ID: 1167487750

View in Genome Browser
Species Human (GRCh38)
Location 19:49773060-49773082
Sequence GAGGATCTGAAGGGCACAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 242}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167487750 Original CRISPR GAGGATCTGAAGGGCACAGT GGG Intronic
900310603 1:2031567-2031589 AAGAATCTGAAGGGAGCAGTTGG + Intergenic
900408020 1:2500907-2500929 GGGGATAGGAGGGGCACAGTGGG - Intronic
900552897 1:3265396-3265418 GATGATGTGAAGGGCCTAGTAGG + Intronic
900706844 1:4086263-4086285 GAGGCTCTGAAGAGGAAAGTGGG + Intergenic
902748408 1:18489019-18489041 GAGGATCCGAGGGGCACCCTAGG - Intergenic
902865208 1:19273493-19273515 GGGCACCTGAAGGGCACAGGTGG + Intergenic
904496354 1:30888972-30888994 GAGGCTCTGTGGGACACAGTGGG + Intronic
905938094 1:41840711-41840733 CAGGATCTGATGGGCTCCGTGGG - Intronic
906310993 1:44754381-44754403 GAGGGGCTGCAGGGCACAATTGG + Intronic
908116688 1:60947818-60947840 GAGGATCAGAAGAGCAATGTTGG - Intronic
912506056 1:110157129-110157151 GAGGTGCTGAAGGGCACACCAGG - Intronic
914248371 1:145902106-145902128 GAGGGTCTGCTGGGCTCAGTTGG + Intronic
915395903 1:155583860-155583882 GAAGATCTGGGGAGCACAGTGGG + Intergenic
915411509 1:155704471-155704493 GAAGATCTGGGGAGCACAGTGGG + Intronic
917795128 1:178527858-178527880 GGGAATGTGAAGGGCACATTTGG - Intronic
918108879 1:181438289-181438311 GAGGAACTGAAGGCTAGAGTGGG + Intronic
919186822 1:194161728-194161750 CAAGATCTGAAGGACACAGCTGG + Intergenic
919550105 1:198975189-198975211 GAGGCCCTGAAGGGGACAGGAGG + Intergenic
920678177 1:208052933-208052955 GAGCATAAGAAGGGCACAGCAGG + Intronic
921330493 1:214030823-214030845 GAGTATCTGCAGGACACAGAAGG + Intronic
921607489 1:217172958-217172980 GAGGATCAGAAGGGAAGAATGGG - Intergenic
922410849 1:225373666-225373688 GAGGATCTGACGGCTAAAGTCGG + Intronic
922697083 1:227736005-227736027 GAGGACCTGGAGGGGACAGTGGG + Intronic
1064661332 10:17610974-17610996 GAGGACCTGAAGTGTAGAGTGGG - Intronic
1067494639 10:46750841-46750863 GGGGAACTGAAGGACACAATGGG - Intergenic
1067600017 10:47589557-47589579 GGGGAGCTGAAGGACACAATGGG + Intergenic
1068244183 10:54342618-54342640 TAGGATCTGGAGGAGACAGTGGG - Intronic
1070708582 10:78659908-78659930 GAGAAACTGAAGGCCAGAGTAGG + Intergenic
1070835312 10:79444195-79444217 GAGGAAGTGAAGGCCACAGATGG + Intronic
1070865736 10:79707138-79707160 GAGGAGCTGCAGGGCCCAGCAGG + Intronic
1070879528 10:79845269-79845291 GAGGAGCTGCAGGGCCCAGCAGG + Intronic
1071651559 10:87397438-87397460 GGGGAGCTGAAGGACACAATGGG + Intergenic
1072032980 10:91539099-91539121 GAGGGTCTGCAGGGCACACCTGG - Intergenic
1072453465 10:95557580-95557602 GTGGATCTAAAGGCCTCAGTTGG + Intronic
