ID: 1167479265

View in Genome Browser
Species Human (GRCh38)
Location 19:49719535-49719557
Sequence AAGAACGCCAAGAAGGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 2, 2: 1, 3: 21, 4: 173}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167479265_1167479270 -6 Left 1167479265 19:49719535-49719557 CCCTGGCCCTTCTTGGCGTTCTT 0: 1
1: 2
2: 1
3: 21
4: 173
Right 1167479270 19:49719552-49719574 GTTCTTCCTCTTCACGCGGCCGG 0: 1
1: 0
2: 1
3: 5
4: 59
1167479265_1167479272 -4 Left 1167479265 19:49719535-49719557 CCCTGGCCCTTCTTGGCGTTCTT 0: 1
1: 2
2: 1
3: 21
4: 173
Right 1167479272 19:49719554-49719576 TCTTCCTCTTCACGCGGCCGGGG 0: 1
1: 2
2: 1
3: 4
4: 66
1167479265_1167479271 -5 Left 1167479265 19:49719535-49719557 CCCTGGCCCTTCTTGGCGTTCTT 0: 1
1: 2
2: 1
3: 21
4: 173
Right 1167479271 19:49719553-49719575 TTCTTCCTCTTCACGCGGCCGGG No data
1167479265_1167479269 -10 Left 1167479265 19:49719535-49719557 CCCTGGCCCTTCTTGGCGTTCTT 0: 1
1: 2
2: 1
3: 21
4: 173
Right 1167479269 19:49719548-49719570 TGGCGTTCTTCCTCTTCACGCGG 0: 1
1: 3
2: 2
3: 9
4: 80
1167479265_1167479275 11 Left 1167479265 19:49719535-49719557 CCCTGGCCCTTCTTGGCGTTCTT 0: 1
1: 2
2: 1
3: 21
4: 173
Right 1167479275 19:49719569-49719591 GGCCGGGGCGGCCACCCCATAGG 0: 1
1: 0
2: 0
3: 9
4: 109
1167479265_1167479273 -1 Left 1167479265 19:49719535-49719557 CCCTGGCCCTTCTTGGCGTTCTT 0: 1
1: 2
2: 1
3: 21
4: 173
Right 1167479273 19:49719557-49719579 TCCTCTTCACGCGGCCGGGGCGG 0: 1
1: 2
2: 0
3: 5
4: 57
1167479265_1167479276 12 Left 1167479265 19:49719535-49719557 CCCTGGCCCTTCTTGGCGTTCTT 0: 1
1: 2
2: 1
3: 21
4: 173
Right 1167479276 19:49719570-49719592 GCCGGGGCGGCCACCCCATAGGG 0: 1
1: 0
2: 0
3: 5
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167479265 Original CRISPR AAGAACGCCAAGAAGGGCCA GGG (reversed) Intergenic
900075946 1:817946-817968 AAGAAAGCCAACAAGGGGCATGG + Intergenic
900564507 1:3325733-3325755 AGGAAGTCCAAGGAGGGCCAAGG - Intronic
900564527 1:3325833-3325855 AGGAAGGCCAAGGAGGGCCAAGG - Intronic
900564547 1:3325912-3325934 AAGAGGGCCGAGGAGGGCCAAGG - Intronic
900564581 1:3326021-3326043 AGGATGGCCAAGGAGGGCCAAGG - Intronic
900564629 1:3326170-3326192 AGGATGGCCAAGGAGGGCCAAGG - Intronic
900585139 1:3429010-3429032 AGGATGGCCAAGGAGGGCCAAGG + Intronic
904927456 1:34060057-34060079 AAGAATGCCAGGAAGGCACAGGG + Intronic
906290778 1:44617980-44618002 AAGAAGGCCAGGGAGGGCAAAGG - Intronic
907413845 1:54300800-54300822 AAGAACTCCAAAAAGAGCAATGG + Intronic
908832301 1:68191326-68191348 AAGGACAACAAGAAGAGCCATGG - Intronic
910225252 1:84929898-84929920 AAGAAAGCAGAGAAGAGCCAGGG + Intronic
