ID: 1167479347

View in Genome Browser
Species Human (GRCh38)
Location 19:49719975-49719997
Sequence CTGAAGCTGATCGGCGAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 36}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167479347_1167479354 18 Left 1167479347 19:49719975-49719997 CCATACTCGCCGATCAGCTTCAG 0: 1
1: 0
2: 1
3: 2
4: 36
Right 1167479354 19:49720016-49720038 TTTCTCGAAGGGTCTCCGCGGGG 0: 2
1: 0
2: 2
3: 1
4: 22
1167479347_1167479353 17 Left 1167479347 19:49719975-49719997 CCATACTCGCCGATCAGCTTCAG 0: 1
1: 0
2: 1
3: 2
4: 36
Right 1167479353 19:49720015-49720037 ATTTCTCGAAGGGTCTCCGCGGG No data
1167479347_1167479352 16 Left 1167479347 19:49719975-49719997 CCATACTCGCCGATCAGCTTCAG 0: 1
1: 0
2: 1
3: 2
4: 36
Right 1167479352 19:49720014-49720036 GATTTCTCGAAGGGTCTCCGCGG 0: 2
1: 0
2: 1
3: 2
4: 46
1167479347_1167479350 6 Left 1167479347 19:49719975-49719997 CCATACTCGCCGATCAGCTTCAG 0: 1
1: 0
2: 1
3: 2
4: 36
Right 1167479350 19:49720004-49720026 GTCGAGACGAGATTTCTCGAAGG No data
1167479347_1167479351 7 Left 1167479347 19:49719975-49719997 CCATACTCGCCGATCAGCTTCAG 0: 1
1: 0
2: 1
3: 2
4: 36
Right 1167479351 19:49720005-49720027 TCGAGACGAGATTTCTCGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167479347 Original CRISPR CTGAAGCTGATCGGCGAGTA TGG (reversed) Intergenic
910043690 1:82886523-82886545 ATGATGCTGATCTGGGAGTAGGG + Intergenic
912763615 1:112389646-112389668 CTGAAGCTGATGGGCCAGGACGG - Intergenic
921987439 1:221327448-221327470 ATGAAGCTGAGGGGAGAGTATGG - Intergenic
924496710 1:244597213-244597235 CAGAAGCTGAAGGGCTAGTAGGG - Intronic
1067762131 10:49056443-49056465 CTGAAGCTGAACAGGGAGTGGGG - Intronic
1073445266 10:103576632-103576654 CTCAGGCTGATCTGGGAGTAAGG + Intronic
1086797984 11:91132932-91132954 CTGAAGCAGATAAGCGAGCAAGG - Intergenic
1099413480 12:82359554-82359576 CTGAAGCTGAGAGGCCAGTTAGG + Intronic
1104505665 12:129329855-129329877 CTGAAGATGAGGGGAGAGTATGG + Intronic
1117740339 14:58812202-58812224 CTGAAGCGGATAGGAGAGAAAGG - Intergenic
1128067754 15:64775288-64775310 CTGAAGCCGGACGGCGAGCACGG - Exonic
1135402983 16:22178899-22178921 CTGGATCTGATCTGGGAGTACGG + Intronic
1135843650 16:25898443-25898465 ATGAAGCTGATCTGCAAGAAGGG - Intronic
1138827406 16:60337020-60337042 CAGAACCTGATGGGGGAGTATGG - Intergenic
1146126439 17:30235407-30235429 CTGAAGCTGACCGGCCAGAGTGG - Intronic
1148149146 17:45385712-45385734 TTGAAGCTGAACTGCCAGTAGGG - Intergenic
1157170608 18:45401498-45401520 CTGAAGCTGATGGCTGAGGATGG + Intronic
1165246256 19:34500138-34500160 CTGCAGCTGAGCGGGGAGGAGGG + Exonic
1165832631 19:38736971-38736993 CTGAAGAGGATCGGGGAGGAGGG - Intronic
1167479347 19:49719975-49719997 CTGAAGCTGATCGGCGAGTATGG - Intergenic
946361434 2:219221258-219221280 CTGAACCTGAGCGGCATGTATGG - Exonic
1176367780 21:6044212-6044234 CTGACCCTGATCGCCGAGTGTGG - Intergenic
1178840197 21:36132534-36132556 CTAAAGCTGATTGGTGAGTATGG + Intergenic
1179755739 21:43494330-43494352 CTGACCCTGATCGCCGAGTGTGG + Intergenic
1183908918 22:41064136-41064158 CTGAAGCTGATCGAAGAGTATGG + Intergenic
950205455 3:11076804-11076826 CTGAAGCAGATCAGGGAGGAAGG - Intergenic
955314338 3:57922994-57923016 CTGAAGCTGCTCCGAGAGAAAGG + Exonic
965346761 3:167560458-167560480 CTAAAGCTGAATGGTGAGTAAGG - Intronic
976207834 4:82639340-82639362 CTCCAGATGATCTGCGAGTAAGG + Intronic
994369722 5:98954468-98954490 CTAAAACTGATAGGCAAGTATGG + Intergenic
996144323 5:119955188-119955210 CTGAAGCTGATCTGTGATTCTGG + Intergenic
1001514592 5:172346438-172346460 CTAAAGCTGATGGGCCAGTGAGG - Intronic
1012919742 6:105209176-105209198 CTGAAGCAGAACAGAGAGTAGGG - Intergenic
1016450389 6:144176231-144176253 CTGAAGCTGTTGGGGGAGTTAGG - Intronic
1023401630 7:39795836-39795858 CTGAAGCTGCTGGGGCAGTATGG - Intergenic
1033659118 7:143391614-143391636 CTGGAGCTGACCGCTGAGTAAGG - Exonic
1044946886 8:97397628-97397650 ATGAAGCTTATGGGCTAGTAGGG - Intergenic
1057436999 9:95049949-95049971 CTGAAGTTGATAGGGGAGCAGGG - Intronic
1194449803 X:94030528-94030550 CTGAAGCTGTGCAGCTAGTATGG - Intergenic
1199481992 X:148307852-148307874 CTGAAGCTGCTCAGCTAGGAAGG - Intergenic