1072574831 10:96690032-96690054 GATGCTCTGAAGGGCAGATTAGG - Intronic
1073140589 10:101244772-101244794 TAGGATTTGAGGGGCAGAGTTGG + Intergenic
1073767679 10:106701080-106701102 GATGATCTGAAGTGTACAGGAGG - Intronic
1075495807 10:122917544-122917566 GAGGATCAGTAGGGCAAGGTGGG - Intergenic
1077318728 11:1930718-1930740 GAACATCTGAAGGGTACAGCCGG + Intronic
1077561202 11:3262693-3262715 GAGAGGCTGCAGGGCACAGTGGG - Intergenic
1077913465 11:6594679-6594701 GAAGAGCTGAAGGGCAGTGTGGG + Intergenic
1078098400 11:8314131-8314153 GGGTCTCTGGAGGGCACAGTGGG - Intergenic
1078633393 11:13027218-13027240 GAGCACCTGAAGGGCATAGAGGG + Intergenic
1079441192 11:20516354-20516376 GAGGATGTGTTGAGCACAGTAGG + Intergenic
1081398146 11:42611554-42611576 GAGGAGCTGTGGGGCAAAGTGGG + Intergenic
1081683276 11:45023685-45023707 GAGGGTCTGAAGTGGACACTGGG - Intergenic
1082587945 11:54966342-54966364 TAGAATCTGAAGGGGACATTTGG + Intergenic
1082674697 11:56082758-56082780 GGGGATCTGCAGGGAACAATAGG - Intergenic
1083436927 11:62649090-62649112 GGGGATCTGGAGGCCGCAGTGGG - Exonic
1084581290 11:70025009-70025031 GAGCATCTGAGGGTCTCAGTTGG + Intergenic
1087312773 11:96568980-96569002 TAGGTTCTGAAAGGAACAGTAGG + Intergenic
1088543068 11:110933612-110933634 AAGGATTTGAAGGGCACAAGGGG - Intergenic
1089001708 11:115057556-115057578 GACTCACTGAAGGGCACAGTTGG + Intergenic
1091232899 11:133999936-133999958 GAGGAACAGAAGTGCACAGGTGG - Intergenic
1091283006 11:134392593-134392615 GAGGATCTGTTGAGCCCAGTAGG - Intronic
1096534372 12:52261737-52261759 GAGGATGTGAAGGGAATAGTGGG + Intronic
1096564944 12:52470605-52470627 GAGGAGCTGCAGGTCACAGCAGG - Exonic
1096566956 12:52490043-52490065 GAGGAGCTGCAGGTCACAGCAGG - Exonic
1097227775 12:57488694-57488716 AATTATCTGAAGGTCACAGTGGG - Intronic
1097312388 12:58134267-58134289 GGGGAACTGAAGGGTACCGTAGG - Intergenic
1097691242 12:62736313-62736335 GAAGATCTGAAGGCTGCAGTGGG + Intronic
1100072799 12:90741727-90741749 AATGAGCAGAAGGGCACAGTAGG + Intergenic
1101250763 12:102932251-102932273 AAGTATAAGAAGGGCACAGTGGG - Intronic
1104642148 12:130474389-130474411 GAGGTGCTCAAGGGCACAGAAGG - Intronic
1104814535 12:131638140-131638162 GAGGAGCTGGAGGTCCCAGTGGG + Intergenic
1105211310 13:18258658-18258680 GAGGCTCTGAGGGGCTCAGAGGG + Intergenic
1106006952 13:25779520-25779542 GGGCATCTGAATGGCTCAGTCGG + Intronic
1108000884 13:45904708-45904730 TAGGATCTGAGGCTCACAGTGGG + Intergenic
1108182777 13:47857358-47857380 GAGGATCTGAAGAGTGCTGTAGG - Intergenic
1110458102 13:75712394-75712416 GAGAAAATGAAGGTCACAGTGGG - Intronic
1110720909 13:78760306-78760328 GAGGATCTGTTAAGCACAGTAGG + Intergenic
