ID: 1167494600

View in Genome Browser
Species Human (GRCh38)
Location 19:49810191-49810213
Sequence GAAAGGGGCAGAGCCAGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 481
Summary {0: 1, 1: 0, 2: 3, 3: 62, 4: 415}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167494596_1167494600 -5 Left 1167494596 19:49810173-49810195 CCGGAGGGCTGTGAGCAGGAAAG 0: 1
1: 0
2: 4
3: 42
4: 317
Right 1167494600 19:49810191-49810213 GAAAGGGGCAGAGCCAGCTCTGG 0: 1
1: 0
2: 3
3: 62
4: 415
1167494591_1167494600 15 Left 1167494591 19:49810153-49810175 CCTGGGGGAGGTGGAGGCTGCCG 0: 1
1: 2
2: 38
3: 209
4: 965
Right 1167494600 19:49810191-49810213 GAAAGGGGCAGAGCCAGCTCTGG 0: 1
1: 0
2: 3
3: 62
4: 415
1167494589_1167494600 21 Left 1167494589 19:49810147-49810169 CCTTGTCCTGGGGGAGGTGGAGG 0: 1
1: 1
2: 7
3: 74
4: 691
Right 1167494600 19:49810191-49810213 GAAAGGGGCAGAGCCAGCTCTGG 0: 1
1: 0
2: 3
3: 62
4: 415

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167494600 Original CRISPR GAAAGGGGCAGAGCCAGCTC TGG Intronic
900564361 1:3325064-3325086 GGAAGAGGCTGAGCCAGCTCTGG - Intronic
900732467 1:4271363-4271385 GGAAGGGGAAGAGCTGGCTCAGG - Intergenic
900806158 1:4769620-4769642 GGAAGGGGGAGCTCCAGCTCTGG - Intronic
900972296 1:5998337-5998359 GAAAGAGGCAGAGCCAGAATCGG + Intronic
901006069 1:6172060-6172082 GAGAGGGGCTGAGGGAGCTCTGG - Intronic
901635488 1:10668363-10668385 GAAAGGGGCAGTGACAGGGCCGG - Intronic
901871290 1:12140559-12140581 GATGGGGGCAGAGCCAGAGCGGG + Intronic
902384075 1:16066470-16066492 GAGAGGGGCAGGACTAGCTCAGG - Intronic
902711588 1:18243648-18243670 GAAAGGGGCAGTGCCAGACCGGG - Intronic
902715232 1:18268267-18268289 GTTAGTAGCAGAGCCAGCTCTGG + Intronic
903011069 1:20330781-20330803 GAAAGGGACAGAGCATGGTCTGG - Intronic
903178700 1:21594924-21594946 GAAGGGGGCAGGGCCAGCAGGGG + Intergenic
903886912 1:26546059-26546081 GCAAGGGACACAGCCAGGTCAGG - Intronic
904255002 1:29249268-29249290 GTAAGGGGCAGAGCTGCCTCTGG - Intronic
904360193 1:29966148-29966170 GAAAGGGTCAGAGCCAGAATGGG - Intergenic
904598927 1:31663240-31663262 GAAAGGGGCTCAGGGAGCTCAGG + Intronic
904787157 1:32991777-32991799 GCTAGGGGCAGAGCCATCACGGG + Intergenic
904839745 1:33364659-33364681 GAGTGGGGCAGCGCCATCTCTGG + Intronic
904988564 1:34572954-34572976 GGCCGGGGCACAGCCAGCTCTGG + Intergenic
905725766 1:40250597-40250619 GGAAGTGGCAGAGCCAGGACAGG - Intronic
905815181 1:40944464-40944486 GGAAGGAGCAGAGCCAGCAGAGG - Intergenic
906054481 1:42904521-42904543 GAAAGGAGCAGAGCCAGAAGAGG + Intergenic
906345525 1:45012183-45012205 GAAAGGGGCGGAGCCTGGACTGG + Exonic
907456990 1:54582269-54582291 GGAAGGGGGAGACCCTGCTCAGG + Intronic
908182623 1:61621442-61621464 GTAAGGGGCAGAGTCAGAACTGG - Intergenic
909866612 1:80681223-80681245 GCAAAGGGCAGAGAGAGCTCAGG - Intergenic
909990646 1:82219416-82219438 GAAAGAGGCAGTGCAGGCTCTGG - Intergenic
910405525 1:86885764-86885786 GTAAGTGGCAGAGCCAGAACTGG - Intronic
911157468 1:94651578-94651600 GAAAAGGGCAGAACCAGCATTGG - Intergenic
912401661 1:109398129-109398151 GAACGGGGCAGAGACTGCTGAGG + Intergenic
913963221 1:143354674-143354696 GAAGGGGGCAGAGCCGTCTCAGG - Intergenic
914001361 1:143697687-143697709 GCAAGGGGCAGCGCCAGGACTGG + Intergenic
914057577 1:144180260-144180282 GAAGGGGGCAGAGCCGTCTCAGG - Intergenic
914121569 1:144786106-144786128 GAAGGGGGCAGAGCCGTCTCAGG + Intergenic
914877219 1:151520926-151520948 GTAAGGGGCAGAGCCAGGATGGG - Intronic
915081522 1:153355840-153355862 GAACGGTGCAGACACAGCTCAGG - Intergenic
915245472 1:154553121-154553143 GAAAGAGGAAGAGCCAGCTGAGG - Exonic
915367365 1:155323650-155323672 GACAGCAGCAGTGCCAGCTCGGG - Intronic
915900171 1:159841048-159841070 AAAAGGGGGAGAGGCAGCTACGG - Intronic
916290771 1:163164051-163164073 GAAATGTGCAGAGCCCGCTTGGG + Intronic
917195117 1:172456509-172456531 GAAATGGGCACAGGCATCTCAGG + Intronic
918127885 1:181600270-181600292 GAGAGGGTCAGGGCCAGATCAGG + Intronic
920121963 1:203665468-203665490 GACAGGGGCAGAGACACCTGAGG - Intronic
920430218 1:205914178-205914200 GAAAGGGGCTGATCCAGATTGGG - Exonic
921312137 1:213855036-213855058 GAAACAGGGAGAGCAAGCTCTGG + Intergenic
921611693 1:217219717-217219739 AAAAGGGGCAGAGCAAGATGGGG - Intergenic
921747212 1:218752372-218752394 CAAAGAGACAGGGCCAGCTCTGG - Intergenic
922067737 1:222160181-222160203 GCCAGGAGCAGAGCCAGCTAGGG - Intergenic
