ID: 1167494166

View in Genome Browser
Species Human (GRCh38)
Location 19:49808369-49808391
Sequence CAGTGTCCCCGCCTGCGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 205}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167494156_1167494166 14 Left 1167494156 19:49808332-49808354 CCCCACCTCCTACTCCCATTTTG 0: 1
1: 0
2: 2
3: 40
4: 438
Right 1167494166 19:49808369-49808391 CAGTGTCCCCGCCTGCGCAGTGG 0: 1
1: 0
2: 2
3: 13
4: 205
1167494164_1167494166 -1 Left 1167494164 19:49808347-49808369 CCATTTTGTGCGACCTGGGACTC 0: 1
1: 0
2: 0
3: 6
4: 64
Right 1167494166 19:49808369-49808391 CAGTGTCCCCGCCTGCGCAGTGG 0: 1
1: 0
2: 2
3: 13
4: 205
1167494152_1167494166 30 Left 1167494152 19:49808316-49808338 CCTCCGGATCCTCCAACCCCACC 0: 1
1: 0
2: 2
3: 23
4: 376
Right 1167494166 19:49808369-49808391 CAGTGTCCCCGCCTGCGCAGTGG 0: 1
1: 0
2: 2
3: 13
4: 205
1167494154_1167494166 21 Left 1167494154 19:49808325-49808347 CCTCCAACCCCACCTCCTACTCC 0: 1
1: 1
2: 13
3: 221
4: 2214
Right 1167494166 19:49808369-49808391 CAGTGTCCCCGCCTGCGCAGTGG 0: 1
1: 0
2: 2
3: 13
4: 205
1167494153_1167494166 27 Left 1167494153 19:49808319-49808341 CCGGATCCTCCAACCCCACCTCC 0: 1
1: 0
2: 7
3: 96
4: 906
Right 1167494166 19:49808369-49808391 CAGTGTCCCCGCCTGCGCAGTGG 0: 1
1: 0
2: 2
3: 13
4: 205
1167494160_1167494166 6 Left 1167494160 19:49808340-49808362 CCTACTCCCATTTTGTGCGACCT 0: 1
1: 0
2: 0
3: 4
4: 89
Right 1167494166 19:49808369-49808391 CAGTGTCCCCGCCTGCGCAGTGG 0: 1
1: 0
2: 2
3: 13
4: 205
1167494155_1167494166 18 Left 1167494155 19:49808328-49808350 CCAACCCCACCTCCTACTCCCAT 0: 1
1: 1
2: 5
3: 109
4: 844
Right 1167494166 19:49808369-49808391 CAGTGTCCCCGCCTGCGCAGTGG 0: 1
1: 0
2: 2
3: 13
4: 205
1167494157_1167494166 13 Left 1167494157 19:49808333-49808355 CCCACCTCCTACTCCCATTTTGT 0: 1
1: 0
2: 0
3: 46
4: 388
Right 1167494166 19:49808369-49808391 CAGTGTCCCCGCCTGCGCAGTGG 0: 1
1: 0
2: 2
3: 13
4: 205
1167494159_1167494166 9 Left 1167494159 19:49808337-49808359 CCTCCTACTCCCATTTTGTGCGA 0: 1
1: 0
2: 0
3: 3
4: 80
Right 1167494166 19:49808369-49808391 CAGTGTCCCCGCCTGCGCAGTGG 0: 1
1: 0
2: 2
3: 13
4: 205
1167494163_1167494166 0 Left 1167494163 19:49808346-49808368 CCCATTTTGTGCGACCTGGGACT 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1167494166 19:49808369-49808391 CAGTGTCCCCGCCTGCGCAGTGG 0: 1
1: 0
2: 2
3: 13
4: 205
1167494158_1167494166 12 Left 1167494158 19:49808334-49808356 CCACCTCCTACTCCCATTTTGTG 0: 1
1: 0
2: 1
3: 28
4: 400
Right 1167494166 19:49808369-49808391 CAGTGTCCCCGCCTGCGCAGTGG 0: 1
1: 0
2: 2
3: 13