1111046057 13:82814223-82814245 GCTGTTCTGAAGGGCCCAGTAGG + Intergenic
1112526552 13:100153584-100153606 CAGGATCTGAAGTGGACAGAGGG + Intronic
1113924752 13:113935241-113935263 GAGGAGCTGAAGGGCGCCGGGGG - Intergenic
1114325707 14:21586871-21586893 GAGGATGAGGAGGCCACAGTGGG - Intergenic
1114658285 14:24329203-24329225 GAGGATGAGAAGGGCACTGCAGG - Exonic
1114797732 14:25735622-25735644 GAGAATTTGAAGGGCACACTAGG + Intergenic
1115339134 14:32273280-32273302 GAGGCTCTGAAGAGAACAGCTGG + Intergenic
1121618218 14:95328021-95328043 GAGGAACTGAAAGGAACAGGTGG - Intergenic
1121823643 14:96992496-96992518 GGGGATCAGAAGGGCCCAGGGGG + Intergenic
1121841132 14:97134843-97134865 GAGGACCCTGAGGGCACAGTTGG - Intergenic
1122873289 14:104651127-104651149 CAGCATCTGCCGGGCACAGTGGG + Intergenic
1123018070 14:105384930-105384952 GGGGAGCTGGTGGGCACAGTTGG - Exonic
1123385726 15:19799047-19799069 TAGGATCTGAAGTGTACATTTGG - Intergenic
1123898464 15:24851580-24851602 GAGGCTGTGAAGGGGAGAGTGGG + Intronic
1126069621 15:44854533-44854555 GAGGAGCTGAAGGGGATAGAAGG - Intergenic
1127755392 15:62086899-62086921 TATGATCTGAGGGGCACAGAGGG + Intergenic
1127882804 15:63172996-63173018 GAGGAGCAGGAAGGCACAGTTGG - Intergenic
1128157762 15:65402451-65402473 CAGGATCTGAAGGACGCCGTTGG + Exonic
1128375875 15:67075447-67075469 GAGGACAGGAAGAGCACAGTTGG + Intronic
1128566632 15:68705031-68705053 GAGGAGCTGGAGTTCACAGTGGG - Intronic
1128786641 15:70402450-70402472 GAGGACCTGGAGGGCACTGTGGG + Intergenic
1128980087 15:72179634-72179656 GACGATCTGCAGGTCACAGAGGG - Intronic
1129793779 15:78360848-78360870 GAGGATGTGCAGGGAACAGCCGG + Intergenic
1130562677 15:84970977-84970999 GAGAAGTTCAAGGGCACAGTGGG + Intergenic
1132239852 15:100249289-100249311 AAAGATCTGAAGGGTGCAGTGGG + Intronic
1132252595 15:100345278-100345300 GCAGCTCTTAAGGGCACAGTGGG - Intergenic
1134103547 16:11469702-11469724 GAGTGTCTGAAGGGTACAGGTGG - Intronic
1134403958 16:13938942-13938964 GAGGATGTGAAGGGAAAAGAGGG - Intronic
1139612344 16:68068069-68068091 GAGGTTCTGAAGGCCACCCTTGG + Intronic
1139655396 16:68384184-68384206 GAGGCCTGGAAGGGCACAGTGGG - Intronic
1141827566 16:86491836-86491858 GAGGTCCTGAAGGACACAATCGG + Intergenic
1141879470 16:86848187-86848209 GAAGATCTGAAGACCACCGTGGG + Intergenic
1144120192 17:12144921-12144943 GAGGTTCTGGGGGCCACAGTGGG + Intergenic
1144723927 17:17491834-17491856 ACAGATCTGAAGAGCACAGTAGG + Exonic
1145007331 17:19345015-19345037 TGGGATCTGCTGGGCACAGTGGG - Intronic
1146311936 17:31776173-31776195 GATGATCAGAAAAGCACAGTGGG + Intergenic
1147239371 17:39080502-39080524 GAGGCTGTGAAAGGCAAAGTGGG + Intronic
1147262232 17:39215220-39215242 GATAATCTGCAGGGGACAGTGGG - Exonic