922232818 1:223701241-223701263 GAGAGGGCCGGAGCCAGCTGGGG - Intergenic
923166559 1:231369454-231369476 GCAGGGGGCAGAGACAGCACTGG + Intronic
923442844 1:234037873-234037895 TAAAGGCACAGAGCCATCTCGGG + Intronic
923685271 1:236149124-236149146 GAAAAGGGCAGGGTCAGCCCGGG - Intronic
1062931938 10:1359221-1359243 GATAGGGGCAGTGCCTGCTCAGG - Intronic
1062932101 10:1360257-1360279 GAAAAGGGCAGGCCCACCTCTGG - Intronic
1063028436 10:2207341-2207363 GAAATGTGCAGAGCCAGGACAGG - Intergenic
1065498178 10:26351220-26351242 GAAAGGAGGAGAGCCTCCTCAGG + Intergenic
1067089605 10:43259877-43259899 GGAAGGGGGATGGCCAGCTCAGG + Intronic
1067533640 10:47092531-47092553 GGAAGGGGCAGACCCAGTTTCGG + Intergenic
1067570758 10:47369269-47369291 GGAAGGGAAAGAGCCTGCTCTGG + Intronic
1067847520 10:49735918-49735940 GAGAAGGGCAGGGCCAGTTCTGG + Intronic
1068388031 10:56358360-56358382 GAAAAGGTCAGACCCAACTCAGG - Exonic
1068405715 10:56586015-56586037 TGAAGGGGCAAAGCCAGCACGGG + Intergenic
1069771517 10:70903489-70903511 GAAGGGGGCAGGGCCACCTCAGG + Intergenic
1070544021 10:77438704-77438726 AAAAGGGGCAGAGCCAGGATTGG + Intronic
1070651437 10:78239911-78239933 GAAAGGGGGAGAGCCTGCTGGGG - Intergenic
1070807224 10:79277692-79277714 GATGGGGACAGAGCCAGCCCAGG + Intronic
1072618026 10:97062674-97062696 GGAAGGGGCAGAGGCAGGCCAGG + Intronic
1072755824 10:98020071-98020093 GAAAGGGGCAGATCCCCCACAGG - Intronic
1072804724 10:98417279-98417301 GATAAAGGCAGAGGCAGCTCTGG + Exonic
1074466985 10:113692159-113692181 TAAAGGGGCAAAGCCAGGTGGGG + Intronic
1075265599 10:120997841-120997863 GGAAGGGGCAGAGCCTGCGCTGG - Intergenic
1076029265 10:127143718-127143740 GCAAGGGGGAGAGCCAGGCCTGG - Intronic
1076157039 10:128212130-128212152 GAAGTGGGCGGAGCCAGCCCCGG + Intergenic
1076249361 10:128972988-128973010 GTAACTGGCAGAGCCAGATCTGG - Intergenic
1076541685 10:131219149-131219171 GACATGGGCAGAGCCAGGCCAGG - Intronic
1077161192 11:1113430-1113452 GAAAGGGGTGGGGCCTGCTCTGG - Intergenic
1077187217 11:1240742-1240764 CACAGGGGCAGGGCCAGCCCTGG + Intronic
1077373489 11:2194558-2194580 GAAGGGCGCACAGCCTGCTCAGG - Intergenic
1077648371 11:3946837-3946859 CACAGTGGCAGAGCCAGCACTGG - Intronic
1077690605 11:4338634-4338656 GAAGGGGACAAAGCCAGCCCAGG + Intergenic
1077889852 11:6411114-6411136 AAGAGGGCCAGAACCAGCTCCGG - Exonic
1077915664 11:6610089-6610111 GAAGGGGGCAGAGACAGGACAGG + Intronic
1078871916 11:15355048-15355070 GAAAGAGGCAGAGACAGGCCAGG + Intergenic
1081713777 11:45234341-45234363 GACAGGGGCAGAGGAGGCTCAGG - Intronic
1082806687 11:57456175-57456197 GTGAGTGGCAGAGCCAGGTCTGG - Intergenic
1083308017 11:61770808-61770830 GCCAGGGGCAGAGCCAGGACTGG + Intronic
1083697632 11:64453377-64453399 GAAGAGGGCATGGCCAGCTCTGG + Intergenic
1083887725 11:65581015-65581037 GAGAAGGGCAGAGTCAGCCCAGG - Intronic
1083901865 11:65647173-65647195 GAGGAGGGCAGAGCCAGCCCCGG + Intronic
1084273709 11:68041553-68041575 GTATGGGGAGGAGCCAGCTCAGG - Intronic
1084941483 11:72615565-72615587 AAGCGGGGCAGAGCCAGCTCAGG + Intronic
1084950201 11:72660877-72660899 GCAAGGGGCAAGGCCAGCTCTGG + Intronic
1085023864 11:73225315-73225337 GGTAGGGGCAGAGCCAGGTCAGG + Intronic
1085339036 11:75719414-75719436 GGGAGGGACAGGGCCAGCTCTGG + Intronic
1085394555 11:76200732-76200754 GCAAGCGGCAGAGCAGGCTCAGG - Intronic
1085645404 11:78219213-78219235 GAGATGGGAAGGGCCAGCTCTGG + Exonic
1086166768 11:83788401-83788423 GAGAGTGGCACAGCCAGATCAGG - Intronic
1086900533 11:92362490-92362512 GAAAGAAGGAGAGCCAGGTCAGG + Intronic
1088549377 11:110995750-110995772 GAAAGTGCCAGGGCCAGGTCAGG + Intergenic
1088595988 11:111440637-111440659 GAAAAGGGCAGATCTAGGTCTGG - Intronic
1089198284 11:116707999-116708021 GAAGGAGGCAAAGCCAGCCCTGG - Intergenic
1089361127 11:117887447-117887469 GTAAGTGGCAGAGCCAGGACTGG + Intergenic
1089579175 11:119470840-119470862 GAGAGAGGCAGAGCCTGGTCAGG - Intergenic
1089737940 11:120562865-120562887 GAAAAGGGAGGAGCCAGGTCAGG + Intronic
1089811802 11:121138243-121138265 TTAGGAGGCAGAGCCAGCTCTGG + Intronic
1090263960 11:125342514-125342536 GAAAAGCGCAGAGCCACCTCCGG - Intronic
1090651487 11:128810459-128810481 GAAGCGGGCAGATCCAGCTGTGG + Exonic
1090940054 11:131379473-131379495 GAAAGAGGCAGACCCAGGTTTGG - Intronic
1091191619 11:133700274-133700296 GGAGGGGGCTGAGCTAGCTCAGG - Intergenic