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167494166 Original CRISPR CAGTGTCCCCGCCTGCGCAG TGG Intronic
900150337 1:1176078-1176100 CAGTCTCTCCACCTGCACAGCGG - Intronic
900301298 1:1978817-1978839 CTGTGTCCCGGCCTGCTCTGAGG - Intronic
900351839 1:2238666-2238688 CAGTGTCCACAGCTCCGCAGAGG - Intronic
900637923 1:3674904-3674926 AAGAGCCCCCGCCTGGGCAGAGG - Intronic
902337171 1:15760181-15760203 CTGTGGCCCAGGCTGCGCAGTGG - Intronic
903055473 1:20633440-20633462 CAGCGCCTGCGCCTGCGCAGAGG + Exonic
903321408 1:22545540-22545562 CAGTTTCCCCGCCTGTGCAGTGG + Intergenic
903658142 1:24961249-24961271 CAGTGCCACAGCCTGTGCAGGGG - Intronic
906295138 1:44645016-44645038 CAGGCTCCTCGCCTGTGCAGGGG - Exonic
917787098 1:178470548-178470570 CAGTGTCTCCTCATGCTCAGGGG - Intronic
919647919 1:200114563-200114585 CAGTGTCCTCACCTGTCCAGTGG + Intronic
919772545 1:201171660-201171682 CAGTTTTCTCACCTGCGCAGTGG + Intergenic
920191390 1:204196341-204196363 CAGTGTCCACCCCTGGGAAGGGG - Intronic
920316063 1:205076406-205076428 CAGGATCCCCTCCTGCGCAGGGG + Exonic
923183381 1:231545862-231545884 CAATCTCCCCGCCTGTGAAGTGG - Intronic
924527459 1:244864584-244864606 CAGTGCTCCCGTCAGCGCAGGGG - Intergenic
1062963425 10:1590488-1590510 CAGTTCCCCCTCCTGCCCAGAGG + Intronic
1063910598 10:10825738-10825760 CTGTGTCCCCACCTGCCTAGAGG + Intergenic
1065519232 10:26555255-26555277 CAGTGCCCCCCACTGCCCAGGGG + Intronic
1067142351 10:43667992-43668014 GAGGGGCCCCGCTTGCGCAGGGG + Intergenic
1067495572 10:46757372-46757394 CAGTGTCCGCGCCCACACAGGGG - Intergenic
1067599081 10:47583016-47583038 CAGTGTCCGCGCCCACACAGGGG + Intergenic
1067948744 10:50709601-50709623 CAGTGTCCGCGCCCACACAGGGG + Intergenic
1069823837 10:71243306-71243328 CAGTTTCCCCATCTGTGCAGTGG + Intronic
1070646223 10:78204113-78204135 CAGTGTCCTCCTCTGTGCAGTGG + Intergenic
1070805641 10:79269160-79269182 CAGTCTCCCCCGCTGCGGAGTGG + Intronic
1070884064 10:79874598-79874620 CAGTGTCCGCGCCCACACAGGGG + Intergenic
1070947964 10:80408700-80408722 CAGTTTCCCCACCTACGCCGCGG - Intronic
1076768145 10:132648227-132648249 CGGTGTCCCCGCCTGCTGTGAGG - Intronic
1078190670 11:9091047-9091069 CAGTTTCCCCGCCTACGCTGAGG + Intronic
1079454498 11:20624961-20624983 CAGTGTCCACACCTGCAAAGTGG - Intronic
1080687000 11:34524286-34524308 CAGTGTGCCCACCTGCAGAGTGG - Intergenic
1080836439 11:35944617-35944639 CAGTTTCCCCACCTGCACCGCGG + Intronic
1081864473 11:46352121-46352143 CAGTGGCCCCCCCGGGGCAGAGG + Intronic
1083254076 11:61485712-61485734 CAGTGTCCCAGCAGGTGCAGAGG - Intronic
1083408465 11:62474949-62474971 CACTGTCCCTGCCAGTGCAGCGG - Intronic