912681803 1:111733715-111733737 AAGAGCCCCAAGAGGGCCCAGGG - Intronic
912712048 1:111957013-111957035 CAGAACGAGAAGAAGGGCCTGGG + Intronic
913501573 1:119476950-119476972 AAGAACCCCATGAATGCCCAGGG - Intergenic
914251051 1:145921803-145921825 AAGGAGGCCAAGAAGGGTCTAGG + Intergenic
914824858 1:151133079-151133101 AACAACGCCAAGGAGGGTCCGGG - Exonic
920521264 1:206628813-206628835 GAGAAAGCCAAGGAGGGCCTGGG + Intergenic
920683656 1:208092666-208092688 AAGACGGCCAAGATGGGCCAGGG + Intronic
1063066545 10:2615614-2615636 AAGAACACCACGAAAGACCATGG + Intergenic
1066045363 10:31589846-31589868 AAGAAAGCAAACACGGGCCAGGG + Intergenic
1066351031 10:34636858-34636880 AGGAAAACCAAGAAGGGCAAAGG + Intronic
1066456547 10:35577238-35577260 AGGAACGCCAAGGTTGGCCAGGG + Intergenic
1066506327 10:36048617-36048639 AAGAAGGCCAAGAAGACCTAAGG - Intergenic
1070248594 10:74753958-74753980 TAGACAGCCAAGCAGGGCCAAGG - Intergenic
1071132001 10:82405322-82405344 GAGAACCTCAAGAATGGCCATGG + Intronic
1075336630 10:121613522-121613544 AAGAGCACCAAGCAGGGCCAGGG - Intergenic
1075336679 10:121613662-121613684 GGGAGCGCCAGGAAGGGCCAGGG - Intergenic
1075336694 10:121613702-121613724 AGGAACGCCAGGGAGTGCCAGGG - Intergenic
1075598333 10:123748634-123748656 CACAGCGCCAAGAAGTGCCAGGG - Intronic
1076049009 10:127317803-127317825 AAGAACACCAAGAACAGGCAAGG - Intronic
1077691218 11:4344490-4344512 ACGAACACAAAGAAGGGCAATGG - Intergenic
1079091114 11:17480864-17480886 AGGAAATCCAAGAAGGCCCAAGG + Intergenic
1084010200 11:66343874-66343896 AAGAAAGCCAAGTACTGCCAAGG + Intronic
1084178435 11:67435131-67435153 AAGAAGTCCAAGAGGGGCCGTGG + Exonic
1084524934 11:69690899-69690921 AAGAAAGAAAGGAAGGGCCAGGG + Intergenic
1085040988 11:73326170-73326192 AAGGAGGCCAAGAAGGGTGAGGG + Intronic
1086453337 11:86938411-86938433 AAGAATGAGCAGAAGGGCCACGG + Intronic
1087737192 11:101847911-101847933 AAGAAAGCCAACAACGGCCCAGG + Intronic
1089656658 11:119952260-119952282 AAGAACCCCAAGAAGAGGAAAGG + Intergenic
1090788324 11:130069477-130069499 AAGAATGCCCAGCAGGGGCAGGG + Intergenic
1092708213 12:11307946-11307968 CAGAACGCCAAGAATGAACATGG + Intronic
1095112603 12:38314683-38314705 AAGAATGCTAAGAAGCTCCATGG - Intergenic
1095396903 12:41771962-41771984 CAGAATCCCAAGAAGGGTCAAGG - Intergenic
1095526719 12:43134819-43134841 AGGAAAGCCAAGAAGGCCAAGGG + Intergenic
1096748650 12:53744911-53744933 AAGATCTCCAAGAACTGCCAGGG - Intergenic
1098989011 12:77044221-77044243 AAGAACCAGAAGAATGGCCAGGG - Intronic
1103479032 12:121239084-121239106 ATGGAAGCCAAGAAGGCCCAGGG + Exonic
1103931579 12:124453541-124453563 AAGAAAGCCAGCAGGGGCCAGGG + Intronic
