ID: 1167497423

View in Genome Browser
Species Human (GRCh38)
Location 19:49827800-49827822
Sequence CAGACAGCCCAGAGAGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 615
Summary {0: 1, 1: 0, 2: 3, 3: 61, 4: 550}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167497410_1167497423 25 Left 1167497410 19:49827752-49827774 CCCCGTCTCTGGCTGGGAAGGTG 0: 1
1: 0
2: 0
3: 21
4: 200
Right 1167497423 19:49827800-49827822 CAGACAGCCCAGAGAGGGGAGGG 0: 1
1: 0
2: 3
3: 61
4: 550
1167497418_1167497423 -6 Left 1167497418 19:49827783-49827805 CCAGGACTGATTTGGAGCAGACA 0: 1
1: 0
2: 1
3: 7
4: 99
Right 1167497423 19:49827800-49827822 CAGACAGCCCAGAGAGGGGAGGG 0: 1
1: 0
2: 3
3: 61
4: 550
1167497411_1167497423 24 Left 1167497411 19:49827753-49827775 CCCGTCTCTGGCTGGGAAGGTGA 0: 1
1: 0
2: 4
3: 27
4: 251
Right 1167497423 19:49827800-49827822 CAGACAGCCCAGAGAGGGGAGGG 0: 1
1: 0
2: 3
3: 61
4: 550
1167497412_1167497423 23 Left 1167497412 19:49827754-49827776 CCGTCTCTGGCTGGGAAGGTGAA 0: 1
1: 0
2: 0
3: 23
4: 226
Right 1167497423 19:49827800-49827822 CAGACAGCCCAGAGAGGGGAGGG 0: 1
1: 0
2: 3
3: 61
4: 550
1167497409_1167497423 26 Left 1167497409 19:49827751-49827773 CCCCCGTCTCTGGCTGGGAAGGT 0: 1
1: 0
2: 1
3: 22
4: 184
Right 1167497423 19:49827800-49827822 CAGACAGCCCAGAGAGGGGAGGG 0: 1
1: 0
2: 3
3: 61
4: 550

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167497423 Original CRISPR CAGACAGCCCAGAGAGGGGA GGG Intronic
900031098 1:373727-373749 CAGCCAGGCCAGGAAGGGGAGGG + Intergenic
900051667 1:601981-602003 CAGCCAGGCCAGGAAGGGGAGGG + Intergenic
900241812 1:1620854-1620876 AAGACAGCCCCCAGTGGGGATGG + Intronic
900399393 1:2466834-2466856 CAGACAGGGCAGGGAGGCGAGGG + Intronic
900487675 1:2931158-2931180 CACACAGGCCTGGGAGGGGACGG + Intergenic
900607605 1:3530866-3530888 CCGACAGCCCTGAGAGGGGACGG + Intronic
900623988 1:3599872-3599894 CAGGCAGCCCAGAAAGGGTTAGG + Intronic
900810824 1:4800307-4800329 CTGGGAGCCCCGAGAGGGGAAGG + Intergenic
901056144 1:6449368-6449390 GAGGAGGCCCAGAGAGGGGAGGG - Intronic
901142601 1:7044678-7044700 AAGGTCGCCCAGAGAGGGGAGGG - Intronic
901469845 1:9448636-9448658 CAGGCAGCCCAGGGAGTGGGAGG + Intergenic
901480353 1:9520739-9520761 CAGGAAGCACAGGGAGGGGAAGG - Intergenic
901557898 1:10046089-10046111 CATTCTGGCCAGAGAGGGGAGGG + Intronic
901658875 1:10786378-10786400 CAGGCAGGCCAGAGAGGTAAAGG + Intronic
901869676 1:12130582-12130604 ATCACAGGCCAGAGAGGGGAGGG + Intronic
902404354 1:16174786-16174808 GGGAAAGACCAGAGAGGGGAGGG - Intergenic
902817194 1:18923035-18923057 CACACGGCTCAGAGCGGGGAAGG + Intronic
903233494 1:21935877-21935899 GAGGCTGCCCAGAGTGGGGATGG + Intronic
903275607 1:22219410-22219432 CAGCCTGGCTAGAGAGGGGATGG - Intergenic
903277814 1:22232943-22232965 AAGACAGCCCATGGAGGGGGAGG - Intergenic
903420253 1:23213852-23213874 CAGAAAGCAGAGAGAGGGGCTGG - Intergenic
903972737 1:27129640-27129662 GATGAAGCCCAGAGAGGGGACGG + Intronic
904182018 1:28672702-28672724 CACCCAGGCCAGAGTGGGGAGGG - Intronic