1083769350 11:64857733-64857755 CCATGTCCCTGCCTGCTCAGAGG - Intronic
1085125873 11:74002064-74002086 CAGTGTCCCCACCTCAGCTGTGG + Intronic
1085395074 11:76203084-76203106 CAGTTTCCCCACTTGCACAGTGG - Intronic
1085475557 11:76786695-76786717 CAGTGACCCCAACTGCCCAGGGG + Intronic
1089359457 11:117876427-117876449 CGCGGTCCCCGCCTGGGCAGCGG - Intronic
1091722243 12:2821677-2821699 CAGTGTCCCTGCCGGGGGAGAGG - Exonic
1092173287 12:6386266-6386288 CAGCCTCCCCGCCTGCCCAGTGG + Intronic
1096771500 12:53938731-53938753 AAGTGTCTCCGCATGCGTAGAGG + Intergenic
1096802147 12:54117701-54117723 CAGTTTCCCCTCCTGCCCAAAGG - Intergenic
1097686357 12:62694591-62694613 CAGTGCCACAGCCTGCACAGCGG + Intronic
1102468121 12:113142466-113142488 CTGTGTCCCCTCCTGGGGAGTGG + Intergenic
1102951650 12:117035395-117035417 CAGTATGCCCTCCTGCTCAGTGG + Intergenic
1104842482 12:131831721-131831743 CAGTCTCCCTGTCTGCGCAATGG + Intronic
1105801000 13:23903420-23903442 CAGTTTCCCCGTCAGTGCAGCGG + Intergenic
1113706242 13:112434566-112434588 CAGGCTCCTCTCCTGCGCAGGGG - Exonic
1113765270 13:112877195-112877217 CTGTCTCCCCTCCTGCACAGAGG - Intronic
1117573086 14:57068837-57068859 CAGTGTCCCGGCTTCCCCAGGGG - Intergenic
1118596471 14:67439168-67439190 CAGTGTCCCCGTCTGTGAAATGG + Intergenic
1120979732 14:90279231-90279253 CAGTGAGCCCACCTGTGCAGAGG + Intronic
1121713361 14:96055369-96055391 CAGTGTCCCCTCTGGGGCAGAGG - Intronic
1121867084 14:97372571-97372593 CAGAGTCCCTGTCTGGGCAGTGG + Intergenic
1122411665 14:101528874-101528896 CAGTCTCCCCATCTGTGCAGTGG - Intergenic
1122692504 14:103537921-103537943 CAGTTTCCCTACCTGTGCAGTGG - Intergenic
1125686389 15:41565975-41565997 CAGGGGCCCCTCCTGCCCAGGGG - Intronic
1127931683 15:63601144-63601166 CATTTTCCCCGTCTGCACAGTGG + Intronic
1128682880 15:69664384-69664406 CAGTGACCCTGCCTGCCCACAGG + Intergenic
1128707823 15:69850576-69850598 CAGTCTCCTCGCCTGCGAAAGGG + Intergenic
1128761120 15:70216616-70216638 CAGTTTCCTCGCCTGTGAAGTGG + Intergenic
1129219185 15:74121579-74121601 CAGTTTCCCCTCCTGTGCTGTGG - Intronic
1132196373 15:99917319-99917341 CAGTTTCCCCGCCTGTGCAGCGG + Intergenic
1132497114 16:269139-269161 CAGTGTCCCCTTGTGCCCAGGGG - Exonic
1132551064 16:553979-554001 CAGGGACCCCGCCTGCCCTGTGG - Exonic
1132622318 16:873646-873668 GAGGGTCCCCGCGAGCGCAGGGG - Intronic
1132978297 16:2721252-2721274 CTGTTTCCCCGCCGGCGCCGGGG + Intergenic
1132997657 16:2831565-2831587 CAGTTTCCCCGTCTGCAAAGTGG - Intronic
1133191097 16:4134141-4134163 CACTGTCCCTGCCTGGGCACTGG - Intergenic
1134131138 16:11651018-11651040 CAGTTTCCCCACCTGGGAAGTGG - Intergenic
