ID: 1167483796

View in Genome Browser
Species Human (GRCh38)
Location 19:49748373-49748395
Sequence CCTGCAGAGACTGCACGTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 168}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167483787_1167483796 19 Left 1167483787 19:49748331-49748353 CCCTGGAGGAAGGGCAGGTGTTG 0: 1
1: 0
2: 3
3: 34
4: 359
Right 1167483796 19:49748373-49748395 CCTGCAGAGACTGCACGTGCTGG 0: 1
1: 0
2: 1
3: 15
4: 168
1167483788_1167483796 18 Left 1167483788 19:49748332-49748354 CCTGGAGGAAGGGCAGGTGTTGG 0: 1
1: 0
2: 6
3: 61
4: 446
Right 1167483796 19:49748373-49748395 CCTGCAGAGACTGCACGTGCTGG 0: 1
1: 0
2: 1
3: 15
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167483796 Original CRISPR CCTGCAGAGACTGCACGTGC TGG Exonic
900782556 1:4627527-4627549 CCTGCAGAGGCTGCCCCCGCTGG - Intergenic
901931412 1:12598106-12598128 CATGTAGAGACTGGATGTGCGGG - Intronic
902559248 1:17266814-17266836 CTTGCAGGCAGTGCACGTGCTGG - Exonic
903657267 1:24956994-24957016 CCCACAGGGACTGCATGTGCTGG + Intronic
907052029 1:51336033-51336055 CTGGCAGAGACTGCAGGTGTTGG - Intronic
911092897 1:94031828-94031850 CCAGCAGCGCCTGCACATGCTGG + Exonic
919614121 1:199783895-199783917 CCTGCAGAGAGTGCAAGTTCAGG + Intergenic
919805741 1:201380103-201380125 CCTGCTGAGGCTGCAGCTGCAGG + Intronic
1065101293 10:22335285-22335307 CCTGCAGAGCCTGCGCCTGCCGG + Intergenic
1065164158 10:22957353-22957375 GCTACAGAGACTGCACTTGCGGG + Intronic
1065179042 10:23106696-23106718 CCTGGTGAGGCTGCACCTGCAGG - Intronic
1067836048 10:49642454-49642476 CCTGCAGAGCCTGCACATGATGG + Intronic
1068558467 10:58484750-58484772 CATGCAGAGAATGCAGATGCAGG - Intergenic
1069858196 10:71453350-71453372 TCTGCAGAGACTGCCGATGCGGG - Intronic
1072310507 10:94149827-94149849 CCTTCAGAGACAGCAGGGGCTGG + Intronic
1073606573 10:104901594-104901616 CCTGGAGAGACTGTAGGTGAGGG - Intronic
1076694099 10:132238698-132238720 CCTGGAGAGACTGCCCCTCCTGG - Intronic
1076759570 10:132595236-132595258 CCTGCAGAAACTGCATGCCCTGG - Intronic
1077063165 11:626530-626552 CCTGCAGAGACAGCACGTGAGGG + Exonic
1077091536 11:780555-780577 CCTTCAGAACTTGCACGTGCTGG + Intronic
1077557304 11:3231814-3231836 CCTTGAGAGTCTGCACCTGCAGG + Intronic
1079300569 11:19275560-19275582 CCAGCAGAAACTGCAAGGGCGGG - Intergenic
1080606839 11:33870541-33870563 CCAGCCGGGACTGCACGGGCTGG + Intronic
1080839014 11:35967137-35967159 CCTGCAGGGACTGGGCCTGCTGG + Intronic
1083036108 11:59639061-59639083 CCGGCAGAAACTGAACTTGCTGG - Exonic
1083195857 11:61086708-61086730 ACTTCACACACTGCACGTGCTGG - Intergenic
1084719612 11:70895927-70895949 ACTGGGGAGACTGCACGTGAGGG - Intronic
1085788019 11:79471989-79472011 TGTGCATAGACTGCATGTGCTGG - Intergenic
