 0
3: 13
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167476897 Original CRISPR GGATTCTCGGGTGCCACATC TGG (reversed) Intronic
902376115 1:16030653-16030675 GGATTCTGGGCCGCAACATCGGG + Exonic
902381046 1:16052390-16052412 GGATTCTGGGCCGCAACATCGGG + Exonic
905111428 1:35597431-35597453 GAATTCTTTAGTGCCACATCTGG - Intergenic
907332934 1:53683148-53683170 GGAGTCTGGGGTCCCACTTCTGG + Intronic
907772044 1:57475321-57475343 GGCTTCCTGGGTGCAACATCCGG - Intronic
911270383 1:95794648-95794670 GGTTTCTCTGGTCCCACCTCTGG + Intergenic
920515783 1:206583896-206583918 GGATTTTCTGGTGCTCCATCTGG - Intronic
922574614 1:226653519-226653541 GGCTGCTCAGGTGCCACTTCCGG + Intronic
1063238180 10:4141140-4141162 GGATTCTCTGGTGCCATCTCTGG + Intergenic
1069705192 10:70455079-70455101 GGATTCCCGGGTCCCACCCCAGG - Intergenic
1073526247 10:104184837-104184859 GCATTCTCGGGTACCACATGGGG - Intronic
1094484774 12:30915850-30915872 GCATTCCTGGGTGCCACAGCAGG - Intergenic
1096090230 12:48894536-48894558 GAATTCACTGGTGCCACATCTGG - Intergenic
1098457158 12:70687570-70687592 GGATTCTTGGATGCCACCTAAGG - Intronic
1100032726 12:90213011-90213033 GGATTCTTGGGAGCCACTGCTGG + Intergenic
1124963070 15:34412481-34412503 AGCTGCTCGGGTGCGACATCAGG + Intronic
1124979693 15:34558707-34558729 AGCTGCTCGGGTGCGACATCAGG + Intronic
1125228532 15:37425103-37425125 GGATTATCTGGTTCCACATAAGG + Intergenic
1128903737 15:71449159-71449181 GGACACTCAGTTGCCACATCAGG + Intronic
1135912904 16:26577834-26577856 CGATTTTCATGTGCCACATCTGG + Intergenic
1137480881 16:48850908-48850930 AAATTCTGGGGTGCCAAATCAGG + Intergenic
1139572997 16:67825037-67825059 GGGTTCTGGGGGGCCCCATCAGG - Intronic
1141212842 16:81996969-81996991 GCTCTCTGGGGTGCCACATCAGG - Exonic
1143634819 17:8158515-8158537 GGATACTAAGATGCCACATCGGG + Intronic
1144855310 17:18264217-18264239 GCCTTCTCGGGTGCCTGATCCGG + Exonic
1147500162 17:40955556-40955578 GGATTCCCAGGTCCCACAGCTGG + Intergenic
1148332193 17:46819531-46819553 GGATTCTCGGTTGGACCATCAGG + Intronic
1150265857 17:63832120-63832142 GGCTTGGCGAGTGCCACATCTGG - Exonic
1151402749 17:73866557-73866579 AGATTCTCAGGTCCCACTTCAGG + Intergenic
1163056005 19:14718635-14718657 GGTTTCTCTGGTGCAAAATCAGG - Exonic
1165447843 19:35866409-35866431 GGAGTCCCGGGGGCCAGATCTGG - Exonic
1167476897 19:49706439-49706461 GGATTCTCGGGTGCCACATCTGG - Intronic
1168102665 19:54149307-54149329 GGATTCTCGGGTGCTCCACCAGG - Intronic
926152682 2:10433785-10433807 GGCTTCTGGAGTGCCACATGAGG + Intergenic
940168307 2:150799469-150799491 AGATTCGAGGGGGCCACATCTGG - Intergenic
1175407870 20:58746433-58746455 GGAGTCTCAGTTTCCACATCTGG + Intergenic
1175421016 20:58833598-58833620 GGATACTTGGTTTCCACATCAGG - Intergenic
1184961543 22:47932941-47932963 GGCTTCTCTGGTGCCAAGTCTGG - Intergenic
966932878 3:184687216-184687238 GGATTAGCTGGTGCCACATCTGG + Intergenic
972371255 4:38425215-38425237 GGATTCTAGGGTTCCAGACCTGG + Intergenic
990537088 5:56733493-56733515 GGACTTCCGGGTGCCACATAAGG - Intergenic
1002121115 5:177005897-177005919 GGCTTCTCGAGCGCCACAGCCGG - Intronic
1005675789 6:28153456-28153478 GGATTCTCTGGTGCAGAATCAGG - Exonic
1010744351 6:79544019-79544041 GGATTCTTGGGGGCCACTTATGG - Intergenic
1029307268 7:99629552-99629574 GGGTTCTCTGGTGCTTCATCAGG - Exonic
1035366728 7:158353222-158353244 GGATGCTAGAGTGCCCCATCAGG - Intronic
1037598522 8:20374241-20374263 GGAAACTAAGGTGCCACATCAGG + Intergenic
1039596142 8:38791457-38791479 GGGTCCTTGGGTGCAACATCCGG + Intronic
1039854081 8:41397733-41397755 AAATTCTCAGGTGTCACATCAGG - Intergenic
1049841228 8:144773880-144773902 GGATTCTCTGGTGATAAATCAGG + Exonic
1050108152 9:2186976-2186998 GGATTCTCAGGCCCCACAACAGG - Intronic
1050281415 9:4054171-4054193 GGACTCTCTGGTGGCACAGCAGG + Intronic
1053138929 9:35669904-35669926 AGATTCTAGGGTGCCATTTCTGG - Intronic
1053526505 9:38835477-38835499 GGATCCTGGGTTGCCACGTCCGG - Intergenic
1054198731 9:62059902-62059924 GGATCCTGGGTTGCCACGTCCGG - Intergenic
1057194244 9:93107938-93107960 GGATTCAGAGGTGACACATCTGG + Intronic
1060594630 9:124840710-124840732 GGATTCTCGAGTTCCCCAGCTGG + Intergenic
1061526356 9:131167266-131167288 GGCTTCTCTTGTTCCACATCAGG + Intronic
1062202074 9:135308766-135308788 GGATCCACGGCTGCCTCATCAGG + Intergenic
1186999344 X:15159124-15159146 GGATTTTCGGTTGTCACAACTGG + Intergenic
1198236075 X:134736938-134736960 GGCTTCTGGAGTGCCACATAGGG - Intronic