ID: 1167492535

View in Genome Browser
Species Human (GRCh38)
Location 19:49800902-49800924
Sequence ATGAGCGCCCTCTCCGGGAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 46}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167492535_1167492546 23 Left 1167492535 19:49800902-49800924 CCGATCCCGGAGAGGGCGCTCAT 0: 1
1: 0
2: 1
3: 4
4: 46
Right 1167492546 19:49800948-49800970 CCACCCCACTCAGGCGCTCCAGG 0: 1
1: 1
2: 2
3: 22
4: 198
1167492535_1167492540 14 Left 1167492535 19:49800902-49800924 CCGATCCCGGAGAGGGCGCTCAT 0: 1
1: 0
2: 1
3: 4
4: 46
Right 1167492540 19:49800939-49800961 CGCCCTTCCCCACCCCACTCAGG 0: 1
1: 0
2: 5
3: 51
4: 442

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167492535 Original CRISPR ATGAGCGCCCTCTCCGGGAT CGG (reversed) Intronic