1091308550 11:134556772-134556794 GTAAGGGGCAGAGCTCTCTCTGG + Intergenic
1091666298 12:2420764-2420786 GCAAGGCGCAGAGCCAGGGCTGG - Intronic
1092964506 12:13628364-13628386 GCAAGGGGTAGAGCAAGCTGGGG - Intronic
1094436677 12:30428292-30428314 GAAGGGAGGAGAGCCAGCTTTGG + Intergenic
1096111263 12:49030664-49030686 TCAATGGGCAGAGCCAGCTGAGG - Exonic
1096521370 12:52186574-52186596 GCAAGTGGCAGAGCCAGGCCTGG + Intronic
1096531454 12:52245210-52245232 GTAAGTGGCAGAGCCAGAACTGG + Intronic
1096622815 12:52874903-52874925 GGAGGGGGCAGAGCCAGAGCTGG - Intergenic
1097702214 12:62831574-62831596 GAAAGGGGCAGAGTCATGGCAGG + Intronic
1099150104 12:79100284-79100306 GCAAGTGGCAGAGCCAACTTTGG + Intronic
1099443526 12:82726583-82726605 GAAAGTGGCAAAGCCAAGTCTGG + Intronic
1099842906 12:87989102-87989124 GTTAGGGGCAGAGCCAGGACTGG + Intronic
1101406803 12:104435934-104435956 GAAAGGGGAAGAGAAAGATCAGG - Intergenic
1101986739 12:109453020-109453042 GTTAGGGGCAGAGCCAGGACGGG + Intronic
1102191778 12:110994198-110994220 GCAAGGGGCAGAGCCAGAACTGG + Intergenic
1104375289 12:128260629-128260651 GAACTGGGCAGAGCCAGCAGAGG + Intergenic
1104766316 12:131332705-131332727 GAGAGGGGAGGAGCCGGCTCAGG + Intergenic
1106185233 13:27404117-27404139 CAGAGGGACAGAGCCAGCACCGG + Intergenic
1106479236 13:30124260-30124282 GCAAAGGGAAGAGCCAGCGCCGG - Intergenic
1106948381 13:34854440-34854462 GAAAGAGGCAGTACCAGCCCTGG - Intergenic
1114219183 14:20682139-20682161 GAAACGGGAAGAGCCAGCAATGG + Intergenic
1116863819 14:50015524-50015546 GAAAGGGGCTCAGCCAGATGTGG - Intergenic
1117679861 14:58192890-58192912 GAAAAGGACAGAGGCAGCTTAGG + Intronic
1117882341 14:60324312-60324334 GAAAGTGGCAGAGCCAGGATTGG - Intergenic
1118740242 14:68734195-68734217 GATAGGGGCAGAGCCAGAATGGG - Intergenic
1119416464 14:74473516-74473538 GGAAGAGGCAGAGCCAGGTCAGG - Intergenic
1119879440 14:78088770-78088792 GAGATGGGCAGACACAGCTCAGG - Intergenic
1121439970 14:93942379-93942401 GACCGGAGCAGATCCAGCTCAGG + Intronic
1121928375 14:97949296-97949318 GAATGGGGTAGAGCAGGCTCTGG + Intronic
1122635003 14:103125709-103125731 GAAAGGGGCAGAGCCTGACCAGG - Intronic
1122961753 14:105097117-105097139 GAAGGGGGCAGAGGCAGGACAGG - Intergenic
1123097944 14:105775204-105775226 GGATGGGGCAGAGCCAGCCATGG - Intergenic
1123189981 14:106559783-106559805 AAAAGGGGCAGAGACATTTCTGG - Intergenic
1124693696 15:31846030-31846052 CAGAGGGGCAGAGCCAGCCAAGG - Intronic
1124722359 15:32121137-32121159 CAATGGGGCACATCCAGCTCGGG - Intronic
1125057209 15:35375593-35375615 GAAAGGAGGACAGCCAGCTGGGG - Intronic
1125248507 15:37671823-37671845 GAAAGGGAGATAACCAGCTCAGG + Intergenic
1125438963 15:39680564-39680586 GAAATGGTCAGAGCCATCTTAGG + Intronic
1126158419 15:45586712-45586734 GAAAAGGGCATAGGCAGCTTTGG - Intergenic
1128511005 15:68313897-68313919 GGAAGGGGCTCAGCCAGCACAGG + Intronic
1129200302 15:73994689-73994711 GAAAGGGGAGGTGCCGGCTCAGG - Intronic
1129803855 15:78438180-78438202 GAGAGCAGCAGAGCCAGCCCCGG - Exonic
1129875489 15:78972953-78972975 GTAAAGGGCAGAGCCAGGTCTGG - Intronic
1130545617 15:84856128-84856150 GAAAGGGCCAGAGCTGGGTCTGG + Intronic
1130650774 15:85760904-85760926 GGAAGGGGCCCTGCCAGCTCTGG - Exonic
1131507057 15:93028496-93028518 CACAGGGGCAGGCCCAGCTCTGG + Intergenic
1131635406 15:94228341-94228363 GTAAGTGGCAGAGCTAGGTCTGG + Intergenic
1132522657 16:398644-398666 CATAGAGGCAGAGCCAGCTCAGG - Intronic
1132648966 16:1011984-1012006 GAAAGGGGCAGAGACAGAGAGGG - Intergenic
1134675366 16:16086433-16086455 GAAAGGCATAGAGCCTGCTCAGG - Intronic
1136111131 16:28064013-28064035 GACAAGGGCAGAGCCTGCTGGGG + Intergenic
1136358308 16:29761116-29761138 GAATCTGGCAGAGCCAGGTCGGG - Intergenic
1137729260 16:50677694-50677716 CAAAGGGGCAGACCCAGATTTGG - Intronic
1138105743 16:54286361-54286383 GGAGCGGGCAGAGGCAGCTCCGG - Exonic
1138117075 16:54369320-54369342 GAAAGTGGTAGAGCCAGGACTGG + Intergenic
1138549594 16:57740267-57740289 GGTCGGGGCAGAGCCAGCACAGG - Intronic
1139276526 16:65732922-65732944 GCAAGGGTCAGAGCTACCTCGGG - Intergenic
1139364552 16:66425871-66425893 GGATGGGGCAGAGCAGGCTCCGG - Intergenic
1139760848 16:69183840-69183862 GAAGGAGGCAGAGACAACTCAGG - Intronic
1139964504 16:70737994-70738016 GGAAGGGCCAGAGGCCGCTCAGG + Intronic
1140672147 16:77289825-77289847 GAAATGGTCAGAGACAGCTCTGG + Intronic
1141645604 16:85365847-85365869 CAAAGGAGCAGAGCCAGGTTTGG - Intergenic
