ID: 1167492535

View in Genome Browser
Species Human (GRCh38)
Location 19:49800902-49800924
Sequence ATGAGCGCCCTCTCCGGGAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 46}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167492535_1167492546 23 Left 1167492535 19:49800902-49800924 CCGATCCCGGAGAGGGCGCTCAT 0: 1
1: 0
2: 1
3: 4
4: 46
Right 1167492546 19:49800948-49800970 CCACCCCACTCAGGCGCTCCAGG 0: 1
1: 1
2: 2
3: 22
4: 198
1167492535_1167492540 14 Left 1167492535 19:49800902-49800924 CCGATCCCGGAGAGGGCGCTCAT 0: 1
1: 0
2: 1
3: 4
4: 46
Right 1167492540 19:49800939-49800961 CGCCCTTCCCCACCCCACTCAGG 0: 1
1: 0
2: 5
3: 51
4: 442

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167492535 Original CRISPR ATGAGCGCCCTCTCCGGGAT CGG (reversed) Intronic
901940011 1:12654840-12654862 AAGACGGCCCTCTCCGGGGTAGG + Intronic
904530657 1:31166671-31166693 AGGAGCGACCTCTCCTGGGTGGG - Intergenic
915303241 1:154963237-154963259 CTGAGCACCCTCTCCGGTTTGGG - Exonic
915361385 1:155288184-155288206 GGGAGCGCCCTGCCCGGGATAGG - Exonic
1065101953 10:22340542-22340564 AAGAGCGCCCTGGCCGGGAAAGG - Intergenic
1083399036 11:62411365-62411387 ATGAGCTCCCTCTGAGGGGTGGG - Intronic
1089687936 11:120168889-120168911 CTAAGCGCCCTCTCCGCGCTGGG - Intronic
1092810541 12:12267490-12267512 ATGAGCTCCGTCTTCGGGGTTGG + Intergenic
1093481004 12:19603882-19603904 ATGGGCGCCCTCTCCAGTTTCGG + Intronic
1095154047 12:38831243-38831265 ATGAGGGCCCTCTCTGGGCTTGG - Intronic
1103333961 12:120175155-120175177 ATGAGCGTCCTCTCAGGTATAGG - Exonic
1103520987 12:121537078-121537100 AGGAGGGGCCTCTCCGGGAGAGG - Intronic
1112377824 13:98860404-98860426 CTGGGCGCCATCTCCGGCATTGG - Exonic
1116563379 14:46413075-46413097 ATGATGGCTCTCTCCGGGATGGG + Intergenic
1119524024 14:75307968-75307990 AAGAGCGCCCTCTTCTGGCTCGG - Intergenic
1119668510 14:76501018-76501040 ATGAGGACCCTCTCCGGGGAAGG + Exonic
1123427152 15:20182054-20182076 ATGAACGCCTCCTCGGGGATGGG - Intergenic
1123536381 15:21188563-21188585 ATGAACGCCTCCTCGGGGATGGG - Intergenic
1133922293 16:10164124-10164146 ATGATGGCTCTCTCCGGGGTAGG + Intronic
1136857146 16:33667782-33667804 ATGAACGCCTCCTCGGGGATGGG + Intergenic
1203118719 16_KI270728v1_random:1516273-1516295 ATGAACGCCTCCTCGGGGATGGG + Intergenic
1146226202 17:31068518-31068540 AGGGGCGCCCTCTACAGGATGGG + Intergenic
1148512224 17:48181032-48181054 CTGAGGGCCCTCTGCAGGATGGG + Intronic
1148754317 17:49964675-49964697 CTGAGCGCTTTCTCAGGGATTGG - Intergenic
1149775466 17:59353554-59353576 CTAAGCGCCCTCCCCGGGGTAGG - Intronic
1165421167 19:35722677-35722699 GTGCCCTCCCTCTCCGGGATCGG + Exonic
1167492535 19:49800902-49800924 ATGAGCGCCCTCTCCGGGATCGG - Intronic
932493413 2:72135080-72135102 ATGAGCCCCCTCTCTGGGGGTGG - Intronic
942358662 2:175148277-175148299 TTCAGGGCCCTCTCCAGGATTGG - Intronic
946411262 2:219516355-219516377 ACAAGCACCCTCTCCGGGAGAGG + Intronic
1178349281 21:31860728-31860750 ATTAGCGCCCTTTCTGGGCTGGG - Intergenic
1178898939 21:36583736-36583758 ATGAGCTCCCTCCCCTGGATGGG - Intergenic
1178909161 21:36660337-36660359 ATGAGCGCCCTGTTGTGGATTGG - Intergenic
1184100310 22:42338490-42338512 CTGAGCGAGCTCTTCGGGATTGG - Intronic
1184839249 22:47043020-47043042 ATCAGCGCCTGCTCCGGGTTGGG + Intronic
1185226985 22:49658745-49658767 AGGCGTACCCTCTCCGGGATGGG + Intergenic
965521174 3:169669221-169669243 CTGGCCGCCCTCTCCGGGCTCGG + Intergenic
967391056 3:188954789-188954811 AAGAGCGCCCTCTGCTGGAATGG + Intronic
973279167 4:48341527-48341549 ATCTGCGCCGGCTCCGGGATTGG - Exonic
992828046 5:80569352-80569374 AGGTGCGCCTGCTCCGGGATGGG - Intronic
1000078345 5:157817644-157817666 ATGAGCTACCTCTACAGGATGGG + Intronic
1001598071 5:172911036-172911058 CTGGGCGCCCTCTCCTGGACTGG + Intronic
1006072314 6:31506736-31506758 AGGAGGGAACTCTCCGGGATGGG - Intronic
1019143188 6:169961157-169961179 CTGAGCGCCCTCATGGGGATTGG + Intergenic
1021085910 7:16421093-16421115 ATGAGCGGCCTCTCCAGGATGGG + Exonic
1032017119 7:128387405-128387427 ATCAGCGCCCTCACAGGGCTTGG + Intergenic
1032702407 7:134394042-134394064 AAGAGGGGCCTCTCCAGGATTGG + Intergenic
1032702692 7:134396507-134396529 AAGAGGGGCCTCTCCAGGATTGG + Intergenic
1034948999 7:155284507-155284529 ATGAGCCACCTCGCCTGGATGGG + Intergenic
1036568412 8:9958010-9958032 ATGAGCGCCCCCTCATGGAGAGG - Intergenic
1036755085 8:11466440-11466462 ATGAGCGGCCTCTCCCGGGGGGG + Intronic
1043534433 8:81186732-81186754 ATGAACACCCTCTCCTGGAAAGG - Intergenic