1088133220 11:106521283-106521305 CTTGCAGAGGCTGCATGTGTTGG - Intergenic
1089209499 11:116790784-116790806 CCTGCAGCTCCTGCACGCGCAGG + Exonic
1096684609 12:53279728-53279750 CCTCCAGAGCCTGCATGGGCTGG - Exonic
1101605864 12:106247534-106247556 CCTGCCGAGCCTGCGCGAGCAGG + Exonic
1102224337 12:111217291-111217313 ACTGCAGAAACTGCACGTTCTGG + Intronic
1104199973 12:126579055-126579077 CCTGCAGCATCTGCACCTGCAGG - Intergenic
1105018049 12:132798118-132798140 CCTGCAGTGACTGCTCGTTAAGG - Intronic
1105821596 13:24085595-24085617 CATGCAGAGAAGGCACGTGGTGG - Intronic
1107382808 13:39875577-39875599 CGTACAGAGCCTGCACATGCCGG + Intergenic
1107725827 13:43298369-43298391 GCTGCAGAAACTGCAGTTGCTGG + Exonic
1107898362 13:44988371-44988393 TCTGCAGAGACTGCATAGGCTGG + Intronic
1108359963 13:49659955-49659977 CCTGCAGAGGCTGCAGGCCCTGG - Intergenic
1112181935 13:97091624-97091646 CCTGCAGAGAGTGCACTGGCAGG - Intergenic
1113941750 13:114022022-114022044 CGTGCACAGACTGCTGGTGCTGG - Intronic
1117293194 14:54353516-54353538 CCTCCAGAGCCAGCATGTGCTGG + Intergenic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1119131610 14:72178051-72178073 CCTGCAGCCAATGCACCTGCTGG + Intronic
1122064963 14:99166481-99166503 CTTGCAGAGAATGCACATGGAGG - Intergenic
1122244952 14:100395836-100395858 CCTGCACAGACTGGAGGTGAGGG - Intronic
1123051741 14:105547347-105547369 GCTGCAGAGACTGGATGTGAAGG + Intergenic
1123506302 15:20943030-20943052 CCTCCAGAGACTGCAGGAGAAGG - Intergenic
1123563528 15:21516734-21516756 CCTCCAGAGACTGCAGGAGAAGG - Intergenic
1123599780 15:21954021-21954043 CCTCCAGAGACTGCAGGAGAAGG - Intergenic
1124319605 15:28703148-28703170 CCCCCAGAGACTGCACATGTTGG + Intronic
1124890185 15:33725446-33725468 CCGCCAGAGACTGCCTGTGCAGG + Intronic
1127174365 15:56338190-56338212 CCTGCAGAGCCTGAAGTTGCTGG + Intronic
1128385533 15:67145666-67145688 CCTGTAGAGATTGCACATGTAGG - Intronic
1131340845 15:91599231-91599253 TCTGCACATACTGCAAGTGCAGG + Intergenic
1132372889 15:101310226-101310248 CCTGCAGAGGCTGACAGTGCTGG - Intronic
1132381545 15:101369873-101369895 CCTGCAGAACCTGCACCAGCAGG - Intronic
1202971886 15_KI270727v1_random:243871-243893 CCTCCAGAGACTGCAGGAGAAGG - Intergenic
1132659139 16:1053830-1053852 CCTGCCCAGTCTGCACCTGCTGG - Intergenic
1133202102 16:4209977-4209999 CCTGAAGAGAAGGCACGTGCAGG - Intronic
1133480116 16:6161922-6161944 CCTTCAGAAACTGCAGGGGCTGG + Intronic
1134021825 16:10926333-10926355 TCTGTAGAGTCTGCAAGTGCAGG - Exonic
1135147053 16:19971851-19971873 CCTGCAGAGGCTGAATGAGCTGG - Intergenic
1136849884 16:33604168-33604190 CCTTCAGAGTCTGCTCATGCAGG + Intergenic
1138343277 16:56304829-56304851 CCTGTGCAGACTGCACGTGTAGG - Intronic
1140670802 16:77277176-77277198 CAGGCAGAGACCCCACGTGCTGG - Intronic