1135621503 16:23959867-23959889 CAGTGTCCCCATCTGCAAAGTGG - Intronic
1138495218 16:57404794-57404816 CAGTGTCACCGCCTGCTGATGGG + Exonic
1139418206 16:66831256-66831278 CAGTGTGCTCACCTGTGCAGTGG + Intronic
1139667768 16:68470438-68470460 CAGTTTCCCCACCTGCCAAGTGG - Intergenic
1140724600 16:77800684-77800706 CAGGCTCCCTGCCTGCGCTGTGG + Intronic
1141033411 16:80608740-80608762 CTGTGTCCCGGCCTGTGGAGAGG + Intronic
1141981021 16:87550622-87550644 CAGTTTCCCCGCCTGCAAAAGGG - Intergenic
1142003436 16:87677551-87677573 CAGTTTCCTCACCTGTGCAGGGG - Intronic
1142122015 16:88391158-88391180 CAGTTTCCCCACCTGTTCAGTGG + Intergenic
1142125700 16:88409230-88409252 CAGTTTCCCCACCTGCAAAGAGG + Intergenic
1148798877 17:50210792-50210814 CAGTGTCCCCACCTGGGAAATGG - Intergenic
1151821179 17:76497725-76497747 CAGTTTCCCCAGCTGCACAGTGG - Intronic
1151878482 17:76880715-76880737 CAGTCTCCCCACCTGGGGAGGGG - Intronic
1151930641 17:77229652-77229674 CAGTTTCCCCATCTGTGCAGTGG - Intergenic
1152238630 17:79150854-79150876 CAGTGTCCCCGTGTGCGCAATGG + Intronic
1152245706 17:79183556-79183578 CAGCCTCCCCGCCCGGGCAGGGG - Intronic
1152305906 17:79520061-79520083 CGGTGTCCTCGACTGCACAGGGG - Intergenic
1152778113 17:82214468-82214490 CAGTGTCCCTGCCTGTAAAGTGG + Intergenic
1152868024 17:82735785-82735807 CAGAGCCCCCGCCTGCGCACGGG - Intronic
1153815374 18:8786028-8786050 CGGTGTCCCCGTCTGCGCGGCGG - Exonic
1154149693 18:11896608-11896630 CTGTGTCCTCCCCTGCCCAGGGG + Intronic
1160145685 18:76362332-76362354 CAGTTTCCACTCCAGCGCAGCGG + Exonic
1160521176 18:79509112-79509134 CAGTGTTGCAGCCTCCGCAGAGG + Intronic
1160706140 19:531263-531285 CCGTTTCCCCGTCTGTGCAGGGG - Intergenic
1160719025 19:589650-589672 CAGTTTCCCCTCCTGGGGAGAGG + Intergenic
1160858984 19:1229745-1229767 CGGTGTCGTCGCCTGCGCCGCGG + Exonic
1160919099 19:1511669-1511691 CAGTTTCCCCATCTGTGCAGTGG + Intronic
1161006772 19:1941120-1941142 CCGTGGCCGCGGCTGCGCAGTGG + Intergenic
1161381410 19:3967001-3967023 CTGTGCCCCCACCTGCGCTGGGG - Intronic
1161482489 19:4517944-4517966 CAGTTTCCCCATCTGTGCAGTGG - Intergenic
1161517034 19:4702329-4702351 CAGTTTCCTCCCCTGTGCAGTGG + Intronic
1161543844 19:4867908-4867930 CAGGGTCCCCAGCTGCGGAGCGG - Intergenic
1161701491 19:5798288-5798310 CAGTCTCCCCACCTGCTCAGGGG - Intergenic
1161719940 19:5897117-5897139 TAGTGTCCCCGGCTGCTGAGTGG + Intronic
1162121186 19:8470019-8470041 CAGTGTGCTCACCTGAGCAGTGG + Intronic
1163657858 19:18558069-18558091 CAGTTTCCCCGTCTGCTCAATGG + Intronic
1165459538 19:35936515-35936537 CTGCGCCCCCGCCTGCGCTGCGG + Intronic
