ID: 1167479346 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 19:49719974-49719996 |
Sequence | TGAAGCTGATCGGCGAGTAT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 32 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 1, 4: 29} |
Found 5 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1167479346_1167479352 | 17 | Left | 1167479346 | 19:49719974-49719996 | CCCATACTCGCCGATCAGCTTCA | 0: 1 1: 0 2: 1 3: 1 4: 29 |
||
Right | 1167479352 | 19:49720014-49720036 | GATTTCTCGAAGGGTCTCCGCGG | 0: 2 1: 0 2: 1 3: 2 4: 46 |
||||
1167479346_1167479353 | 18 | Left | 1167479346 | 19:49719974-49719996 | CCCATACTCGCCGATCAGCTTCA | 0: 1 1: 0 2: 1 3: 1 4: 29 |
||
Right | 1167479353 | 19:49720015-49720037 | ATTTCTCGAAGGGTCTCCGCGGG | No data | ||||
1167479346_1167479351 | 8 | Left | 1167479346 | 19:49719974-49719996 | CCCATACTCGCCGATCAGCTTCA | 0: 1 1: 0 2: 1 3: 1 4: 29 |
||
Right | 1167479351 | 19:49720005-49720027 | TCGAGACGAGATTTCTCGAAGGG | No data | ||||
1167479346_1167479350 | 7 | Left | 1167479346 | 19:49719974-49719996 | CCCATACTCGCCGATCAGCTTCA | 0: 1 1: 0 2: 1 3: 1 4: 29 |
||
Right | 1167479350 | 19:49720004-49720026 | GTCGAGACGAGATTTCTCGAAGG | No data | ||||
1167479346_1167479354 | 19 | Left | 1167479346 | 19:49719974-49719996 | CCCATACTCGCCGATCAGCTTCA | 0: 1 1: 0 2: 1 3: 1 4: 29 |
||
Right | 1167479354 | 19:49720016-49720038 | TTTCTCGAAGGGTCTCCGCGGGG | 0: 2 1: 0 2: 2 3: 1 4: 22 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1167479346 | Original CRISPR | TGAAGCTGATCGGCGAGTAT GGG (reversed) | Intergenic | ||