1141833519 16:86523200-86523222 GAAAGAGGCAGGCACAGCTCTGG + Intergenic
1142032378 16:87845009-87845031 GACAGAGCCAGAGCCAGCCCAGG + Intronic
1142145720 16:88492224-88492246 GAAAGGGGCAGAGACGGGTGAGG - Intronic
1142217918 16:88838915-88838937 GAGATGGGGAGAGGCAGCTCGGG - Intronic
1142229105 16:88891307-88891329 GCTAGGTGCAGAGCCAGCGCAGG - Intronic
1142267707 16:89072140-89072162 GAAACGCGTAGAGCCAGCTCCGG - Intergenic
1142351221 16:89581380-89581402 CAAAGGGGCAGGGGCAGCTGCGG - Intronic
1142640985 17:1285884-1285906 GAAAGGGGCAGAGACACCCAGGG + Intronic
1143013098 17:3877073-3877095 GGAAGGGGCAGAGCTAGCCTAGG - Intronic
1143114706 17:4576026-4576048 GAAAGTGGCAGGGGCAGCTCAGG - Intergenic
1143503125 17:7350355-7350377 GAAAGGGGCTGGGCCAGCGCCGG + Intronic
1143599769 17:7936871-7936893 GAAAGGGGCAGAAATAGCTCTGG + Intronic
1143620277 17:8076487-8076509 GAAAGGAGCAGAGGCAGGGCTGG - Intronic
1143768759 17:9154505-9154527 GAAAGGGGCCGAGGCAGGACTGG - Intronic
1144374043 17:14621370-14621392 GCAAGTGGAAGAGCCAGGTCTGG + Intergenic
1145278144 17:21448294-21448316 GAAGGGGGCACAGGAAGCTCAGG - Intergenic
1145714396 17:27006121-27006143 GAAGGGGGCACAGGAAGCTCAGG - Intergenic
1148197981 17:45728573-45728595 GAGTGGGGCTGAGCCAGCTGTGG + Intergenic
1148482051 17:47966380-47966402 GAAAGGGGCAGGGCCTGCAGGGG + Intergenic
1148689633 17:49519889-49519911 AGAAGGGGCTGGGCCAGCTCTGG + Intergenic
1148772043 17:50072880-50072902 GACAGGGGCAGACCCAGGGCTGG + Intronic
1149541662 17:57472313-57472335 GCAGGGGGCAGGGCGAGCTCAGG + Intronic
1150971151 17:70029640-70029662 GCAAAGGTCAGAGCCAGCTGGGG + Intergenic
1151702698 17:75751933-75751955 GTAAGTGGCAGAGCCAGGGCTGG - Intronic
1151841790 17:76624082-76624104 AAAGGGTGCAGTGCCAGCTCCGG - Intergenic
1151874042 17:76856469-76856491 GAAAGGGGCTGGGCCGGCCCTGG + Intergenic
1152236159 17:79139967-79139989 AAAAGGGGCAGGGCCAGGCCTGG + Intronic
1152391533 17:80006608-80006630 GAAAGGGGCTGGGCGAGCCCTGG - Intronic
1152460095 17:80438160-80438182 GAAAGGGGCTGGGCCAGCTCAGG - Intergenic
1152509441 17:80775519-80775541 CAAGGAGGCAGAGCCAGCCCTGG + Intronic
1152537527 17:80959405-80959427 GCGAGGGGCAGAGCCGGCTCTGG - Intronic
1152548732 17:81018491-81018513 AAGATGGGCAGAGCCTGCTCTGG - Intergenic
1153098890 18:1441274-1441296 GAAAGGGGCTTACCCAGCTATGG + Intergenic
1155628520 18:27863954-27863976 AAAAGGGGCAGTGCCAACTCAGG - Intergenic
1157177983 18:45468415-45468437 CAAAGGGGCAGAGCTTGTTCTGG + Intronic
1157474286 18:48011490-48011512 GGAAGGGGAAGAGCTGGCTCAGG + Intergenic
1157689200 18:49667194-49667216 GAAATGTCCAGAGCCAGCACCGG - Intergenic
1157989847 18:52481719-52481741 GACAGTGTCAGAGCCAGATCTGG - Intronic
1159830460 18:73271905-73271927 GAAAGGTGCAGAGTCAACTTTGG + Intergenic
1160313101 18:77816107-77816129 GAAAGAGAAAGAGCTAGCTCTGG + Intergenic
1160657208 19:279723-279745 GTAAGGAGCAGAGGAAGCTCGGG - Intergenic
1160687048 19:441950-441972 GAGAGGGGCAGAGCCTGGGCCGG - Intronic
1161250151 19:3276014-3276036 GAGAGGGGCCGGGCTAGCTCTGG + Intronic
1161317685 19:3625808-3625830 CGAAGGGGCTGAGCCAGCACTGG + Intronic
1161452272 19:4353056-4353078 GACAGGGGCGGATACAGCTCGGG + Intronic
1161615617 19:5268608-5268630 GAGAGCGGCAGTTCCAGCTCGGG + Intronic
1161650298 19:5480196-5480218 GGGAGGGGCAGAGCGAGCTGGGG + Intergenic
1162134768 19:8548549-8548571 TTCAGGGGCAGAGTCAGCTCTGG - Intronic
1162164557 19:8743447-8743469 CACAGGTGCAGAACCAGCTCCGG - Intergenic
1162165629 19:8750915-8750937 CACAGGTGCAGAACCAGCTCCGG - Intergenic
1162166694 19:8758371-8758393 CACAGGTGCAGAACCAGCTCCGG - Intergenic
1162167760 19:8765827-8765849 CACAGGTGCAGAACCAGCTCCGG - Intergenic
1162168699 19:8772125-8772147 CACAGGTGCAGAACCAGCTCCGG - Intergenic
1162170445 19:8784889-8784911 CACAGGTGCAGAACCAGCTCCGG - Intergenic
1162477305 19:10908246-10908268 GTAAGGGACAGAGCCAGGACGGG - Intronic
1162921510 19:13906058-13906080 GAAAGAGGCAGAGCGCGCGCAGG - Exonic
1163039932 19:14594578-14594600 GAGCAGGGCAAAGCCAGCTCTGG - Intronic
1163262859 19:16201741-16201763 GAAATGAGAAGAGCCAGGTCAGG + Intronic
1164423289 19:28116792-28116814 GGAAGGGGCAGGGCCAGCACGGG - Intergenic
1164591050 19:29507173-29507195 AAATGGTGCAGAGCCGGCTCTGG + Intergenic
1165308621 19:35017564-35017586 GAGAGGGGCAGCCACAGCTCTGG - Intronic
1165648621 19:37467129-37467151 CAAAGTGGCAGAGCCGGCGCGGG + Exonic