1105566794 13:21557326-21557348 AAGAACGTAAAGAAGGGAAATGG + Intronic
1107371944 13:39760966-39760988 CAGAAAGCCAAGAATGGCTAAGG - Intronic
1110123632 13:71913755-71913777 AAGAAAGCCAAGACTGGGCATGG - Intergenic
1110195823 13:72787486-72787508 AAGAAAGCAAAGAAGGTTCATGG + Intronic
1110916941 13:81032011-81032033 AAGAAGACTAAGAAGGGCCCAGG - Intergenic
1113139159 13:107127876-107127898 AAGAAGGCAGAGGAGGGCCAGGG + Intergenic
1114225521 14:20734609-20734631 AAGAATGCAAAGCAGGGCCAAGG - Intronic
1119787851 14:77326401-77326423 AAGAAGGCAACTAAGGGCCAAGG - Intronic
1123681544 15:22767851-22767873 AAGAACGCCCAGGAGCGCCCAGG - Intergenic
1123761841 15:23439616-23439638 AAGAACGCCCAGCAGTGCCCAGG - Exonic
1124333759 15:28842308-28842330 AAGAACGCCCAGGAGCGCCCAGG - Intergenic
1128288781 15:66460892-66460914 AACCACCCCAGGAAGGGCCAAGG - Intronic
1134552740 16:15145551-15145573 AGGAACGCCAGGCTGGGCCAGGG + Intergenic
1136564236 16:31060642-31060664 AAGAATCCCAAGAAGGGCACAGG + Intergenic
1137500778 16:49010382-49010404 ATGAACCCCACCAAGGGCCAGGG - Intergenic
1138162917 16:54773187-54773209 AACAAGGCAAAGAAGGGCAAAGG - Intergenic
1138558455 16:57786453-57786475 CAGGGCGCCAAGAATGGCCATGG + Intronic
1141886344 16:86895019-86895041 AGGAATCCCAAGAAGAGCCAGGG + Intergenic
1142018573 16:87765853-87765875 AAGAAGGAGAAGAAGGGCCGCGG - Exonic
1146482216 17:33213865-33213887 GAGAATGCCCAGAGGGGCCAGGG - Intronic
1146787634 17:35732772-35732794 AGGAACGCCAAGAAGAGTCCTGG - Intronic
1148069540 17:44899928-44899950 CTGAACGCCAAGAAGGGGCTGGG - Intronic
1148632204 17:49119897-49119919 AAGACAGTCAGGAAGGGCCAGGG - Intergenic
1150143133 17:62746658-62746680 AAGAAACAGAAGAAGGGCCAGGG + Intronic
1151101789 17:71564050-71564072 AACAACGCCTAGAATGGCGATGG - Intergenic
1153635214 18:7107478-7107500 AAGAATGCCAAGAAGTGTCCTGG + Intronic
1154173765 18:12068396-12068418 ACGTACGCCAAGAGGGGCAAGGG - Intergenic
1156500570 18:37554780-37554802 ATGGCTGCCAAGAAGGGCCAGGG + Intronic
1156825432 18:41425172-41425194 AAGAAAACAAAGCAGGGCCAGGG - Intergenic
1163832633 19:19554371-19554393 AAGAAAGCCAGGGAGGGCCGGGG + Intergenic
1164997436 19:32732583-32732605 AAGAAGGCAAGGAGGGGCCACGG - Intronic
1167343844 19:48932963-48932985 AATACAGCCAAGAAGGGGCAAGG + Intergenic
1167479265 19:49719535-49719557 AAGAACGCCAAGAAGGGCCAGGG - Intergenic
1168113371 19:54207516-54207538 AAGAATGCCAAGAAGGGCCAGGG + Exonic
1168517618 19:57021494-57021516 AGGAACCCCAAGAAGAGCTACGG - Intergenic
925387488 2:3472216-3472238 AAGAAGGGAAGGAAGGGCCAGGG + Intronic
927719217 2:25372409-25372431 AAGGAAGCCAGGAAGGGCCCTGG - Intergenic
