ID: 1167480073

View in Genome Browser
Species Human (GRCh38)
Location 19:49724737-49724759
Sequence AAGAAACATCATTGTTGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167480073_1167480077 6 Left 1167480073 19:49724737-49724759 CCCGGCCAACAATGATGTTTCTT No data
Right 1167480077 19:49724766-49724788 GCCGTCTTAGACATTGCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167480073 Original CRISPR AAGAAACATCATTGTTGGCC GGG (reversed) Intergenic
No off target data available for this crispr