ID: 1167492540

View in Genome Browser
Species Human (GRCh38)
Location 19:49800939-49800961
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 499
Summary {0: 1, 1: 0, 2: 5, 3: 51, 4: 442}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167492536_1167492540 9 Left 1167492536 19:49800907-49800929 CCCGGAGAGGGCGCTCATTGTTG 0: 1
1: 0
2: 0
3: 9
4: 69
Right 1167492540 19:49800939-49800961 CGCCCTTCCCCACCCCACTCAGG 0: 1
1: 0
2: 5
3: 51
4: 442
1167492534_1167492540 17 Left 1167492534 19:49800899-49800921 CCACCGATCCCGGAGAGGGCGCT 0: 1
1: 0
2: 0
3: 7
4: 59
Right 1167492540 19:49800939-49800961 CGCCCTTCCCCACCCCACTCAGG 0: 1
1: 0
2: 5
3: 51
4: 442
1167492537_1167492540 8 Left 1167492537 19:49800908-49800930 CCGGAGAGGGCGCTCATTGTTGT 0: 1
1: 0
2: 1
3: 1
4: 41
Right 1167492540 19:49800939-49800961 CGCCCTTCCCCACCCCACTCAGG 0: 1
1: 0
2: 5
3: 51
4: 442
1167492533_1167492540 18 Left 1167492533 19:49800898-49800920 CCCACCGATCCCGGAGAGGGCGC 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1167492540 19:49800939-49800961 CGCCCTTCCCCACCCCACTCAGG 0: 1
1: 0
2: 5
3: 51
4: 442
1167492535_1167492540 14 Left 1167492535 19:49800902-49800924 CCGATCCCGGAGAGGGCGCTCAT 0: 1
1: 0
2: 1
3: 4
4: 46
Right 1167492540 19:49800939-49800961 CGCCCTTCCCCACCCCACTCAGG 0: 1
1: 0
2: 5
3: 51
4: 442

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type