1166538799 19:43592524-43592546 CAGTGCCCCTGCCTGGGCTGGGG + Exonic
1167441999 19:49513915-49513937 CGGTGTCCTCGCCTGCCCCGGGG + Exonic
1167494166 19:49808369-49808391 CAGTGTCCCCGCCTGCGCAGTGG + Intronic
925176100 2:1784995-1785017 CAGGGTCCCCTCCTGGGTAGAGG + Intergenic
925200726 2:1965821-1965843 CAGTGGCCCTGTCTGGGCAGCGG + Intronic
926784631 2:16507901-16507923 CAGTCTCCCCACCTGCAAAGTGG - Intergenic
928099539 2:28427992-28428014 CAGTGCCCTGGCATGCGCAGGGG - Intergenic
928186661 2:29116009-29116031 GAGAGTCCCCGCACGCGCAGTGG + Intronic
931706128 2:64947900-64947922 CAGTGCCCCGGCCTGCATAGGGG - Intergenic
931826931 2:66010143-66010165 CTGAGGCCCCGCCTGCACAGGGG - Intergenic
932714672 2:74092717-74092739 CAGTGTCCCCAGCTGTGAAGTGG + Intronic
937639486 2:124195358-124195380 CAGTGAACCCCCTTGCGCAGGGG + Intronic
937906398 2:127054877-127054899 CATTGTCTCCGCCTGTGCCGGGG - Intronic
948388077 2:237593975-237593997 CAGCTTCCCCTCCTGCACAGAGG + Intronic
948575577 2:238947367-238947389 CAGGGCCCCTGCCTGCTCAGTGG + Intergenic
948575599 2:238947449-238947471 CAGAGCCCCTGCCTGCTCAGTGG + Intergenic
948867395 2:240782834-240782856 CAGTTTCCCCGCCTGTAAAGTGG - Intronic
1171794564 20:29556763-29556785 CAGTTTCCCCTCCTGCCCAAAGG + Intergenic
1171853885 20:30327501-30327523 CAGTTTCCCCTCCTGCCCAAAGG - Intergenic
1172657475 20:36545982-36546004 CAGTTTCCCCATCTGTGCAGTGG - Intronic
1174396610 20:50250649-50250671 CAGTTTCCCCATCTGCTCAGTGG - Intergenic
1175913303 20:62414643-62414665 CAGTTTCCTCGCCTGTGGAGTGG - Intronic
1176047030 20:63097967-63097989 CAGTTTCCCCATCTGTGCAGTGG + Intergenic
1179731431 21:43369926-43369948 CAGTGTCCCCTCCAGCACACAGG + Intergenic
1180013251 21:45065120-45065142 CACTGTTCCCGCCTGCACTGAGG - Intergenic
1180991766 22:19941497-19941519 CAGTTTCCCCACCTGGGAAGGGG + Intronic
1180997734 22:19973791-19973813 CCCTCTCCCCGCCTCCGCAGTGG - Exonic
1181072255 22:20352560-20352582 CAGTTTCTCCACCTGAGCAGTGG - Intronic
1181085953 22:20439396-20439418 GAGTGTCCCCTCCAGCCCAGGGG - Intronic
1181310697 22:21943188-21943210 CCGTGTCCCAGCCTGAGGAGGGG - Intronic
1181313853 22:21959794-21959816 CAGTATCCCTGCCTGGGAAGGGG - Intronic
1181518982 22:23434549-23434571 CAGTGTCCCCACCTGTGAAATGG - Intergenic
1184222728 22:43111047-43111069 CAGTCTCCGCGCCTGTGCAATGG + Intronic
1185041793 22:48507945-48507967 CAGTGTCCTCATCTGTGCAGTGG + Intronic
1185228231 22:49665241-49665263 CAGCGTCCCCGCTTGTGCCGTGG - Intergenic
1203244226 22_KI270733v1_random:49241-49263 CAGTCTCACAGCCTGCACAGTGG - Intergenic
949471875 3:4404991-4405013 CAGTCTCATCGCCTGGGCAGAGG + Intronic