1203111495 16_KI270728v1_random:1452621-1452643 CCTTCAGAGTCTGCTCATGCAGG + Intergenic
1143314718 17:6023649-6023671 CCTGCAGAGACTGGCTGTGAAGG + Intronic
1145403625 17:22568314-22568336 CCTCCAGAGACTGCAGGAGAAGG + Intergenic
1151678103 17:75610244-75610266 GCGGCAGAGACTGCAGGTGCAGG + Intergenic
1152926028 17:83088168-83088190 CCTGCAGAGGCGGCTGGTGCAGG - Intronic
1152941905 17:83177222-83177244 CCTGCAGAGCCTGCTGGAGCCGG + Intergenic
1153027021 18:681310-681332 GCTGCAGAGCCTGCAGGTCCAGG - Intronic
1153304140 18:3617058-3617080 CCTGGAGAGACTGCAAGCTCAGG + Intronic
1153759404 18:8316206-8316228 CCAGTAGAGACTGCAGGAGCTGG - Intronic
1154092515 18:11378658-11378680 CCTGCAGGGACTACAGGAGCCGG + Intergenic
1154107438 18:11534536-11534558 CCTGCAGAGACTGCAGGAGAAGG - Intergenic
1154172620 18:12062169-12062191 CCTCCAGAGACTGCAGGAGAAGG - Intergenic
1154485453 18:14868317-14868339 CCTCCAGAGACTGCAGGAGAAGG - Intergenic
1157251235 18:46098089-46098111 CCTGCAGAGAGCGCCCGAGCCGG + Intronic
1157894274 18:51449095-51449117 CGTGCAGAGACTCCCCGCGCAGG + Intergenic
1159026239 18:63184318-63184340 CCTGCAGAGAGAGCATGGGCTGG + Intronic
1159119537 18:64152732-64152754 CCTTCTCAGACTGCACATGCAGG + Intergenic
1161124086 19:2546300-2546322 CCTGGAGAGGCTGCAGGTGCAGG - Intronic
1161127185 19:2564721-2564743 CCTCCAGAGACTCCAGGGGCAGG - Intronic
1161326952 19:3668636-3668658 ACTGCAGGGATCGCACGTGCTGG + Intronic
1161621655 19:5300885-5300907 CTTGCAGAGACTAGAGGTGCTGG + Intronic
1163650511 19:18515189-18515211 CCTGCAGAGACTGCCAGCTCGGG + Intronic
1164507997 19:28875127-28875149 CCTACAGAGCCTGCCCCTGCAGG + Intergenic
1165030977 19:32998073-32998095 CCTTCAGAGCCTGGTCGTGCAGG - Intronic
1165491914 19:36128495-36128517 CCTGCAGAAACTGCCCTTACCGG + Intergenic
1166852861 19:45768724-45768746 CCTGCAAAGTCTGCAAGAGCTGG + Exonic
1166898517 19:46040063-46040085 CCAGCAGAGACTGCACATCTGGG + Intronic
1167476023 19:49701382-49701404 CCTGCACAGAGGGCACGGGCTGG - Exonic
1167483796 19:49748373-49748395 CCTGCAGAGACTGCACGTGCTGG + Exonic
1167617198 19:50541858-50541880 CCTGATGAGACTGGACGTCCCGG - Intronic
1168406637 19:56114080-56114102 ACTGCTGCCACTGCACGTGCCGG + Intronic
925082114 2:1078559-1078581 CAGGGAGAGACTGCAGGTGCCGG + Intronic
925113048 2:1352568-1352590 CCTGCAGAGACAGCATTTCCTGG - Intronic
926120595 2:10239412-10239434 CCTCCAGAGGCTGGCCGTGCTGG + Intergenic
926177339 2:10606335-10606357 CCTGCACAGACTGGGCGTGGTGG + Intronic
927842818 2:26456210-26456232 ACTGCAGAGAATGGACGGGCGGG + Intronic
928885492 2:36143609-36143631 TCTTCAGAGACTGGAGGTGCTGG + Intergenic
930035764 2:47084129-47084151 CCTGCAGAGACTTCCCCTGGAGG - Intronic
930721212 2:54640016-54640038 CATGCAGAGACTATACATGCTGG - Intronic
937065069 2:119011600-119011622 CCTGCAGCGACCCCGCGTGCCGG - Intergenic