1147496653 17:40922744-40922766 GAGAATCTGAAGGCTGCAGTAGG + Exonic
1150059402 17:62051721-62051743 GAGGATGTGAAGTGAACATTTGG - Intronic
1151327131 17:73386313-73386335 CGGGAGCTGAAGGGCCCAGTGGG + Intronic
1152336174 17:79701203-79701225 GAGGAGGGGAAGGGCACAGGTGG + Intergenic
1152336263 17:79701429-79701451 GAGGAGGGGAAGGGCACAGGTGG + Intergenic
1152336285 17:79701489-79701511 GAGGAGGGGAAGGGCACAGGTGG + Intergenic
1152336318 17:79701579-79701601 GAGGAGGGGAAGGGCACAGGTGG + Intergenic
1153130535 18:1851176-1851198 GGGGAGGTGAAGGGCACAGCAGG + Intergenic
1156801020 18:41114043-41114065 GACTATCTGAAAGGCACATTTGG + Intergenic
1157416607 18:47508687-47508709 GAGGAAGTGAAGCCCACAGTGGG - Intergenic
1157548317 18:48563406-48563428 GAGGAGCTGCAGGCCAGAGTGGG - Intronic
1159493592 18:69170963-69170985 GAGGATCTCTTGGGCACAGGAGG - Intergenic
1160225179 18:77006534-77006556 GAGGAACTGCAGAGAACAGTGGG + Intronic
1161092402 19:2368344-2368366 GAGAATGTGAAGGGCACATTAGG + Intergenic
1161135269 19:2615936-2615958 AAGGATTTGAAGGGGACAGGAGG - Intronic
1161299632 19:3536572-3536594 GAGCCTCTGAAGGCCACTGTGGG - Intronic
1162374166 19:10295329-10295351 GCCGGTCTGAAGGGCACAGAAGG - Exonic
1163014292 19:14444445-14444467 GAGGCTCTGCAGGGGACTGTGGG - Intronic
1163235043 19:16025064-16025086 GAGGACCTAATGGGCTCAGTTGG + Intergenic
1163314276 19:16531715-16531737 GAGGAGCAGAAGGGCAGAGCTGG + Intronic
1163580732 19:18137204-18137226 GAGGACCTGCAGGGCTCAGCGGG + Intronic
1164234171 19:23317637-23317659 GAGGTTCTGAACGTCACATTTGG + Intronic
1164248959 19:23460152-23460174 GAGGTTCTGAATGTCACATTTGG + Intergenic
1164325376 19:24186784-24186806 GAGGTTCTGAATGTCACATTTGG - Intergenic
1165245191 19:34494606-34494628 GAGGATAGGACGGGCACAGGAGG - Exonic
1165458052 19:35926295-35926317 GAGGAGCTGAGGGGCCCAGTGGG - Intergenic
1167487750 19:49773060-49773082 GAGGATCTGAAGGGCACAGTGGG + Intronic
926978089 2:18534934-18534956 TAGCATATGAATGGCACAGTTGG - Intergenic
927908723 2:26881193-26881215 GAGGATGAGACGGGCACAGAGGG - Intronic
929300675 2:40300569-40300591 TGGGGTCAGAAGGGCACAGTGGG - Intronic
929443939 2:41988396-41988418 CAGGATCTGAGGCACACAGTGGG - Intergenic
930713862 2:54574397-54574419 CAGGATCTGGAGGGAGCAGTTGG + Intronic
934937197 2:98473969-98473991 GAGGAACTGGAAGGCAAAGTGGG - Intronic
937216314 2:120315789-120315811 GAGAAGCAGAAGGGCACAGTTGG - Intergenic
938758681 2:134403816-134403838 GAGGGTCTGATTGGCACAGATGG + Intronic
941826378 2:169902188-169902210 GAAGATTTGAAGGACAGAGTTGG - Intronic
942117210 2:172739720-172739742 GTGGATCTGAAGTTCACAGTTGG - Intronic
946118291 2:217483558-217483580 GAGAATATGAAGGGCACAGGGGG + Intronic
