ID: 1167492678

View in Genome Browser
Species Human (GRCh38)
Location 19:49801419-49801441
Sequence CACGCTGCACAGATGGAACT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 106}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167492678 Original CRISPR CACGCTGCACAGATGGAACT TGG (reversed) Exonic
901348634 1:8570741-8570763 CAAGCTGCACAGATGGCTCCAGG + Intronic
901415012 1:9110639-9110661 CAGTCTGCACATGTGGAACTAGG - Intronic
912384420 1:109264174-109264196 CACCATGCACAGCTGGCACTGGG + Exonic
917233705 1:172866351-172866373 CACGAAGCCCAGATGGAGCTGGG + Intergenic
917611035 1:176689239-176689261 CAAGCTACACAGATAGAAGTTGG + Intronic
918623059 1:186627104-186627126 CATGCTGCACAGCTGAAAGTGGG - Intergenic
924258372 1:242204651-242204673 CATGCTGCAGTGATGGCACTAGG + Intronic
1062971878 10:1654517-1654539 CACACTGCACAGGTGGAAAGAGG - Intronic
1063367190 10:5498684-5498706 CACCAAGCACACATGGAACTCGG + Exonic
1070674800 10:78405202-78405224 CACATTGCACAGATGAAACTCGG + Intergenic
1072190364 10:93072928-93072950 CACGCAGTACAGATGGAGCCGGG + Intergenic
1077134935 11:993783-993805 GACGCTGCACAGGTGGAACTTGG - Exonic
1081678106 11:44982793-44982815 CATGGTCCACAGATGCAACTGGG - Intergenic
1082105472 11:48216857-48216879 CACTCTGCACAGCTGGATCCTGG - Exonic
1083269623 11:61565236-61565258 CATGCTGAGCAGATGGAAATGGG + Intronic
1085627307 11:78083311-78083333 GTCACTGCACAGATGGAACATGG - Intergenic
1085836192 11:79959316-79959338 CACGCTTCACAGATCGAAAGTGG - Intergenic
1091621627 12:2093474-2093496 TGAGCTGCACAGATGGAAGTGGG + Intronic
1094316967 12:29145765-29145787 CACGCTGCACAGATATTACTAGG - Intergenic
1105688510 13:22811460-22811482 CACGTTGCAAAGATGAAAGTAGG - Intergenic
1106238000 13:27881615-27881637 CAAGCTGTAAAGATGGCACTGGG + Intergenic
1106415720 13:29544148-29544170 CACGCTGTAAAGATCGCACTGGG - Intronic
1111884347 13:94000567-94000589 CAAGTTGGACAGTTGGAACTGGG + Intronic
1112032434 13:95470097-95470119 AACCCTGCAAATATGGAACTAGG + Intronic
1113769009 13:112896851-112896873 CCCGCCTCACAGATGGAACAGGG + Intronic
1117100214 14:52338253-52338275 CAACCTGCACAGATGCAACAAGG + Intergenic
1122888078 14:104719411-104719433 CACGCTGGGCAGCTGGCACTGGG - Exonic
1122937405 14:104966549-104966571 CAACCTGCACAGACAGAACTTGG + Intronic
1123771896 15:23537400-23537422 CACACTGGACAGATGCAACAAGG - Intergenic
1124149161 15:27161382-27161404 CACACTGCCCCCATGGAACTTGG - Intronic
1128135511 15:65260340-65260362 CACACTGCAGAGATGGAACTAGG + Intronic
1128551284 15:68599609-68599631 CACGCTGCCCAGACAGATCTGGG + Intronic
1129945605 15:79536955-79536977 CAGGCTGCTCAGATGGTCCTGGG + Intergenic
1133041749 16:3064719-3064741 CACGCTGCCCACATTGACCTTGG + Intergenic
1138189044 16:54999358-54999380 CACGCTGCACAGATGGAGGCTGG + Intergenic
