ID: 1167479345

View in Genome Browser
Species Human (GRCh38)
Location 19:49719968-49719990
Sequence TGATCGGCGAGTATGGGTTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 27
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 24}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167479345_1167479348 -9 Left 1167479345 19:49719968-49719990 CCGGAACCCATACTCGCCGATCA 0: 1
1: 0
2: 0
3: 2
4: 24
Right 1167479348 19:49719982-49720004 CGCCGATCAGCTTCAGCTCTTGG 0: 1
1: 1
2: 1
3: 3
4: 43
1167479345_1167479353 24 Left 1167479345 19:49719968-49719990 CCGGAACCCATACTCGCCGATCA 0: 1
1: 0
2: 0
3: 2
4: 24
Right 1167479353 19:49720015-49720037 ATTTCTCGAAGGGTCTCCGCGGG No data
1167479345_1167479352 23 Left 1167479345 19:49719968-49719990 CCGGAACCCATACTCGCCGATCA 0: 1
1: 0
2: 0
3: 2
4: 24
Right 1167479352 19:49720014-49720036 GATTTCTCGAAGGGTCTCCGCGG 0: 2
1: 0
2: 1
3: 2
4: 46
1167479345_1167479354 25 Left 1167479345 19:49719968-49719990 CCGGAACCCATACTCGCCGATCA 0: 1
1: 0
2: 0
3: 2
4: 24
Right 1167479354 19:49720016-49720038 TTTCTCGAAGGGTCTCCGCGGGG 0: 2
1: 0
2: 2
3: 1
4: 22
1167479345_1167479351 14 Left 1167479345 19:49719968-49719990 CCGGAACCCATACTCGCCGATCA 0: 1
1: 0
2: 0
3: 2
4: 24
Right 1167479351 19:49720005-49720027 TCGAGACGAGATTTCTCGAAGGG No data
1167479345_1167479350 13 Left 1167479345 19:49719968-49719990 CCGGAACCCATACTCGCCGATCA 0: 1
1: 0
2: 0
3: 2
4: 24
Right 1167479350 19:49720004-49720026 GTCGAGACGAGATTTCTCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167479345 Original CRISPR TGATCGGCGAGTATGGGTTC CGG (reversed) Intergenic
902208830 1:14890159-14890181 TGCTCTGCGAGTTTGGGTTTTGG + Intronic
904485056 1:30819182-30819204 TGATGGGCGAGTGTGGGGTGAGG - Intergenic
905548088 1:38816114-38816136 TGCTCGGAGAGTATGAGCTCTGG - Intergenic
919812072 1:201415009-201415031 GGATCCTCGAGTATGGATTCTGG - Intronic
1084307785 11:68298148-68298170 TAATAGGCGAGTAGGGGCTCAGG + Intergenic
1092205768 12:6613569-6613591 TGGTAGGCGAGTAAGGGTTGAGG + Intergenic
1093202070 12:16199838-16199860 TTATAGGTGAGTATGAGTTCTGG + Intronic
1098625486 12:72660574-72660596 TAACCGGCGAGTATAGGGTCAGG - Intronic
1159841019 18:73399099-73399121 TCATGGGCTAGTATGGGTTAAGG + Intergenic
1160005071 18:75063497-75063519 TGCTCGGGGAGGATGGGTCCGGG - Exonic
1160747704 19:719713-719735 TGATCGGCGAGGCTGGGACCAGG - Intronic
1162734457 19:12738375-12738397 TGAGAGGAGAGTATGGGTTATGG - Intronic
1167479345 19:49719968-49719990 TGATCGGCGAGTATGGGTTCCGG - Intergenic
929755895 2:44764495-44764517 GGATCAGCGAGGATGGGTTAAGG + Intronic
1172095015 20:32456330-32456352 TGCTCGACGTGGATGGGTTCAGG + Exonic
1183908920 22:41064143-41064165 TGATCGAAGAGTATGGGCTCCGG + Intergenic
960808891 3:121610016-121610038 TGCTGGGCCATTATGGGTTCAGG + Intronic
960987394 3:123289931-123289953 TCATCAGCGAGGATCGGTTCCGG - Exonic
979354250 4:119684422-119684444 TGATCATCGAGAATGGGTTCAGG - Intergenic
981751973 4:148101480-148101502 TGATGGGAGAGGAAGGGTTCAGG + Intronic
995415698 5:111910603-111910625 TGCTTGCCGAGTATGGGTTTAGG + Intronic
1009651432 6:66481398-66481420 TGTGCTGCGAGGATGGGTTCTGG - Intergenic
1023087528 7:36586292-36586314 TGATTGGAAAGAATGGGTTCAGG - Intronic
1042844732 8:73158609-73158631 TGATCTGAGACTCTGGGTTCAGG - Intergenic
1045294487 8:100861615-100861637 TGATAGGAGAGTCTGAGTTCTGG - Intergenic
1062243290 9:135551022-135551044 AGAGCGGCGAGTGTGGGTGCAGG + Intergenic
1187451219 X:19398157-19398179 TGAGCGGTGGGTATGGGATCTGG + Intronic