ID: 1167479349

View in Genome Browser
Species Human (GRCh38)
Location 19:49719984-49720006
Sequence GACCAAGAGCTGAAGCTGAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167479349_1167479354 9 Left 1167479349 19:49719984-49720006 CCGATCAGCTTCAGCTCTTGGTC No data
Right 1167479354 19:49720016-49720038 TTTCTCGAAGGGTCTCCGCGGGG 0: 2
1: 0
2: 2
3: 1
4: 22
1167479349_1167479353 8 Left 1167479349 19:49719984-49720006 CCGATCAGCTTCAGCTCTTGGTC No data
Right 1167479353 19:49720015-49720037 ATTTCTCGAAGGGTCTCCGCGGG No data
1167479349_1167479352 7 Left 1167479349 19:49719984-49720006 CCGATCAGCTTCAGCTCTTGGTC No data
Right 1167479352 19:49720014-49720036 GATTTCTCGAAGGGTCTCCGCGG 0: 2
1: 0
2: 1
3: 2
4: 46
1167479349_1167479351 -2 Left 1167479349 19:49719984-49720006 CCGATCAGCTTCAGCTCTTGGTC No data
Right 1167479351 19:49720005-49720027 TCGAGACGAGATTTCTCGAAGGG No data
1167479349_1167479350 -3 Left 1167479349 19:49719984-49720006 CCGATCAGCTTCAGCTCTTGGTC No data
Right 1167479350 19:49720004-49720026 GTCGAGACGAGATTTCTCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167479349 Original CRISPR GACCAAGAGCTGAAGCTGAT CGG (reversed) Intergenic