1140548633 16:75838010-75838032 CACTCAGCACTGATGAAACTTGG - Intergenic
1141829819 16:86503996-86504018 CACTTAGCACAGATGGGACTGGG - Intergenic
1144783952 17:17821684-17821706 CAGGCTGCACAGTTGGTCCTTGG - Intronic
1148264569 17:46215275-46215297 CAGGGTTCACAGAAGGAACTGGG + Intronic
1151237812 17:72734321-72734343 CAGGCTGCAGAGAAGGAACGAGG - Intronic
1165232202 19:34394184-34394206 CAAGGAGCACAGATGGACCTTGG - Intronic
1166803423 19:45471403-45471425 GACGTTCCACACATGGAACTAGG + Intronic
1167188777 19:47967831-47967853 CAAGCAACACAGATGGAAGTAGG - Intergenic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
1167646536 19:50708802-50708824 CACTCAACAAAGATGGAACTAGG + Intronic
927162607 2:20282108-20282130 CCAGCTGCACCGATAGAACTGGG + Intronic
928865732 2:35915761-35915783 CACACTGCAGAGAGGGAATTAGG - Intergenic
936048107 2:109202267-109202289 GACGCTGCCGAGATGGACCTGGG - Intronic
938722823 2:134081432-134081454 CCAGATGCAGAGATGGAACTGGG - Intergenic
941887003 2:170538463-170538485 CACGCTGCGCCGGTGGCACTAGG - Intronic
946215011 2:218177405-218177427 CATCCTGCACAGATGGGACACGG + Intergenic
946770812 2:223086464-223086486 CACTTTGCAGAGATGGAGCTGGG - Intronic
947252370 2:228122208-228122230 GATGCTGCACTGCTGGAACTAGG - Intronic
948947091 2:241226216-241226238 CACCAAGCAGAGATGGAACTGGG + Intergenic
1170817494 20:19727090-19727112 CACTCTGCAGAGATGGAAGCAGG + Intergenic
1173370473 20:42430176-42430198 CACGGTCCACAGATATAACTGGG + Intronic
1179716472 21:43291209-43291231 CTCGCCGTACAGAAGGAACTGGG + Intergenic
1180031507 21:45211805-45211827 CAGCCTGCAAAGAGGGAACTAGG - Intronic
1180160596 21:45997284-45997306 CCCCCTGCACTGATGGGACTGGG + Intronic
1182159170 22:28104627-28104649 AAGGCTGCACAGTTGGACCTTGG - Intronic
1183411130 22:37655553-37655575 AACCCTGCACAGGTGGACCTGGG + Exonic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
950667421 3:14505849-14505871 CACTCAGCACAGCTGGAAATGGG - Intronic
955076695 3:55620656-55620678 ACAGCTGCACAGAGGGAACTGGG + Intronic
956452176 3:69385890-69385912 CACGCTGCGGAGATGGTACACGG - Exonic
957228272 3:77476803-77476825 CACACTGCCCAGATGTCACTCGG + Intronic
967403660 3:189092631-189092653 CACGCTGCTCAGAGTGCACTGGG + Intronic
967525370 3:190486659-190486681 CTAGCAGCACAGATGGCACTGGG + Intergenic
971893980 4:32565693-32565715 CAGTCTGCAAAGATGGCACTAGG - Intergenic
976419968 4:84830698-84830720 CATGCAGCATAGATGGAATTAGG - Intronic
982089426 4:151867558-151867580 AATGTTGCACAGATGGAGCTGGG + Intergenic
984700198 4:182814174-182814196 CTAGCTGCCCAGATGGAAGTAGG + Intergenic
985819878 5:2152436-2152458 CTCACTGCACAGATGGAAGATGG + Intergenic
985819881 5:2152471-2152493 CTCACTGCACAGATGGAAGATGG + Intergenic
985819884 5:2152506-2152528 CTCACTGCACAGATGGAAGATGG + Intergenic