946605823 2:221402981-221403003 GAGTGTCTGAAGGGCACAGAGGG - Intergenic
947562194 2:231165525-231165547 TAGGTTTTGAAGGGCAAAGTAGG + Intronic
948302297 2:236916473-236916495 GTGTTTCTGAAGGGCACCGTGGG + Intergenic
948496518 2:238353415-238353437 GAGGAGGGGGAGGGCACAGTTGG + Intronic
1169143986 20:3240640-3240662 GAAGAGCTGAAGGACACAGGCGG + Intergenic
1172962425 20:38807893-38807915 GATGATCTGGAGAGCACAGATGG - Intronic
1173065956 20:39711758-39711780 GAGGCTGGGAAGGGCACAGGGGG - Intergenic
1173396453 20:42684648-42684670 CAGACTCTGAAGAGCACAGTGGG + Intronic
1175284776 20:57830730-57830752 GAGGGTCTGAATGGAACAGAAGG - Intergenic
1176105351 20:63383298-63383320 GTGGATCTGAAGGGGCCACTTGG - Intergenic
1178489054 21:33036375-33036397 GGGCATCTGAGGGGCACAGATGG - Intergenic
1179580996 21:42343873-42343895 AAGGATCCGAAGGGCAATGTAGG + Intergenic
1180023265 21:45142795-45142817 GGGGATCTGAGGGGCCCAGAAGG + Intronic
1180764925 22:18340779-18340801 GAGGCTCTGAGGGGCTCAGAGGG - Intergenic
1180814106 22:18778905-18778927 GAGGCTCTGAGGGGCTCAGAGGG + Intergenic
1180877947 22:19183805-19183827 GAGGCTCTGGAGGGGACAGGTGG + Intronic
1181200289 22:21213240-21213262 GAGGCTCTGAGGGGCTCAGAGGG + Intronic
1181367735 22:22391645-22391667 GAGAAACTGAAGGACTCAGTAGG + Intergenic
1181373808 22:22440344-22440366 GAGAAACTGAAGGGCTCAATAGG + Intergenic
1181628254 22:24135746-24135768 GAGAAACTGAAGGGCAGAGGTGG + Intronic
1181695435 22:24590631-24590653 GAGGATCTGAAGGGAACACTGGG - Intronic
1181701449 22:24623719-24623741 GAGGCTCTGAGGGGCTCAGAGGG - Intronic
1182125315 22:27811576-27811598 GAAGGTGAGAAGGGCACAGTAGG - Intergenic
1182550232 22:31096955-31096977 AAGGATGTGAAAGGCACAGGGGG - Intronic
1183722676 22:39571610-39571632 GAGGCTCAGAAGAGCACAGGGGG - Intronic
1184305923 22:43601876-43601898 GGGGACCTGCAGGGCACAGAAGG - Intronic
1184415237 22:44348328-44348350 GAGCTTCTGAAGCACACAGTAGG + Intergenic
1184479141 22:44736987-44737009 GAGGACCTGAAGGTCCCGGTGGG - Exonic
1184761802 22:46549132-46549154 GAGGATTTGGGGGTCACAGTGGG - Intergenic
1184940669 22:47762344-47762366 GAGGACCTGAGGGGCACTGCGGG - Intergenic
1185233011 22:49694087-49694109 GAGGATCTGGGGGGCCCAGGTGG + Intergenic
1203226547 22_KI270731v1_random:81684-81706 GAGGCTCTGAGGGGCTCAGAGGG - Intergenic
1203264203 22_KI270734v1_random:4592-4614 GAGGCTCTGAGGGGCTCAGAGGG + Intergenic
953931618 3:47008635-47008657 GAGGATGTGCAGGGCGCACTGGG - Exonic
954712898 3:52513766-52513788 GAGGATGTGTAGGACACCGTTGG - Exonic
955218485 3:57004428-57004450 GAGGAACTGAAGAGAACAGAAGG - Intronic
961165380 3:124759986-124760008 GAGGGTCTGAAGGCCTGAGTAGG + Intergenic
961972085 3:130979005-130979027 AAAGAACTGAAGGGCAGAGTAGG - Intronic