950520736 3:13496348-13496370 CAGTGTCCCCTTCTGTACAGTGG + Intronic
950702704 3:14761252-14761274 CACCGTCCCAGCCTGGGCAGGGG + Intronic
953906693 3:46872034-46872056 CAGTGTTCACACCTGCACAGTGG + Intronic
954674748 3:52309561-52309583 CAGTGTCCCCACCTGCAAAAAGG + Intergenic
954999995 3:54918759-54918781 CAGTGTCCTCGCAGGCTCAGTGG - Exonic
955291120 3:57693079-57693101 CAGCGTCTGCGCCTGCGCGGAGG - Exonic
961447199 3:126986427-126986449 CGGTTTCCCCACCTGAGCAGTGG + Intergenic
962444680 3:135453979-135454001 CAGTGTCCCCATCTGTGCAATGG - Intergenic
968577835 4:1376209-1376231 CAGGGTCCCAGCCTGAGGAGGGG + Intronic
968830356 4:2930431-2930453 CAGTTTCCCCCTCTGCACAGTGG - Intergenic
968901207 4:3432765-3432787 CAGGGTACCCACCTGCCCAGGGG - Intronic
969243724 4:5918980-5919002 CAGTTTCCCCATCTGTGCAGAGG - Intronic
970507411 4:16745317-16745339 CAGTCTCCCCGCCTGGGCTCTGG - Intronic
975027360 4:69567667-69567689 CTGTGGCCCCGGCTGCTCAGGGG - Intergenic
977904160 4:102456388-102456410 CAGAGTCCCCACCGGCGCAAAGG - Intergenic
988380244 5:30489614-30489636 CAGTGTCTCCGTCTCCGCGGAGG + Intergenic
989443734 5:41504128-41504150 CATTATCCCAGCCTGCTCAGTGG + Intronic
997585233 5:135039809-135039831 CAGTGTCCCCGCCTTCCCCGCGG - Intronic
997727217 5:136132169-136132191 CAGTGGCCCCGCCTGTCCAGGGG + Intergenic
998222998 5:140303081-140303103 CACTGTAAGCGCCTGCGCAGTGG + Exonic
999447521 5:151652056-151652078 CAGTTTCCCCACCTGCATAGTGG + Intergenic
1001518937 5:172377102-172377124 CACTGTCCCAGCCAGAGCAGAGG + Intronic
1002641645 5:180633315-180633337 CAGTGTCCCAGTCTGTACAGTGG - Intronic
1002778529 6:348991-349013 CAGTGTGCCCGGCTGGGCAGGGG + Exonic
1003331197 6:5130142-5130164 CAGTGTCTCCCCCAGCGCTGGGG - Intronic
1004560823 6:16748519-16748541 CAGTTTCCTCGCCTGTGCAATGG + Intronic
1006121215 6:31807029-31807051 TAGGGTCCGCGCCTGCGCAATGG - Intergenic
1008468333 6:51855103-51855125 CAGTTTCCCCGGCTGGGTAGCGG + Intronic
1013225891 6:108119321-108119343 AAGTGCCCCCGCCTTCGCACCGG + Intronic
1018885640 6:167933960-167933982 CAGAGTCCTGGCCTGTGCAGGGG - Intronic
1019592304 7:1841777-1841799 CAGTGTCCCCACCTGTGAAATGG + Intronic
1019707940 7:2505262-2505284 CAGTGTCCCCGTCTGCGAAATGG - Intergenic
1022109671 7:27220599-27220621 CAGGGTCCCCGCCAGCCCCGCGG - Intergenic
1022506188 7:30909905-30909927 CAGTGTCCCTGCCAGGGCATGGG + Intergenic
1022506757 7:30912364-30912386 CAGTGTCCCCATCTGCACAATGG - Intronic
1024222804 7:47301765-47301787 CAGTGTCCCTGACTTCTCAGAGG + Intronic
1025245460 7:57313303-57313325 CTGTGGCCCCTCCTGCGCTGGGG + Intergenic
1032026260 7:128444943-128444965 CAGTGCCCCAGGCTGGGCAGTGG + Intergenic