985819887 5:2152541-2152563 CTCACTGCACAGATGGAAGATGG + Intergenic
985819890 5:2152576-2152598 CTCACTGCACAGATGGAAGATGG + Intergenic
986599470 5:9457311-9457333 CACTCTGCACAGGTAGAAATTGG - Intronic
987394007 5:17403897-17403919 CAGACTGCACAGATGGAACATGG + Intergenic
992552670 5:77874118-77874140 CCCACTGCACTGATGGAAATGGG - Intergenic
994324895 5:98436899-98436921 GGTCCTGCACAGATGGAACTTGG - Intergenic
995516601 5:112960433-112960455 GCCCCTGCACAGATGGATCTAGG - Intergenic
996217768 5:120890177-120890199 CAAGCTTCCCAGATTGAACTAGG - Intergenic
999202227 5:149824649-149824671 CAAGCTGGACAGATGGTTCTGGG + Intronic
1000825053 5:166034712-166034734 CACGGTGCCCAGCTGGAACCTGG - Intergenic
1011837345 6:91449942-91449964 TACTTTGCACAGAAGGAACTCGG + Intergenic
1016839941 6:148516179-148516201 CAGGCTTCACAGATGGAAGATGG + Intronic
1018673879 6:166202379-166202401 CACGCCTCACAGCTGGGACTGGG - Intergenic
1018673885 6:166202405-166202427 CACGCCTCACAGCTGGGACTGGG - Intergenic
1019418326 7:937332-937354 CACGCTGCACATCTGGGATTTGG + Intronic
1019418472 7:937764-937786 CACGCTGCACATCTGGGATTTGG + Intronic
1019758683 7:2792417-2792439 CACCCTGCACTGACGGAACAGGG + Intronic
1021773086 7:24024757-24024779 CAGGCTGAACAGATGGAACACGG - Intergenic
1022790584 7:33684933-33684955 CACTCTTCACAGAAGGATCTAGG - Intergenic
1024088851 7:45919607-45919629 CACGTTGGACAGATGTCACTGGG - Intronic
1029156685 7:98522226-98522248 CCAGCTGCACAGAGGGCACTAGG - Intergenic
1032240341 7:130154588-130154610 CAGGCTGCGCAGCTGGCACTTGG - Intergenic
1032800871 7:135316452-135316474 CACGTTGCTCTGCTGGAACTGGG - Intergenic
1033314460 7:140285981-140286003 CACACTGCACACATGGGAATGGG - Intergenic
1035754501 8:2021736-2021758 CCGGCTGCACAGCTGGAGCTGGG - Intergenic
1035754507 8:2021776-2021798 CCGGCTGCACAGCTGGAGCTGGG - Intergenic
1035754513 8:2021816-2021838 CCGGCTGCACAGCTGGAGCTGGG - Intergenic
1037689733 8:21171906-21171928 CCCGCTGCACAGAGGGAGGTGGG - Intergenic
1037959855 8:23088477-23088499 CACGCACCACACATGGAACCAGG + Intronic
1038577742 8:28719488-28719510 CACTTTGCACAGAAGGAAGTAGG - Intronic
1040894913 8:52355842-52355864 CTCCCTGCACAAATGGAACAGGG + Intronic
1043571095 8:81603092-81603114 CAAGCTTCTCAGATGGAGCTGGG - Intergenic
1043593394 8:81855947-81855969 CACTGTGCACAGATGAAACATGG - Intergenic
1050346227 9:4690935-4690957 CACTCTCCACTGATGGAACTTGG - Intronic
1059064554 9:111069336-111069358 CACGCTGGACAGATGCAAAAGGG - Intergenic
1062065209 9:134523077-134523099 CACGCTGCAGAGAGGGAGCCGGG - Intergenic
1192163001 X:68802657-68802679 TAGGCTGCAGATATGGAACTGGG + Intergenic
1194252156 X:91589230-91589252 CACCCTCCAAAGATGGAACCAGG + Intergenic
1198084529 X:133269563-133269585 CATTCTGCACTGATGGGACTTGG - Intergenic
1200571087 Y:4830469-4830491 CACCCTCCAAAGATGGAACCAGG + Intergenic