1165972027 19:39639848-39639870 GAAAGGGGCTGGGCCAGGTGTGG - Intergenic
1166325981 19:42051440-42051462 GGAAGGGGCGGGGCCAGATCTGG - Intronic
1166389326 19:42400323-42400345 GAAAGGGCCAGGGTCAGCTCAGG - Intergenic
1166477522 19:43141467-43141489 AAAAAGGGTAGAGCCAGCTGGGG - Intronic
1167085897 19:47309634-47309656 GAGAGGGGCCGAGCCTGCACAGG + Intronic
1167213606 19:48149422-48149444 TAGAGGGGCAGAGTCAACTCTGG + Intronic
1167304124 19:48696984-48697006 GGAAGGGGCAGGGCCGGCGCTGG + Intronic
1167330704 19:48854120-48854142 GGCAGGGGAAGAGCCAGATCTGG - Intronic
1167369661 19:49072851-49072873 GAAAGGCGCAGAGCAGGCGCGGG - Exonic
1167429421 19:49446107-49446129 GGAAAGTGCAGGGCCAGCTCTGG + Intergenic
1167476216 19:49702765-49702787 GGAAGGGGCAGGGTCAGCTTTGG + Intronic
1167494600 19:49810191-49810213 GAAAGGGGCAGAGCCAGCTCTGG + Intronic
1167571251 19:50290397-50290419 GTGAGGGGCAGGGGCAGCTCTGG + Intronic
1167636749 19:50659906-50659928 GAGAGGGGCAGAGGCCGCGCTGG - Intronic
1167658766 19:50783450-50783472 GAAAGGGACAGGGTCAGCTCTGG + Intergenic
1167715016 19:51137559-51137581 GGAAGAGGCAGTGTCAGCTCTGG - Intergenic
1167746577 19:51354414-51354436 GAAAGGGGCAGGGCCTTGTCCGG + Exonic
1168402812 19:56095717-56095739 AAAAGGGGCTGGGGCAGCTCAGG - Intronic
1168587448 19:57604883-57604905 GAGAGGTGCACAGCCAGCACTGG - Intronic
1202697060 1_KI270712v1_random:132933-132955 GAAGGGGGCAGAGCCGTCTCAGG - Intergenic
925422243 2:3722188-3722210 GTAAGTGGCAGAGCCAGTACTGG + Intronic
926567978 2:14498703-14498725 GATGGGGGCAGAGCCTGGTCTGG - Intergenic
927474498 2:23402088-23402110 GTCAGGGGCAGAGCCAGAACTGG + Intronic
928264620 2:29801005-29801027 GTGAGGGGCAGAGCAACCTCAGG + Intronic
928906839 2:36377197-36377219 CAAGAGGGCAGAGCCAGCACTGG - Intronic
929515001 2:42598984-42599006 GAAAGGGGCAGAGTGAACTAAGG - Intronic
931960116 2:67473104-67473126 GAAAGGGGCAGAGCCAACTAGGG + Intergenic
932798139 2:74715541-74715563 GAAATGTGCAGAGCCGGCCCTGG - Intergenic
934035078 2:88082473-88082495 GACAGGTGCAGAGCCAGCTGAGG - Intronic
934051415 2:88214412-88214434 GAAACAGGCAGGGGCAGCTCGGG + Intergenic
934278221 2:91589947-91589969 GAAGGGGGCAGAGCCGTCTCAGG - Intergenic
935612606 2:105041038-105041060 GAATGGTGCAGAGACAGGTCTGG + Intronic
935861789 2:107339203-107339225 ATAAGTGGCAGAGCCAGCACTGG + Intergenic
936621808 2:114107979-114108001 GGAAGGGGCAGAGCAAGGTTGGG - Intergenic
936689422 2:114868855-114868877 AGACGTGGCAGAGCCAGCTCTGG - Intronic
936952911 2:117996175-117996197 GCAAGGAGCAGAGTAAGCTCAGG - Intronic
937228975 2:120385976-120385998 GTAAGGAGCAGAGCCAGCATTGG + Intergenic
937290817 2:120780716-120780738 GTAAGTGGCAGAGCCAGTCCTGG + Intronic
937630429 2:124095539-124095561 GAAAGGGAAAGAGCCAGATAAGG - Intronic
939925117 2:148163292-148163314 GAAAGTGGCAGAGCCAGGATTGG - Intronic
944474255 2:200087655-200087677 GAAAGGGGAAGAGGCAGCACAGG + Intergenic
946434513 2:219642840-219642862 GAAAGCAGCAGCACCAGCTCCGG - Intergenic
947159183 2:227194449-227194471 GGAAGGAGCAGAGCGAGGTCAGG - Intronic
948585529 2:239016537-239016559 AAAGGGGGCTGAGCCTGCTCGGG + Intergenic
948603861 2:239122605-239122627 GAGGAGAGCAGAGCCAGCTCGGG + Intronic
948992347 2:241561481-241561503 GACAGGGGCCCAGCCAGCCCAGG + Intronic
948992381 2:241561583-241561605 GACAGGGGCCCAGCCAGCCCAGG + Intronic
948992415 2:241561685-241561707 GACAGGGGCCCAGCCAGCCCAGG + Intronic
1168871912 20:1136284-1136306 TAAAGAGGCAGAGCCAGGGCTGG + Intronic
1168998700 20:2151059-2151081 GAAAGGGGCAGGCTCAGGTCAGG - Intronic
1169666445 20:8041852-8041874 TAGAGGGGCAGAGCCACCTCAGG - Intergenic
1170496572 20:16930837-16930859 GGAAGGGCAACAGCCAGCTCTGG + Intergenic
1171412765 20:24957861-24957883 GAAAGTGGCAAAGACACCTCTGG - Intronic
1172601355 20:36185719-36185741 GAAAGTGGCAGAGCCAGTATAGG - Intronic
1173549963 20:43925909-43925931 GACAGCTGCAGAGCAAGCTCGGG - Intronic
1174395886 20:50246701-50246723 GGAAAGGGCAGAGCCAGGACAGG + Intergenic
1174838718 20:53881505-53881527 GGAAGGGGCAGAGACAGGCCAGG + Intergenic
1175166700 20:57049106-57049128 GAGAGGGGCAGGCCCACCTCTGG + Intergenic
1175571440 20:60025774-60025796 GAAACTGGCAGTGCCAGCCCAGG - Intronic
1175590912 20:60191289-60191311 GAGAGAGGCAGAGCCAGCTAGGG + Intergenic
1176013554 20:62914614-62914636 GAAAGGGGCCGGGGCAGCGCAGG + Intronic
1176019195 20:62953901-62953923 GCAAGGGGCAGGGCCCGCTGAGG - Intronic
