ID: 1167479346

View in Genome Browser
Species Human (GRCh38)
Location 19:49719974-49719996
Sequence TGAAGCTGATCGGCGAGTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 32
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 29}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167479346_1167479354 19 Left 1167479346 19:49719974-49719996 CCCATACTCGCCGATCAGCTTCA 0: 1
1: 0
2: 1
3: 1
4: 29
Right 1167479354 19:49720016-49720038 TTTCTCGAAGGGTCTCCGCGGGG 0: 2
1: 0
2: 2
3: 1
4: 22
1167479346_1167479351 8 Left 1167479346 19:49719974-49719996 CCCATACTCGCCGATCAGCTTCA 0: 1
1: 0
2: 1
3: 1
4: 29
Right 1167479351 19:49720005-49720027 TCGAGACGAGATTTCTCGAAGGG No data
1167479346_1167479353 18 Left 1167479346 19:49719974-49719996 CCCATACTCGCCGATCAGCTTCA 0: 1
1: 0
2: 1
3: 1
4: 29
Right 1167479353 19:49720015-49720037 ATTTCTCGAAGGGTCTCCGCGGG No data
1167479346_1167479350 7 Left 1167479346 19:49719974-49719996 CCCATACTCGCCGATCAGCTTCA 0: 1
1: 0
2: 1
3: 1
4: 29
Right 1167479350 19:49720004-49720026 GTCGAGACGAGATTTCTCGAAGG No data
1167479346_1167479352 17 Left 1167479346 19:49719974-49719996 CCCATACTCGCCGATCAGCTTCA 0: 1
1: 0
2: 1
3: 1
4: 29
Right 1167479352 19:49720014-49720036 GATTTCTCGAAGGGTCTCCGCGG 0: 2
1: 0
2: 1
3: 2
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167479346 Original CRISPR TGAAGCTGATCGGCGAGTAT GGG (reversed) Intergenic
904485058 1:30819188-30819210 CGGAGCTGATGGGCGAGTGTGGG - Intergenic
904648013 1:31982713-31982735 TGAAGATGATGGGCCAGTCTGGG + Intergenic
912763614 1:112389645-112389667 TGAAGCTGATGGGCCAGGACGGG - Intergenic
922371631 1:224917044-224917066 AGAATCTGATCGGCCAGTTTGGG + Intronic
1092266117 12:6981800-6981822 TGAAGCTGATTGGTGAGTGATGG - Exonic
1095133055 12:38566411-38566433 TGATGCTGATCGGACAGGATGGG + Intergenic
1096660258 12:53119684-53119706 TCAAGCTGAGGGGCCAGTATGGG - Intronic
1112195932 13:97226252-97226274 TGAGGCTGATGGACGAGTTTTGG + Intronic
1113123837 13:106954468-106954490 TGAAGATGATTGGCCAATATTGG + Intergenic
1116426886 14:44801361-44801383 TGAAGCTGATCTGGGTGTTTTGG - Intergenic
1128785768 15:70395805-70395827 AGAAGCTGATCTGAGAGTAAAGG - Intergenic
1131203792 15:90424427-90424449 AGAAGCTTATCATCGAGTATAGG + Intronic
1133916926 16:10117427-10117449 TGAAGCTGGATGGTGAGTATAGG + Intronic
1138827405 16:60337019-60337041 AGAACCTGATGGGGGAGTATGGG - Intergenic
1142258732 16:89032136-89032158 AGAAGCAGAGCGGGGAGTATGGG - Intergenic
1146126438 17:30235406-30235428 TGAAGCTGACCGGCCAGAGTGGG - Intronic
1148149145 17:45385711-45385733 TGAAGCTGAACTGCCAGTAGGGG - Intergenic
1157170609 18:45401499-45401521 TGAAGCTGATGGCTGAGGATGGG + Intronic
1165882055 19:39051286-39051308 TGTAGCTGACCGGAGAGCATCGG + Intergenic
1167479346 19:49719974-49719996 TGAAGCTGATCGGCGAGTATGGG - Intergenic
1172903743 20:38353759-38353781 TGAATCTGATAGGCGAGAACTGG + Intronic
1178840198 21:36132535-36132557 TAAAGCTGATTGGTGAGTATGGG + Intergenic
1183396153 22:37571980-37572002 TGAAGCTGCTGGGCAAGTGTGGG - Intronic
1183908919 22:41064137-41064159 TGAAGCTGATCGAAGAGTATGGG + Intergenic
952402762 3:32978093-32978115 TTAAGCTGATGGGAGAGTAGAGG + Intergenic
973724796 4:53764388-53764410 TGAGGCTGCTGGGGGAGTATGGG + Intronic
986501920 5:8409695-8409717 TGATGCTGATCAGAGAGTACAGG + Intergenic
1023401629 7:39795835-39795857 TGAAGCTGCTGGGGCAGTATGGG - Intergenic
1035780734 8:2226480-2226502 GGAAGCTGTTCGGCGAGCAATGG - Intergenic
1036593484 8:10190952-10190974 TGAAGCTGATCGACCAGTCATGG - Intronic
1055524634 9:77118603-77118625 TGAAGATGAACGTTGAGTATAGG - Intergenic
1200735346 Y:6788064-6788086 TGAAGCTGATGAGTGAGTTTCGG + Intergenic