929762506 2:44817704-44817726 AGGAAGGCCAAGCAGGGCCCTGG - Intergenic
929937409 2:46303581-46303603 AGGAAGGCCAAGAAGGGAGAGGG + Intronic
930386061 2:50696503-50696525 AAGAAAGACAAGAAAAGCCAAGG + Intronic
930782037 2:55232664-55232686 AAGAACGCCGCGCAGGCCCACGG - Exonic
931627666 2:64271436-64271458 AAGACAGCCCAGAATGGCCAAGG + Intergenic
932123583 2:69123526-69123548 AGAAAGGCCAAGTAGGGCCATGG + Intronic
933960455 2:87405224-87405246 AAGAACTCCAACCAGGGCAATGG + Intergenic
934244531 2:90295925-90295947 AAGAACTCCAACCAGGGCAATGG + Intergenic
934264320 2:91501547-91501569 AAGAACTCCAACCAGGGCAATGG - Intergenic
938381264 2:130837622-130837644 AGGAACCCCAAGATGGGCCGGGG + Intronic
939880019 2:147620632-147620654 AAGAAAGTCAAGAAGAGTCAAGG + Intergenic
939905496 2:147908414-147908436 AGGAAAGCAAAGAAAGGCCAAGG - Intronic
942687818 2:178552304-178552326 AAGAATGCCAAGAAGGAGCATGG - Exonic
942736963 2:179125382-179125404 AAGAAAGCCAGGCAGGGGCATGG - Intronic
945458129 2:210072191-210072213 ATGAAAGCCAAGAAAGGCTAAGG - Intronic
947122466 2:226831529-226831551 AGGAGCACCAAGAAAGGCCAAGG + Intergenic
948347211 2:237308532-237308554 GAGAAAGCCACGAAGGACCAGGG - Intergenic
1168837781 20:889130-889152 AGCAAGGCCAGGAAGGGCCATGG - Intronic
1168997229 20:2142503-2142525 AAAAACTCCTAGATGGGCCAAGG + Intronic
1169193712 20:3672634-3672656 CAGAAAGGCAAGAAGGGCCCAGG + Intronic
1169492897 20:6086161-6086183 AAGGACACAAAGAAGTGCCATGG + Intronic
1172019301 20:31901626-31901648 AAGAACACTAAGAAAAGCCAGGG - Intronic
1172188564 20:33047952-33047974 AAGAAAGCCAAGCCAGGCCAAGG - Intergenic
1172762065 20:37329800-37329822 GAGAAAGCCAGGAAGAGCCAGGG - Intergenic
1173453394 20:43185256-43185278 AAGAAAACAAACAAGGGCCATGG - Intronic
1173620625 20:44433220-44433242 AAGAATGGCAAGAGGGTCCAAGG + Intergenic
1174095879 20:48089150-48089172 AGGAGCCTCAAGAAGGGCCATGG + Intergenic
1174263285 20:49313080-49313102 AAGATGGCCAACCAGGGCCATGG + Intergenic
1175005505 20:55678025-55678047 AAGAAAGCCAAGAGGGGAGATGG + Intergenic
1175532530 20:59683988-59684010 AAGAACGCAGAGAGGGGCAATGG + Intronic
1178840271 21:36132973-36132995 AAGAATGCCAGCAAGGGCCAGGG + Intergenic
1179002599 21:37477276-37477298 AGGAACACAAAGATGGGCCAGGG + Intronic
1180025304 21:45157713-45157735 GAGAGGGACAAGAAGGGCCAGGG + Intronic
1183349766 22:37328494-37328516 AAGATCTCCAAGGATGGCCAGGG - Intergenic
1183909003 22:41064577-41064599 AAGAATGCCAAGAAGGGCCAGGG + Intergenic
1185370884 22:50460364-50460386 AAGAACGCCAAGAAGACCATCGG - Exonic
955348613 3:58178569-58178591 TAGAAAGGCAAGAAAGGCCACGG - Intergenic