965940825 3:174179368-174179390 GAGAAAGTGAAGGGCACAATAGG + Intronic
966169160 3:177058282-177058304 CTGGATCTGTAGGGCAGAGTTGG - Intronic
966859152 3:184219094-184219116 GAGGATCTGATGAGAACAGAAGG - Intronic
967111395 3:186297275-186297297 GAGGTTCTGAAGGCCACAGGAGG + Intronic
968946570 4:3667687-3667709 GAGGAGCTGAAGGTGACAGGAGG + Intergenic
972328639 4:38042646-38042668 GAGGACCTGAAAGGGACAGGAGG + Intronic
972923679 4:43975899-43975921 GAGGTTCTGAAGGATACATTTGG - Intergenic
974764300 4:66322309-66322331 GAGGCTCCTAAGGGCAAAGTTGG - Intergenic
983977815 4:173956744-173956766 AAGGCTCTGAAGGGGACGGTAGG - Intergenic
984462484 4:180055952-180055974 AAGGTTCTGAAGGGGACAGAGGG - Intergenic
986501013 5:8400153-8400175 GAGGCTCTGAGGGACACAGCAGG - Intergenic
986818794 5:11442707-11442729 CATGATCTTGAGGGCACAGTGGG + Intronic
988599032 5:32622431-32622453 TGGGAGCAGAAGGGCACAGTAGG + Intergenic
990983267 5:61620132-61620154 TAGGAGCTGGGGGGCACAGTGGG + Intergenic
992349003 5:75910352-75910374 GAGGAGCTGAAGGCCATCGTAGG - Intergenic
998325933 5:141279915-141279937 AAGGATCTGAACAGCACAGAGGG + Intergenic
1001108121 5:168872990-168873012 CAGGCTGTGAAGGTCACAGTTGG - Intronic
1003137496 6:3444893-3444915 GAGGAGCTGAAGGCCACACCTGG - Intronic
1003805246 6:9720925-9720947 GCGGATCTGAGTGGCACAATGGG - Intronic
1006040232 6:31246452-31246474 GAGGAGCTGAAGGGCCCGGGTGG + Intergenic
1006048643 6:31321866-31321888 GAGGAGCTGAAGGGCCCAGGTGG + Intronic
1008705751 6:54157123-54157145 GAGCATATGAAAGGCACTGTTGG + Intronic
1008980886 6:57482719-57482741 GAAGATGTGAGGGGCACATTAGG + Intronic
1011023111 6:82836313-82836335 GAGGAGCTGAAGGGTGCAGGGGG - Intergenic
1014082341 6:117302396-117302418 AAAGATATGGAGGGCACAGTGGG - Intronic
1014780703 6:125561412-125561434 TAGTATTTGAATGGCACAGTAGG - Intergenic
1015302673 6:131671632-131671654 GAGGGTCTGCTGGGAACAGTAGG + Intronic
1019401940 7:859875-859897 TAGGAGCTGAAGGACATAGTGGG - Intronic
1019881409 7:3864661-3864683 GGGGATGTGAGGGGCAGAGTTGG + Intronic
1020799316 7:12714497-12714519 AATGTTCTGAAGGGCACAATTGG - Intergenic
1022392681 7:29957383-29957405 GTGGATCAGAAGGGCAAAGCAGG - Intronic
1022892245 7:34713588-34713610 GAAGCTCTGCAGAGCACAGTGGG + Intronic
1023665426 7:42518109-42518131 GAGGCTGTCCAGGGCACAGTGGG + Intergenic
1023739721 7:43268543-43268565 GAGGCTGTCCAGGGCACAGTGGG - Intronic
1023841586 7:44101397-44101419 GGGGATCTGCAGGGCACAGAAGG - Intergenic
1025025689 7:55514560-55514582 CAGGCCCTGAAGGGCACAGAAGG + Intronic
1025734274 7:64133164-64133186 CTGGCACTGAAGGGCACAGTTGG + Intronic
1027599407 7:80220871-80220893 GAGGAACTCAAGGGCAGAGTGGG - Intergenic