1176085162 20:63292595-63292617 GACAGGGGCAGGGCCAGGGCAGG + Intergenic
1176218379 20:63958711-63958733 CAAAGGGGCAAAGACAGCTCTGG + Exonic
1178491872 21:33057625-33057647 GAAAGGGGCACAGCCAGTCGGGG + Intergenic
1178754427 21:35335065-35335087 GAAAGTGGCAGAGCAGGCACTGG + Intronic
1180074990 21:45457657-45457679 GAATGGGGCAGGCACAGCTCAGG - Intronic
1180130268 21:45822586-45822608 GCAAGGGGCGGACCCAGCACAGG + Intronic
1180289468 22:10783925-10783947 CAAAGGGGCAGAGGCTTCTCCGG - Intergenic
1181545286 22:23598943-23598965 GAATGAGGCAGAGCTAGCTCAGG - Intergenic
1181625377 22:24119183-24119205 GGTTGGGGCAGAGCCAGCACTGG + Intronic
1181815023 22:25430952-25430974 GAGTGAGGCAGAGCCAGCTCAGG + Intergenic
1182016695 22:27046351-27046373 GGAAGGGGCAGTGCCAGGGCAGG - Intergenic
1183011369 22:34949675-34949697 GTGAGGGGCGGAGCCAGGTCAGG - Intergenic
1183978267 22:41525539-41525561 GAACTGGGCAGAGCTAGATCTGG + Intronic
1184045546 22:41970392-41970414 GCAAGGGGCAGAGCTAGGGCTGG - Intergenic
1184614121 22:45626341-45626363 GAGAGGGGCTGAGCCAGCCGTGG + Intergenic
1184688742 22:46108050-46108072 GAATGTGGCAGTGCCCGCTCCGG - Intronic
1185270230 22:49926581-49926603 GCAAGAGGCAGGGCCAGCCCAGG - Intronic
1185373659 22:50472184-50472206 GAAAGGGTCACGGCCAGCACAGG + Intronic
949332233 3:2935190-2935212 CAAAGGGTCAGACCCATCTCAGG - Intronic
949503172 3:4701472-4701494 GACAGGAGCAGAGGCAGCCCGGG - Intronic
950103932 3:10376637-10376659 GACAGAGGAAGAGCCTGCTCAGG + Intronic
950194435 3:10999214-10999236 GAAAGGGGCTTGGTCAGCTCAGG - Intronic
953021859 3:39119678-39119700 CAGAGGGGCAGTGCCAGCTCTGG + Intronic
953371346 3:42391123-42391145 GAAAGGGGCCCAGATAGCTCAGG - Intergenic
953968370 3:47327711-47327733 GCAATGGACAGAGCAAGCTCAGG + Intronic
954214337 3:49116075-49116097 GTAAGAGGCAGAGTCAGCGCTGG - Exonic
954267902 3:49484574-49484596 GTAAAGGGCACAGGCAGCTCAGG - Intronic
954382126 3:50225107-50225129 GAGAGGGGCAGAGCCAACAGTGG + Intergenic
954426447 3:50445868-50445890 AGAAGGGCCAGAGCCTGCTCAGG - Intronic
955473173 3:59308200-59308222 GAAGGTGGCAGAGCCTGTTCAGG + Intergenic
956750724 3:72342042-72342064 GAAAGGGTCAGAGCCATCTGGGG + Intergenic
957039598 3:75327149-75327171 GAGAGGGGCTGAGCCAGCAGAGG + Intergenic
960713432 3:120553683-120553705 GGTAGGGGCAGAGCCAGGTTTGG - Intergenic
961054610 3:123777634-123777656 GAAGGGGCCTGAGCCAGCTTGGG + Intronic
961495475 3:127288106-127288128 GTAAGGGGCGGGGCCAGCTGGGG + Intergenic
961742743 3:129043900-129043922 GAAAGGGACAGATCCAGATCCGG + Intergenic
962993586 3:140602874-140602896 GAAAAGTGCTCAGCCAGCTCTGG + Intergenic
963064886 3:141255789-141255811 GAAAGGGGGAAAGGGAGCTCTGG + Intronic
963721037 3:148862245-148862267 GAAAGGCTCAGAGCCTGCTCTGG - Intergenic
967198397 3:187049447-187049469 GGAAGGGGCAGAACCAGGTTGGG + Intronic
968046822 3:195628826-195628848 GAAAGGGGCAGAACAAGCTGGGG + Intergenic
968056185 3:195693812-195693834 GAGATGGGCAGATTCAGCTCTGG + Intergenic
968307833 3:197661218-197661240 GAAAGGGGCAGAACAAGCTGGGG - Intergenic
968582249 4:1400555-1400577 GCTGGGGGCAGTGCCAGCTCTGG - Intergenic
969137899 4:5045201-5045223 GAGAGGTACAGAGCCCGCTCAGG - Intergenic
969138507 4:5050328-5050350 GTAAATGGTAGAGCCAGCTCTGG + Intergenic
969564834 4:7971550-7971572 GGAAGTGGCAGAGCCAGACCTGG + Intronic
970348926 4:15181413-15181435 GAAAGGGCCAGCAACAGCTCTGG + Intergenic
970370014 4:15396845-15396867 GAAAGGGACACAGGCAACTCAGG + Intronic
970758521 4:19455273-19455295 GTAAGAGGCAGAGCCACCTGAGG + Intergenic
970839779 4:20453906-20453928 GAAAGTGGCAGAGCCAGATGTGG + Intronic
971121459 4:23709731-23709753 GAAAAGGGCAAAGCCAAATCAGG - Intergenic
972180922 4:36464390-36464412 GTAAGTGGCAGAGCCAGCTTTGG + Intergenic
972637267 4:40895454-40895476 GAATTGGCCACAGCCAGCTCTGG - Intronic
972733408 4:41817055-41817077 GAAAGAGATAGAGCAAGCTCAGG + Intergenic
975263723 4:72336516-72336538 GAAAAGGAAAGAGCCTGCTCAGG + Intronic
976947850 4:90792492-90792514 GAAAGAAGCTGAGCCATCTCTGG - Intronic
977294312 4:95193897-95193919 GAAAGGAGCAAAGCCAGGCCGGG - Intronic
977360421 4:95997442-95997464 GAAAGGAGCAGAGCAAGCTCTGG + Intergenic
977360557 4:95999183-95999205 GAAGGGAGCAGAGCAAGCTCTGG + Intergenic
981711263 4:147710799-147710821 TGAAGGAGCTGAGCCAGCTCAGG + Intergenic
985619919 5:948839-948861 GCACAGGGCAGGGCCAGCTCGGG - Intergenic