904479654 1:30785934-30785956 CAGAAGGCCTTGAGAGGGGAGGG - Intergenic
904617516 1:31757958-31757980 CAGTCAGGCCAGAGTGGGTAAGG + Intronic
905170398 1:36106537-36106559 CAGGAAGCCGAGGGAGGGGAGGG + Intronic
905630498 1:39515504-39515526 GAGCCAGCCCCGAGAGGTGAGGG + Intronic
905667263 1:39770685-39770707 GAGCCAGCCCCGAGAGGTGAGGG - Exonic
905869705 1:41396162-41396184 CAGGCAGCCAGGAGAGGTGATGG - Intergenic
905914385 1:41674845-41674867 CACAAAGCCCTGAGAGGGGCGGG + Intronic
906554814 1:46701228-46701250 CAGAAAGCCCCGTGAGGGCATGG - Intronic
907312178 1:53544958-53544980 AAGGCAGCCCAGAGAGGGCAAGG + Intronic
907451046 1:54546087-54546109 TAGAAAGCGCAGAGAGGAGAGGG + Intronic
907476795 1:54711197-54711219 CACACAGCCCAGAGAGAGAGGGG + Intronic
907522499 1:55033366-55033388 GGAACAGCCCAGAGATGGGAAGG - Intergenic
907586533 1:55622922-55622944 CAAACAGCTCAATGAGGGGAAGG - Intergenic
907963698 1:59308420-59308442 CAGACAGCACAGAGAGGGACAGG + Intronic
908609919 1:65846238-65846260 GAGAAAGCACAGAGAGAGGAGGG + Intronic
909698965 1:78499235-78499257 AAGATAGCCCAGATAGAGGAGGG - Intronic
909702940 1:78547979-78548001 CAGAAATCTCAGAGAGGGGAGGG - Intergenic
910521227 1:88124384-88124406 CAGTCAACCCAGAGAAGGCAAGG - Intergenic
910663263 1:89696458-89696480 CAGACAGAGGGGAGAGGGGAAGG + Intronic
910976329 1:92910003-92910025 CAGGCAGCTAAGAGACGGGAAGG + Intronic
911327145 1:96481463-96481485 TAGAAAACCCAGAGAGAGGAGGG - Intergenic
911972399 1:104454455-104454477 CAGAGCTCCCAGAGAGGGGCAGG - Intergenic
912498281 1:110105460-110105482 CACACAGCCCAGAGTGCAGACGG + Intergenic
913149347 1:116025199-116025221 AAGAAAGCCCAGAGGAGGGATGG - Intronic
913943619 1:125135246-125135268 CATACAGCTCAAAGAGGAGAAGG + Intergenic
914446640 1:147756497-147756519 CAGAGGGCCCAGAGATGGGCAGG + Exonic
914790973 1:150876859-150876881 CAGCCAGTCCAGTGAAGGGAGGG + Intergenic
914833289 1:151186623-151186645 TAGACAGCCAAGAGGGAGGAAGG + Intronic
914859090 1:151372002-151372024 GAGCCAGCCCCGAGCGGGGAAGG + Intronic
915068915 1:153249429-153249451 CACAGAGCCCAGAGTGGGGTAGG + Intergenic
915331876 1:155117740-155117762 GAGACAGTGCAGAGAGGGGTGGG - Intergenic
915805782 1:158848006-158848028 CAGAGAGTCCAGCGAGTGGAAGG + Intronic
915978993 1:160408581-160408603 CACTCAGCCCAGTGAGGAGAAGG + Intronic
916268911 1:162919426-162919448 CCCACAGCCCAGGAAGGGGATGG + Intergenic
916463921 1:165054164-165054186 TAGAGAGCCCAGTGAGGGTAGGG - Intergenic
918125546 1:181580440-181580462 CAGAGAGGCCAGGGAGGAGAGGG + Intronic
918187471 1:182141083-182141105 AAAACAGCACAGAGAAGGGAAGG + Intergenic
918374753 1:183897920-183897942 CTGACAGCTCACAGAGGAGAAGG + Intronic
919976306 1:202615299-202615321 CAGTGGGCCCAGAGAGTGGATGG + Intronic
920184282 1:204150922-204150944 CAGGCAGCCCACAGCGGGGCTGG + Intronic
920302402 1:204997068-204997090 CAGGCAGCCCGGTGAGGAGACGG - Intronic
920388863 1:205586413-205586435 TCAGCAGCCCAGAGAGGGGAAGG - Intronic
920966385 1:210704944-210704966 CACAAACCCCAGAGAAGGGAAGG - Intronic
921220781 1:212972209-212972231 AAGACACCCAGGAGAGGGGAAGG + Intronic