937092866 2:119218114-119218136 CCTGCATGGACTGCCCCTGCTGG + Intergenic
940805297 2:158180529-158180551 CAGGCAGAGACAGCAAGTGCAGG + Intronic
940844383 2:158623961-158623983 CCTGCAGTTACAGCAGGTGCTGG - Intronic
943132454 2:183871026-183871048 TCAGCAGACACTGTACGTGCTGG + Intergenic
947099728 2:226607133-226607155 TCTGCAGAGACAGCAAGTCCTGG + Intergenic
947238907 2:227973104-227973126 CATGCAGGGACAGAACGTGCTGG + Intergenic
1175636166 20:60586333-60586355 CCTCTAGAGACTGCAAATGCTGG - Intergenic
1175695860 20:61102168-61102190 CCTGCAGAGACCCCAAGTGAGGG + Intergenic
1176795883 21:13371160-13371182 CCTCCAGAGACTGCAGGAGAAGG + Intergenic
1177061385 21:16378552-16378574 CCCTGAGAGAGTGCACGTGCTGG + Intergenic
1180108600 21:45637034-45637056 CCGGCACAGACTGCGGGTGCAGG - Intergenic
1181861077 22:25818677-25818699 GCTGCAGAGACTTCCCCTGCAGG - Intronic
1184347625 22:43923488-43923510 CCAGCAGACACTGCATGTCCTGG - Intergenic
1184730601 22:46369106-46369128 CCCGCAGAGACTGGACGTCGGGG + Intronic
1185011873 22:48319080-48319102 CCTGCACAGACTGTTCCTGCAGG + Intergenic
1185182743 22:49372611-49372633 ACGGCAGAGACTGCAGCTGCGGG - Intergenic
950128807 3:10527830-10527852 TCTGCAGTGACTGTAGGTGCTGG - Intronic
951247982 3:20363407-20363429 CCTGCAGAAAGGGCAAGTGCTGG + Intergenic
952952186 3:38533844-38533866 CCTGCAGTGACTGCTGATGCTGG + Intronic
956492744 3:69791231-69791253 CCCTCAGGGACTGCAAGTGCTGG - Intronic
959159201 3:102703546-102703568 CCTGCAGAGACTGCCCTAGCAGG - Intergenic
959259208 3:104053221-104053243 CCTGCAGCCACTGAACCTGCAGG - Intergenic
960517607 3:118619284-118619306 CCTGCAGCAACTGCATGTGAAGG + Intergenic
968566031 4:1313381-1313403 GCTGCACGGACTGCAGGTGCAGG + Intronic
972348216 4:38211535-38211557 CCTGATGAGACTGCACGAGTGGG + Intergenic
972794037 4:42398540-42398562 CCCGCAGAGACCGCAAGTGGCGG - Intronic
974280829 4:59790489-59790511 ACCGCAGAAACTGCACGTCCAGG + Intergenic
975376961 4:73657438-73657460 CCTGCAGAGAATGATCGTGACGG + Intergenic
975437053 4:74365248-74365270 GCTGCGGAGAGTGCACGGGCAGG - Exonic
985018014 4:185657555-185657577 CATCCAGAGACTGCGCATGCTGG + Exonic
985538357 5:476626-476648 GCTCCAGAGACTGCATGTCCAGG + Exonic
986172989 5:5328672-5328694 CCTCCAGGGACATCACGTGCTGG + Intergenic
996796749 5:127355950-127355972 CCTGCAAAGACTGCAATTTCAGG - Intronic
997644712 5:135473984-135474006 CCTGGAGAGTCTGCACCTGCAGG + Intergenic
998187021 5:139988059-139988081 CCTGCAGAGGCTGGGCGTGGTGG - Intronic
1003607752 6:7580111-7580133 CCTCCAGGGACTGCTTGTGCCGG - Exonic
1011495884 6:87936315-87936337 ACTGCAGTGACTGCACGAGCAGG + Intergenic
1011930277 6:92701935-92701957 TCTGCAGAGCCTGCAGGGGCTGG - Intergenic
1013207355 6:107957506-107957528 CAAGAAGAGACTGAACGTGCGGG - Intronic