1032011229 7:128349438-128349460 CAGGAGCTGATGGGCAAAGTTGG + Intergenic
1032467985 7:132158764-132158786 CAGGATCTGAAGAGGCCAGTGGG - Intronic
1035288764 7:157823876-157823898 GGGAATCTGGAGGGCAAAGTGGG + Intronic
1036826496 8:11980341-11980363 GTGGTTCTGGACGGCACAGTGGG + Intergenic
1037833158 8:22200995-22201017 GTGGATCTGAGGGGCAGGGTGGG - Intronic
1037992502 8:23330897-23330919 GAGCCTCTGAAGAGCACAGAGGG - Intronic
1038805146 8:30783558-30783580 GAGGATAGGCTGGGCACAGTGGG - Intronic
1039214467 8:35253973-35253995 GAGTACGTGAAGGGAACAGTAGG - Intronic
1041661924 8:60409274-60409296 GAGGAAATGAAGGGCACTGGAGG - Intergenic
1041755898 8:61313032-61313054 GAGGAGCAGAAGGGGAGAGTGGG - Intronic
1045395531 8:101757151-101757173 CAGGATCTGAAGGCCATGGTGGG - Intronic
1046356747 8:113096158-113096180 GAAGATTTCAAGGGGACAGTTGG - Intronic
1046666775 8:117012541-117012563 GATGATTTAAAGAGCACAGTAGG + Intronic
1048132867 8:131717030-131717052 GTTGATGGGAAGGGCACAGTGGG - Intergenic
1049341804 8:142117042-142117064 GAGGAGCTGGGGGGGACAGTTGG - Intergenic
1049396607 8:142403770-142403792 GAGGAGCTGAAGTGCAGAGTAGG + Intergenic
1049409814 8:142467536-142467558 GAAGATCTGGAGGTCAGAGTGGG + Intronic
1051813470 9:21076796-21076818 GAGAATCTGGAGCACACAGTAGG + Intergenic
1052938702 9:34114875-34114897 GAGGATCTCATGGGCCCAGGAGG + Intronic
1053712536 9:40834108-40834130 GAGGATCTGAAGTGAACTTTTGG + Intergenic
1053712774 9:40838534-40838556 TAGAATCTGAAGTGCACATTTGG + Intergenic
1054423071 9:64967354-64967376 GAGGATCTGAAGTGAACTTTTGG + Intergenic
1054423303 9:64971782-64971804 TAGAATCTGAAGTGCACATTTGG + Intergenic
1056827065 9:89883782-89883804 GTGGATCAGAAAGGCACAGTGGG + Intergenic
1057354743 9:94323879-94323901 GAGGAGCTGCAGGGCCCAGCAGG - Intronic
1059701286 9:116777391-116777413 AAGGAACTGAAGGTCAGAGTGGG + Intronic
1061134557 9:128725880-128725902 CAGGATCTGATGTGCTCAGTGGG + Intergenic
1061261078 9:129481518-129481540 GGGGATGTGAAGGGCAGAGTCGG + Intergenic
1062520310 9:136954861-136954883 GGGAATCAGAAGGGCACGGTGGG - Intronic
1185708955 X:2287146-2287168 AAGTATGTGAAGGGCAGAGTAGG + Intronic
1185814250 X:3139649-3139671 GAAGCTCTGAGGGGCTCAGTGGG + Intergenic
1189804564 X:44722391-44722413 GAAGATATGAAGGGAACAGCAGG - Intergenic
1191883660 X:65866821-65866843 GAGAATATGAAGGCCAGAGTGGG - Intergenic
1192026915 X:67463050-67463072 GAGAATTTGAAGGGAACTGTTGG + Intergenic
1195966859 X:110436829-110436851 GAGGAGCTGAGAGTCACAGTGGG + Intronic
1200064816 X:153499307-153499329 GAGGACCAGGAGCGCACAGTGGG + Intronic
1201979435 Y:19891361-19891383 GAGTTTCTGGAGGGCAGAGTTGG - Intergenic
1202603593 Y:26619310-26619332 GAGGATCTGTAGCGCCCAGGAGG + Intergenic