985744788 5:1640319-1640341 GAAAGGGGCAGAACAAGCTGAGG - Intergenic
985788325 5:1911517-1911539 GAAAGGAGCAAAGCCAGCTGGGG - Intergenic
985822083 5:2167214-2167236 GAGTGGGGCAGAACCAGCTGGGG - Intergenic
986460239 5:7962868-7962890 GACAGGGGCAGGGGCAGCGCTGG + Intergenic
987461135 5:18212029-18212051 GAATGGGGCAGAACATGCTCAGG - Intergenic
988110359 5:26812175-26812197 GAAAGAGGCAAAGGCAGCTAGGG + Intergenic
989147801 5:38265754-38265776 GACCCGCGCAGAGCCAGCTCTGG - Intronic
990490591 5:56299367-56299389 GAAAAGGGCAAAGGCAGCCCAGG + Intergenic
991984650 5:72272219-72272241 TAAAGGGGAAGAGCCATATCAGG + Intronic
992222814 5:74589596-74589618 GAGAGGGGTAGAGCAAACTCTGG + Intergenic
994759600 5:103836382-103836404 GTGAGTGGCAGAGCCAGCACTGG + Intergenic
995186880 5:109281134-109281156 TAAAGGGGCAAAGCCAGGTGGGG - Intergenic
995477241 5:112560653-112560675 GAAGAAGGCAGAGCCAGCTCAGG - Intergenic
996088673 5:119329401-119329423 CACAGGGGCAGAGACTGCTCAGG - Intronic
996765418 5:127030613-127030635 GCTAGGGGCGGAGCCAGCCCCGG + Exonic
998414983 5:141939708-141939730 GCAAGTGGCAGAGCCAGACCTGG - Exonic
999247668 5:150163831-150163853 GCAAGGGGCAGAGCAGGCCCTGG - Intergenic
999271003 5:150296414-150296436 GAAGGAGGCAGAGCCAGGGCTGG + Exonic
999312666 5:150561835-150561857 GAAAAGGGCAGAGCCAGGCTCGG - Intergenic
1000241010 5:159408039-159408061 GAATGGGGCAGACCCCTCTCTGG - Intergenic
1000634039 5:163623068-163623090 GAAAGTGGAAGAGCCAGCCCTGG - Intergenic
1001218898 5:169882477-169882499 CACAGGGGCAGAGACAGCTTTGG - Intronic
1001424919 5:171616634-171616656 GCAAGGGCCAGAGCCAGGACAGG - Intergenic
1001856469 5:175015039-175015061 GAAGGAGGCAGAGGCAGCCCTGG + Intergenic
1003146437 6:3514312-3514334 GAAGGGTGCAGAGGAAGCTCAGG + Intergenic
1004469952 6:15920320-15920342 GACAGGGGCAGAGTGGGCTCCGG - Intergenic
1004477334 6:15986104-15986126 GACAGGCTCACAGCCAGCTCTGG + Intergenic
1005991096 6:30902650-30902672 GAGAGGAGCAGAGGCAGATCTGG - Intergenic
1006073736 6:31516053-31516075 GGAAGGGGAGGAGCCAACTCTGG + Intergenic
1006408094 6:33856718-33856740 GAAAGGGGCTGAGAGATCTCTGG + Intergenic
1006642327 6:35495865-35495887 GGTAGGGGCAGAACCAGGTCAGG - Intronic
1006983492 6:38163303-38163325 GAAGTGGGCAGGGGCAGCTCAGG - Intergenic
1007116267 6:39345407-39345429 GAAAGGGAAAGAGCCAGCCCAGG - Intronic
1007386097 6:41521136-41521158 GCAAGGGGCAGAGCCAGAACTGG - Intergenic
1007636030 6:43300345-43300367 GATAGGGGCAGGGCCAGCATGGG + Intronic
1008731962 6:54493462-54493484 AAAAGCAGCAGAGCCAGCTCAGG - Intergenic
1008931469 6:56944921-56944943 GGAAGGGGCAGAGCCAGCCATGG - Intronic
1012131337 6:95497259-95497281 GCAAGGGGCAGTGCCCGCTGGGG - Intergenic
1013092606 6:106913891-106913913 GAAAGCGGCAGAGCCAGATTTGG + Intergenic
1014287120 6:119512971-119512993 GTAAGGTGCAGAGCTAGGTCAGG - Intergenic
1014787776 6:125638009-125638031 CAATGGAGCAGAGCCAGCTGAGG + Intergenic
1016063531 6:139655262-139655284 GAATGTGGCAGAGCCAGAACTGG + Intergenic
1018929709 6:168233050-168233072 GAAAGTGGCAGAACCAGAACCGG + Intergenic
1019316282 7:388441-388463 GAAGGGGACAGAGCTGGCTCTGG + Intergenic
1019364712 7:627478-627500 GCAAAGGGCAGAGCCAGGTGCGG + Intronic
1019505658 7:1389172-1389194 GAGAGGGGCAGGGGCAGCGCCGG + Intergenic
1019536840 7:1533752-1533774 GAGAGGGGCAGGGGCAACTCCGG + Intronic
1019716686 7:2542479-2542501 GAGAGGGGCAGTGCCCGCTCAGG + Intronic
1021968024 7:25941200-25941222 CAGAGGGTCAGAGCCAGGTCTGG - Intergenic
1022504469 7:30901969-30901991 GAAAGGGGAAGAGGCATCACAGG - Intergenic
1022957756 7:35397182-35397204 GCAGGGGGAAGAGCAAGCTCTGG - Intergenic
1023452372 7:40301523-40301545 GAAAGGTGCAAAGCCAGGTGTGG - Intronic
1023990962 7:45127944-45127966 GAAAATGGCATAGCTAGCTCTGG - Intergenic
1024046771 7:45590498-45590520 GAAAGGGTCAGGGCCAGAGCAGG - Intronic
1024656546 7:51455572-51455594 GTAAGGGGCAGAGCCAGCCGAGG + Intergenic
1026099352 7:67371895-67371917 GACAGGGGCAGACACAGCTCCGG - Intergenic
1026624292 7:71978605-71978627 GGCAGGGGCAGCGCCAGCTGTGG + Intronic
1026856366 7:73757778-73757800 GAAAGGGGCATAGCTAGGTTGGG + Intergenic
1028440374 7:90852749-90852771 GTAAGTGGCAGAGCTCGCTCAGG + Intronic
1030495177 7:110289763-110289785 GAAAGAGGCAGACCCAGGACTGG - Intergenic
1030994399 7:116340777-116340799 GAAAGGGAAAGAGCCAGCACCGG - Intronic
1034263052 7:149769022-149769044 GAACGGGGCCCAGCAAGCTCCGG - Intronic