955570395 3:60298896-60298918 AAGAAGACCAAGCAGTGCCAGGG + Intronic
956329750 3:68093179-68093201 ATGAAGGCCAAGAAGAGCCCAGG - Intronic
957362553 3:79177729-79177751 TAGAAAACCAAGAAGGGCAAAGG - Intronic
957664802 3:83213902-83213924 AAGAACACAAAGAAGGTTCAGGG + Intergenic
959656589 3:108812795-108812817 AAGAAACCCAAGAAGGCCCATGG - Intergenic
960971330 3:123142123-123142145 AAGAACTCCAAGAGGGACCAGGG - Intronic
962390349 3:134966472-134966494 AAAAAAGACAAGAAGAGCCAGGG - Intronic
962817872 3:139019404-139019426 AAAAACCCCAAGAAAAGCCATGG + Exonic
963769771 3:149378354-149378376 AGCAATGCCAGGAAGGGCCAAGG + Intergenic
964625019 3:158750394-158750416 AAGACGACCAAGATGGGCCAGGG - Intronic
966983722 3:185161092-185161114 AAGAAAGGCAAGAAAGGCAAAGG + Intergenic
968001801 3:195211696-195211718 AAGAAAGCAAGGAAGGGCCAGGG + Intronic
970489307 4:16555918-16555940 AAGAAGAAGAAGAAGGGCCATGG - Intronic
970835832 4:20405923-20405945 AAGAAGACCAAGAACAGCCAAGG - Intronic
974235578 4:59177352-59177374 AAGAACACAAAGAAGTACCATGG - Intergenic
978548363 4:109898041-109898063 AAGAAGGCCAAGAATGGTAAAGG - Intergenic
981783008 4:148446091-148446113 AAGAACCCAAAGAAGGGCGGGGG - Intergenic
984190598 4:176601147-176601169 AAAGACACCAGGAAGGGCCAGGG + Intergenic
985772502 5:1821702-1821724 AAGAAGGCCAAGGACGGCCAAGG - Intergenic
985772505 5:1821712-1821734 AAGAACGCCAAAGAAGGCCAAGG - Intergenic
985772589 5:1822134-1822156 AAGAATGCCAAGGAAGTCCAAGG - Intergenic
986759677 5:10868528-10868550 AGGAACTCCCAGAAGGACCATGG + Intergenic
987736267 5:21847429-21847451 AAGGAGGCCAACAAGGGGCAGGG + Intronic
990344936 5:54862730-54862752 ATGAAGGGCAAGAATGGCCAGGG + Intergenic
991565088 5:67996917-67996939 AAGAAAGCCAAGAAGAGGCAAGG + Intergenic
993149485 5:84142740-84142762 AAGAACATCAAGAAGGAACATGG + Intronic
994369782 5:98954908-98954930 AAGAATTCCAAGAAGGGCCAGGG + Intergenic
995483321 5:112614425-112614447 ATGAAAGCCAAGAAGTGCCACGG + Intergenic
996598299 5:125230520-125230542 AAGAACTACAAGAAGGGGGAGGG - Intergenic
999626991 5:153531314-153531336 AAGATCCCCAGGAAGGCCCATGG - Intronic
1002187288 5:177460253-177460275 CAGGACCCCAAGAAGGGCCAGGG - Intronic
1004854280 6:19733528-19733550 AACAATGTCAAGAAGGGCCTGGG - Intergenic
1005390428 6:25327257-25327279 AAGAACAGAAAGAACGGCCAGGG + Intronic
1007726733 6:43921325-43921347 AAGGAAGCCTGGAAGGGCCAGGG + Intergenic
1010944674 6:81959957-81959979 AAGGGGGCCAAGAAGGGCAAAGG - Intergenic
1012620068 6:101333101-101333123 AAGAAGGAAAAGAAGAGCCAAGG - Intergenic
1014215292 6:118746917-118746939 AATGAGGCCAAGCAGGGCCAGGG - Intergenic
1018211667 6:161488255-161488277 GAGAACACCATGAAGGGCCAGGG + Intronic
