ID: 1167479346

View in Genome Browser
Species Human (GRCh38)
Location 19:49719974-49719996
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 32
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 29}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167479346_1167479352 17 Left 1167479346 19:49719974-49719996 CCCATACTCGCCGATCAGCTTCA 0: 1
1: 0
2: 1
3: 1
4: 29
Right 1167479352 19:49720014-49720036 GATTTCTCGAAGGGTCTCCGCGG 0: 2
1: 0
2: 1
3: 2
4: 46
1167479346_1167479351 8 Left 1167479346 19:49719974-49719996 CCCATACTCGCCGATCAGCTTCA 0: 1
1: 0
2: 1
3: 1
4: 29
Right 1167479351 19:49720005-49720027 TCGAGACGAGATTTCTCGAAGGG No data
1167479346_1167479354 19 Left 1167479346 19:49719974-49719996 CCCATACTCGCCGATCAGCTTCA 0: 1
1: 0
2: 1
3: 1
4: 29
Right 1167479354 19:49720016-49720038 TTTCTCGAAGGGTCTCCGCGGGG 0: 2
1: 0
2: 2
3: 1
4: 22
1167479346_1167479350 7 Left 1167479346 19:49719974-49719996 CCCATACTCGCCGATCAGCTTCA 0: 1
1: 0
2: 1
3: 1
4: 29
Right 1167479350 19:49720004-49720026 GTCGAGACGAGATTTCTCGAAGG No data
1167479346_1167479353 18 Left 1167479346 19:49719974-49719996 CCCATACTCGCCGATCAGCTTCA 0: 1
1: 0
2: 1
3: 1
4: 29
Right 1167479353 19:49720015-49720037 ATTTCTCGAAGGGTCTCCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167479346 Original CRISPR TGAAGCTGATCGGCGAGTAT GGG (reversed) Intergenic