ID: 1167479344

View in Genome Browser
Species Human (GRCh38)
Location 19:49719955-49719977
Sequence TGGGTTCCGGAACAAACGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 1, 2: 1, 3: 1, 4: 46}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167479344_1167479351 27 Left 1167479344 19:49719955-49719977 CCTCACGTTTGTTCCGGAACCCA 0: 1
1: 1
2: 1
3: 1
4: 46
Right 1167479351 19:49720005-49720027 TCGAGACGAGATTTCTCGAAGGG No data
1167479344_1167479348 4 Left 1167479344 19:49719955-49719977 CCTCACGTTTGTTCCGGAACCCA 0: 1
1: 1
2: 1
3: 1
4: 46
Right 1167479348 19:49719982-49720004 CGCCGATCAGCTTCAGCTCTTGG 0: 1
1: 1
2: 1
3: 3
4: 43
1167479344_1167479350 26 Left 1167479344 19:49719955-49719977 CCTCACGTTTGTTCCGGAACCCA 0: 1
1: 1
2: 1
3: 1
4: 46
Right 1167479350 19:49720004-49720026 GTCGAGACGAGATTTCTCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167479344 Original CRISPR TGGGTTCCGGAACAAACGTG AGG (reversed) Intergenic