ID: 1167479354

View in Genome Browser
Species Human (GRCh38)
Location 19:49720016-49720038
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 27
Summary {0: 2, 1: 0, 2: 2, 3: 1, 4: 22}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167479347_1167479354 18 Left 1167479347 19:49719975-49719997 CCATACTCGCCGATCAGCTTCAG 0: 1
1: 0
2: 1
3: 2
4: 36
Right 1167479354 19:49720016-49720038 TTTCTCGAAGGGTCTCCGCGGGG 0: 2
1: 0
2: 2
3: 1
4: 22
1167479346_1167479354 19 Left 1167479346 19:49719974-49719996 CCCATACTCGCCGATCAGCTTCA 0: 1
1: 0
2: 1
3: 1
4: 29
Right 1167479354 19:49720016-49720038 TTTCTCGAAGGGTCTCCGCGGGG 0: 2
1: 0
2: 2
3: 1
4: 22
1167479345_1167479354 25 Left 1167479345 19:49719968-49719990 CCGGAACCCATACTCGCCGATCA 0: 1
1: 0
2: 0
3: 2
4: 24
Right 1167479354 19:49720016-49720038 TTTCTCGAAGGGTCTCCGCGGGG 0: 2
1: 0
2: 2
3: 1
4: 22
1167479349_1167479354 9 Left 1167479349 19:49719984-49720006 CCGATCAGCTTCAGCTCTTGGTC No data
Right 1167479354 19:49720016-49720038 TTTCTCGAAGGGTCTCCGCGGGG 0: 2
1: 0
2: 2
3: 1
4: 22

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167479354 Original CRISPR TTTCTCGAAGGGTCTCCGCG GGG Intergenic