ID: 1167479351

View in Genome Browser
Species Human (GRCh38)
Location 19:49720005-49720027
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167479347_1167479351 7 Left 1167479347 19:49719975-49719997 CCATACTCGCCGATCAGCTTCAG 0: 1
1: 0
2: 1
3: 2
4: 36
Right 1167479351 19:49720005-49720027 TCGAGACGAGATTTCTCGAAGGG No data
1167479346_1167479351 8 Left 1167479346 19:49719974-49719996 CCCATACTCGCCGATCAGCTTCA 0: 1
1: 0
2: 1
3: 1
4: 29
Right 1167479351 19:49720005-49720027 TCGAGACGAGATTTCTCGAAGGG No data
1167479345_1167479351 14 Left 1167479345 19:49719968-49719990 CCGGAACCCATACTCGCCGATCA 0: 1
1: 0
2: 0
3: 2
4: 24
Right 1167479351 19:49720005-49720027 TCGAGACGAGATTTCTCGAAGGG No data
1167479349_1167479351 -2 Left 1167479349 19:49719984-49720006 CCGATCAGCTTCAGCTCTTGGTC No data
Right 1167479351 19:49720005-49720027 TCGAGACGAGATTTCTCGAAGGG No data
1167479344_1167479351 27 Left 1167479344 19:49719955-49719977 CCTCACGTTTGTTCCGGAACCCA 0: 1
1: 1
2: 1
3: 1
4: 46
Right 1167479351 19:49720005-49720027 TCGAGACGAGATTTCTCGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167479351 Original CRISPR TCGAGACGAGATTTCTCGAA GGG Intergenic