1018766788 6:166939987-166940009 ATGGAAGCCCAGAAGGGCCAGGG + Intronic
1019104375 6:169656635-169656657 AAGAAGGCCCAGGAGGGCCCAGG + Intronic
1019972386 7:4551491-4551513 AGAAACGCCAAGAAGGGGCAAGG + Intergenic
1021652269 7:22843843-22843865 AAGAAGACCAAGAAGGGTGAAGG - Intergenic
1024559580 7:50631913-50631935 AAGAAAGGCAAGCAGAGCCAGGG - Intronic
1025806013 7:64835501-64835523 AAAACCACCAAGAAGGACCAGGG + Intergenic
1033536065 7:142313123-142313145 AAAACCACCAAGCAGGGCCAAGG + Intergenic
1034733542 7:153409485-153409507 AAAACCACCAAGAAGGACCAGGG + Intergenic
1034970633 7:155417210-155417232 AAGAACTCCAGGGCGGGCCAGGG - Intergenic
1035534060 8:377797-377819 AAGAAAGCCAACAAGGGGCATGG - Intergenic
1035918455 8:3651395-3651417 AGGTACTCCATGAAGGGCCATGG - Intronic
1035927270 8:3741798-3741820 AAGAAAGGGTAGAAGGGCCATGG - Intronic
1040040732 8:42914648-42914670 AAGAAATACAAGAAGGGCCAAGG - Intronic
1040645865 8:49395825-49395847 ACAAAGGCCAGGAAGGGCCATGG + Intergenic
1044843617 8:96359385-96359407 GAGAACACAAGGAAGGGCCAAGG - Intergenic
1047803825 8:128338000-128338022 AAGAAAGCAAATCAGGGCCACGG - Intergenic
1048004674 8:130409615-130409637 AAGAAAGCCAAGAAGGGCTGAGG + Intronic
1048532943 8:135266774-135266796 GAGAACCACAAGAAGGGGCATGG - Intergenic
1050682837 9:8134152-8134174 AACAATAGCAAGAAGGGCCATGG + Intergenic
1051132731 9:13880818-13880840 AAGAAAGCAAAGAGGGGCAAGGG - Intergenic
1054776882 9:69131373-69131395 AAGAAATCCAAGAAGGGCAGTGG + Intronic
1056548218 9:87630482-87630504 CAGGACTCCAAGAAGGACCAGGG - Intronic
1059277354 9:113107893-113107915 AGGAAGGACAAGAAGAGCCATGG + Intergenic
1059278897 9:113116658-113116680 AGGAAGGACAAGAAGAGCCATGG - Intergenic
1060560710 9:124540366-124540388 AGGAAGGCCACGAAGGGCCATGG - Intronic
1060624513 9:125098617-125098639 AAGAATGCTAAGATGGGGCATGG + Intronic
1060979971 9:127786209-127786231 AAGCTCGCCAAGATCGGCCAAGG + Exonic
1061855907 9:133441850-133441872 AAGGAGCCCAAGAAGGGCTAGGG - Intronic
1062243155 9:135550422-135550444 AAGAAGGCCAGGGTGGGCCAAGG - Intergenic
1188407100 X:29825232-29825254 AAGAAAGGCAAGAATGGCTATGG - Intronic
1189010122 X:37038623-37038645 AGGAAGGCCAAGAAGGGACTTGG + Intergenic
1189038462 X:37517107-37517129 AGGAAGGCCAAGAAGGGACTTGG - Intronic
1189905457 X:45754635-45754657 ATGAATGCCATGAAGGACCACGG + Intergenic
1191664671 X:63687841-63687863 AAGAACGCCAACAAGATCTAGGG + Intronic
1194380935 X:93190919-93190941 AAGAACACCAGGTGGGGCCAGGG - Intergenic
1195680613 X:107543346-107543368 AAGAACAGCAAGGAAGGCCAAGG - Intronic
1200932714 Y:8711588-8711610 ATGAAAGCAAAGAAAGGCCAAGG + Intergenic