1032196833 7:129794298-129794320 CAGTTTCCCCACCTGTGAAGTGG - Intergenic
1034130105 7:148707946-148707968 CAGTGTCCCCTTCTGAGTAGGGG + Intronic
1034164052 7:149012349-149012371 CAGTGTCCACACCTGCCAAGAGG + Exonic
1036751270 8:11444873-11444895 CAGTTTCCCCTCCTGTGGAGTGG - Intronic
1036929651 8:12942707-12942729 CAATGTCCCCTCCTGGGCTGGGG - Intergenic
1037611551 8:20480432-20480454 CAGTGTCCACGCAAGCCCAGAGG - Intergenic
1043047254 8:75342315-75342337 CAGTGTAGAGGCCTGCGCAGTGG - Intergenic
1047279355 8:123431741-123431763 CAGTGTCTCCCCCTGGTCAGTGG + Intronic
1049205496 8:141361690-141361712 CAGTGTCTCCTCCTGTGAAGTGG + Intronic
1049337792 8:142095801-142095823 CAGAGACCCAGCCTGAGCAGGGG + Intergenic
1053791687 9:41690794-41690816 CAGTTTCCCCTCCTGCCCAAAGG - Intergenic
1054153471 9:61623976-61623998 CAGTTTCCCCTCCTGCCCAAAGG + Intergenic
1054180088 9:61902809-61902831 CAGTTTCCCCTCCTGCCCAAAGG - Intergenic
1054473265 9:65555177-65555199 CAGTTTCCCCTCCTGCCCAAAGG + Intergenic
1054657503 9:67678332-67678354 CAGTTTCCCCTCCTGCCCAAAGG + Intergenic
1056232524 9:84561237-84561259 CAGATTCCTCGTCTGCGCAGGGG - Intergenic
1056306359 9:85294630-85294652 CAGGGTCCACACCTGGGCAGTGG + Intergenic
1056574352 9:87843439-87843461 CAGTGTCCGCGCCCACACAGGGG - Intergenic
1056900225 9:90592301-90592323 CAGGGTCCCCGCATGAGCACTGG - Intergenic
1056954093 9:91068671-91068693 CAGTGTCCCAGCCGGCTCGGTGG + Intergenic
1057003667 9:91536343-91536365 CAGAGTCCCCTCCTGCCGAGGGG - Intergenic
1059669439 9:116478553-116478575 CAGTGACCCAACCTGCTCAGTGG - Intronic
1060103859 9:120861665-120861687 CAGTGTCCCTACCTGGACAGTGG + Intronic
1060667786 9:125443302-125443324 CAGTGTCCCCACCTGTAAAGTGG - Intronic
1060743036 9:126112071-126112093 CAGTGACCCCATCTGCACAGTGG - Intergenic
1060750514 9:126165495-126165517 CAGAGTCCCCTGCTGGGCAGGGG + Intergenic
1061422565 9:130480196-130480218 CAGTTTCCCCACCTGTCCAGTGG + Intronic
1062042510 9:134410645-134410667 CAGTCTCCACGCCTGGGCACAGG - Intronic
1062360907 9:136187634-136187656 CAGGGTCCCCACATGCTCAGAGG + Intergenic
1062461849 9:136665675-136665697 CAGTTTCCCCGTCTGCGCAATGG + Intronic
1062521097 9:136958322-136958344 CAGTTTCCCCATCTGTGCAGAGG - Intergenic
1189340954 X:40204216-40204238 CACTGTCCCCGGCTGCGAAATGG - Intergenic
1197871317 X:131065267-131065289 CAGTGTTCCTGCCTGTGCAATGG - Intronic
1199688895 X:150291152-150291174 CAGTGTCCCCACTTACGCTGTGG + Intergenic
1199713955 X:150492640-150492662 CAGTGTCCCCACCTACCAAGTGG + Intronic
1200063590 X:153494640-153494662 CAGTGTCCCCATCTGGGCAGTGG + Intronic