1034400863 7:150860658-150860680 GAAGGAGGCAGGGCCAGCACCGG - Intronic
1034737965 7:153446601-153446623 GAAAGGGGCAAAGACATCTGTGG - Intergenic
1034760569 7:153668448-153668470 GAGAGGGGCACAGCCTCCTCAGG + Intergenic
1035368177 7:158361837-158361859 GGACTGGGCAGTGCCAGCTCAGG - Intronic
1035400768 7:158564056-158564078 GCGGGGGGCACAGCCAGCTCTGG + Intronic
1035495159 7:159318702-159318724 GCGTGGGGCAGAGTCAGCTCTGG - Intergenic
1035746092 8:1962881-1962903 GAAAGTGGCAGAGCTAGGGCAGG + Intergenic
1035941000 8:3900823-3900845 GAAATGAGAAGAGCAAGCTCTGG - Intronic
1036475315 8:9087802-9087824 GAAAGGGGCAGATTCAGGTAGGG + Intronic
1036787523 8:11697867-11697889 GAAACGGGCCGAGCTGGCTCAGG + Intronic
1038311289 8:26448381-26448403 GGCTGGGGCAGAGCCAGCTAGGG + Intronic
1039506717 8:38057458-38057480 GAAAGGGGCCCAGGCACCTCAGG + Intronic
1039568358 8:38566670-38566692 GAATGCCACAGAGCCAGCTCTGG + Intergenic
1041926468 8:63242424-63242446 GGCAGGGGAAGAGGCAGCTCTGG + Intergenic
1047012271 8:120685180-120685202 CATAAGGGCAGAGCCACCTCAGG - Intronic
1048887291 8:138918566-138918588 GATAGAGGCAGTCCCAGCTCAGG - Intergenic
1048937046 8:139366067-139366089 GCAAGGGGCAGACCCAGCTTTGG - Intergenic
1049148901 8:141021752-141021774 GATAGGTGCAGAGCCAGGTTTGG + Intergenic
1049173447 8:141176506-141176528 GACAGAGGCAGAGCGGGCTCTGG - Intronic
1049241372 8:141539064-141539086 GAAGGGCGCAGGGCCAGCTGAGG + Intergenic
1049544426 8:143222987-143223009 ACAAGGGGCAGCTCCAGCTCAGG - Intergenic
1049548742 8:143246725-143246747 TAAAGGGGCGGGGTCAGCTCGGG + Intergenic
1049725523 8:144143899-144143921 GGCAGGGGGAGGGCCAGCTCTGG + Intergenic
1049786537 8:144453638-144453660 GAAACAGGCAGAGCCAGCTTGGG + Intronic
1049986141 9:953698-953720 GAATGGTGGAGAGGCAGCTCTGG - Intronic
1050318140 9:4424227-4424249 ATCAGGGGCAGAGCTAGCTCTGG - Intergenic
1051986090 9:23089249-23089271 CAATGGGGCTGAGCCAGCCCTGG - Intergenic
1053191741 9:36076943-36076965 GCAAAGGGCAGAGCCAGGGCTGG - Intronic
1053280996 9:36819755-36819777 GAAAGGGCCAGATCTTGCTCAGG - Intergenic
1055383062 9:75730144-75730166 GAAGGGAGGAGAGCCAGCTAAGG + Intergenic
1057951611 9:99373523-99373545 GAAAGCAGCAGAGCCTGGTCTGG + Intergenic
1059414881 9:114156247-114156269 GGCGGGGGCAGAGCCAGCCCGGG + Intronic
1059469568 9:114494527-114494549 GAAAGTGGCAGAGCCAGTCTTGG + Intronic
1060899167 9:127242469-127242491 GAAAGGAGCAGACACATCTCAGG + Intronic
1061431373 9:130533403-130533425 CAATGGGGAAGAGCCAGCACTGG + Intergenic
1061519917 9:131111892-131111914 GAGAGGGGCAGGGCCAGGACCGG - Intronic
1062391858 9:136337075-136337097 GAGTGGGGCAGGGCCAGCCCAGG + Intronic
1062395607 9:136351427-136351449 GTGATGGGCAGAGCCAGCTGTGG - Intronic
1203760935 EBV:12801-12823 GAGAGGGGCAGAACCAACCCCGG - Intergenic
1203761864 EBV:15873-15895 GAGAGGGGCAGAACCAACCCCGG - Intergenic
1203762793 EBV:18945-18967 GAGAGGGGCAGAACCAACCCCGG - Intergenic
1203763722 EBV:22017-22039 GAGAGGGGCAGAACCAACCCCGG - Intergenic
1203764651 EBV:25089-25111 GAGAGGGGCAGAACCAACCCCGG - Intergenic
1203765580 EBV:28161-28183 GAGAGGGGCAGAACCAACCCCGG - Intergenic
1203766509 EBV:31233-31255 GAGAGGGGCAGAACCAACCCCGG - Intergenic
1203767438 EBV:34305-34327 GAGAGGGGCAGAACCAACCCCGG - Intergenic
1187270046 X:17771876-17771898 GATATGGGCAGAGGCAGATCAGG - Intergenic
1187420072 X:19126298-19126320 GTAAGTGGCAGAGCCAGGACTGG + Intergenic
1188244671 X:27825274-27825296 GACCAGGGCAGAGTCAGCTCCGG - Intergenic
1188247948 X:27856835-27856857 GACCAGGGCAGAGTCAGCTCTGG - Intergenic
1189607439 X:42695007-42695029 GAGAGTGGCAGAGCCAAGTCTGG + Intergenic
1190453932 X:50607441-50607463 CAAGGGGGCTGAGCCTGCTCAGG + Exonic
1190908404 X:54750330-54750352 GAAAGGGGGACAGCCAGGTTTGG + Intronic
1190916558 X:54815488-54815510 GAGAGTGGCAGTGCCAGCACTGG + Exonic
1192848026 X:74925605-74925627 TGAATGGGCAGAGACAGCTCCGG - Intergenic
1193086409 X:77450801-77450823 GAAAAGGGCAGAGCCTGATGTGG + Intronic
1193424693 X:81327919-81327941 CATAGGGGCAGAGCCACCACTGG + Intergenic
1195460921 X:105123216-105123238 AAAAGGGGCAGAGCCAGAGAAGG + Intronic
1199381937 X:147181589-147181611 GAAAGGAGGAGAGACAGGTCAGG + Intergenic
1199803348 X:151272868-151272890 GAAAGGGGAAGAGAGAGCTTGGG - Intergenic
1200053250 X:153445713-153445735 GGGAGAGGCAGAGGCAGCTCAGG + Intronic
1201190331 Y:11438616-11438638 GCAAGGGCCAGAGCCAGGGCAGG - Intergenic