1013599355 6:111690081-111690103 CCTTCAGAGATTGCACAAGCAGG - Intronic
1014140636 6:117938485-117938507 CCTGCAGAGAATGCATGAGGAGG - Intronic
1018039452 6:159909155-159909177 CCTCCAGACACTGCACGTCCTGG + Exonic
1020271674 7:6600298-6600320 CCTGCAGAGCCTGCGCCAGCCGG - Exonic
1022524690 7:31029381-31029403 CCTCCAGAGCCTGCAAGTCCTGG - Intergenic
1028511933 7:91634792-91634814 CCTGCAGGGAAAGCACATGCTGG + Intergenic
1029366575 7:100120197-100120219 TCTGCAGAGGCTGCAGGAGCCGG + Intronic
1029414708 7:100435708-100435730 CCTGGTGAGCCTGCAGGTGCCGG - Exonic
1034587091 7:152103383-152103405 CCAGCTGTGACTGCACGTGTAGG - Intronic
1034745007 7:153516481-153516503 CCAGCAGCGACTGCACCTTCTGG + Intergenic
1034845441 7:154440257-154440279 ACTGCAGAGACTGCAGGCGTGGG - Intronic
1034858641 7:154577367-154577389 CCAGGAGAGACTGCTGGTGCAGG + Intronic
1036178476 8:6562685-6562707 GGTGCAGAGGCTGCAAGTGCTGG - Exonic
1036682634 8:10886577-10886599 CCTGCAGAGATTGGTGGTGCAGG + Intergenic
1036827146 8:11986387-11986409 GGTGCAGAAACTGCAAGTGCAGG + Intergenic
1038857463 8:31349063-31349085 CCTGCAGAGATTGCAGAGGCAGG + Intergenic
1039903817 8:41771896-41771918 CCTGCAGGGATTTCACGAGCTGG + Intronic
1040443815 8:47473046-47473068 CCTGGAGAGAGTGCAGGGGCTGG - Intronic
1041425076 8:57711684-57711706 CTTGCAGAGATTGCATGTGGCGG - Intergenic
1042903073 8:73747110-73747132 CCCGCAGAGCCTGCAGCTGCTGG - Intronic
1044060687 8:87631461-87631483 CATGAAGAGACTGCATTTGCTGG - Intergenic
1044510648 8:93074411-93074433 CCTCCAGACACTGAACCTGCTGG + Intergenic
1047403490 8:124565661-124565683 CCTGCAGACACTGGACTTTCTGG + Exonic
1049671587 8:143872476-143872498 CCTGCACAGCCTGCTCGTCCAGG + Exonic
1049688938 8:143950346-143950368 CCTGCACAGCCTGCACGTGGGGG + Exonic
1049802522 8:144524704-144524726 CCTGCAGACACTGTTCCTGCAGG - Exonic
1049832492 8:144710937-144710959 CCTGCAGAGCCTGGCCTTGCAGG + Intergenic
1052037817 9:23703128-23703150 ACTGCTGATACTGCAGGTGCGGG + Intronic
1052080124 9:24194661-24194683 GCTTCAGACACTGCACTTGCAGG - Intergenic
1057208539 9:93187091-93187113 CCTGCAGAGGCAGCACCTGAGGG - Intronic
1058102362 9:100931585-100931607 TCTCCAGAGTCTGCACCTGCTGG + Intergenic
1060204274 9:121673444-121673466 CCTGCTGAGAATGCATGTTCTGG - Intronic
1061163499 9:128909579-128909601 CCTGGAGAGACTGCATGGCCAGG + Intronic
1061204221 9:129153660-129153682 GCTGCAAAGACTGCAGGTGAAGG + Intergenic
1061478552 9:130884991-130885013 CCTGCAGAGGCTGCTGGTGGGGG - Exonic
1062310264 9:135931626-135931648 CCTGGAGAAGCTGCATGTGCAGG + Intergenic
1062480460 9:136748512-136748534 CCTGGAGGGACTGCACATCCTGG - Exonic
1198266650 X:135015797-135015819 CCTGATGAGACTGCCTGTGCTGG + Intergenic
1200061548 X:153486052-153486074 CCTCAAGGGACTGCAGGTGCTGG + Exonic