922860408 1:228811466-228811488 CAGAGAGCCCAGAGAAAGGGGGG - Intergenic
922905740 1:229172337-229172359 CAGGTAGGGCAGAGAGGGGAGGG + Intergenic
922908997 1:229199696-229199718 CAGGCAGGCCAGAGAAGGGAAGG - Intergenic
923575718 1:235157272-235157294 CAGACTGACCAGAGCAGGGAAGG + Intronic
924085228 1:240444357-240444379 CAGACAGTCCAGAGAGCTAAGGG + Intronic
924234701 1:241990969-241990991 CAGACAAGCCAGGGAGGGCAAGG + Intergenic
924527059 1:244863005-244863027 AAGAGAGCGCAGAGAGGGGGAGG + Intronic
1065307835 10:24385097-24385119 CAGGCAGCACAGAAAGGGGAGGG + Intronic
1066230149 10:33424259-33424281 CAGTCAGACCATAGAGAGGATGG - Intergenic
1067072257 10:43141869-43141891 GAAACAGACCAGAGAGGGAAGGG - Intronic
1067289517 10:44931127-44931149 CAGACAGACTGGAGAGGGAAGGG + Intronic
1067793024 10:49301935-49301957 AAGACAGCCCAGAGTGGGGTGGG - Intronic
1069051736 10:63802558-63802580 AAAACAGCCCAGAGATGGGCTGG - Intergenic
1069716328 10:70523556-70523578 TAGGCAGCTCAAAGAGGGGAGGG - Intronic
1069797025 10:71060086-71060108 CAGACAGCGCAGTGGGGGCAGGG - Intergenic
1069828832 10:71270563-71270585 TAGGGAGCCCAGAGAGAGGAAGG + Intronic
1069959005 10:72068623-72068645 CAGACAGCTAACACAGGGGAAGG - Intronic
1070425866 10:76286505-76286527 CTGAGTGACCAGAGAGGGGATGG + Intronic
1070462369 10:76682774-76682796 CAGACACCACTGAGTGGGGAAGG + Intergenic
1070791273 10:79190918-79190940 AACAGAGGCCAGAGAGGGGAGGG - Intronic
1070960756 10:80498682-80498704 CAGACAGAGCAGAGATGTGAGGG - Intronic
1072735488 10:97876227-97876249 CATACAGCCCAGACAGACGAAGG - Intronic
1073096552 10:100983695-100983717 CAGACAGGCCACATAGAGGAGGG - Exonic
1073099868 10:101000732-101000754 GAGTGGGCCCAGAGAGGGGAGGG + Exonic
1076923862 10:133471504-133471526 GAGACAGCCCAGAGGGAGGAAGG - Intergenic
1077065152 11:637766-637788 CAGACAGCGCAGCGGGTGGAAGG - Intronic
1077214185 11:1388523-1388545 CAGACAGCCCAAAGAGCAGGAGG + Intergenic
1077309472 11:1882014-1882036 CAGCCAGCCCCGAGGGAGGAAGG - Intronic
1077842484 11:5990787-5990809 AAGACAGCCCAGAGACCAGAAGG - Intergenic
1078196729 11:9142918-9142940 CCCACAGCCCAGAGTTGGGAGGG + Intronic
1078736774 11:14027445-14027467 CTGACAGTCCTGAGAAGGGATGG - Intronic
1079315524 11:19404947-19404969 CAGAGAGCACAGAGAGAGGAGGG - Intronic
1079723185 11:23845773-23845795 CAGACAGCCCAGCATGGAGATGG - Intergenic
1081083056 11:38767335-38767357 GAGAGAGCCCTGAGATGGGATGG + Intergenic
1081735058 11:45397000-45397022 CAGTGTGCCCAGAGAGGGCATGG - Intergenic
1083163685 11:60870895-60870917 CATCCAGCACAGAGACGGGATGG - Intronic
1083626124 11:64072985-64073007 CCTGCAGCCCAGAGAGGGGTCGG + Intronic
1083731029 11:64652778-64652800 CAGGATGGCCAGAGAGGGGAAGG + Intronic
1083989510 11:66238199-66238221 CAGGAAGACCAGAGAGGAGAAGG + Intronic
1084110377 11:67010490-67010512 CACAGAGCCCAGGGAGGGGTGGG - Intronic
1084264147 11:67996256-67996278 CAGGCAGTCCAGGGAGGGCAGGG - Intronic
1084266528 11:68008136-68008158 CACCCAACCCAGAGTGGGGAGGG + Intergenic
1084497158 11:69511900-69511922 CAGAAAGCCCAGTGAGGGAGGGG + Intergenic
1084714974 11:70867872-70867894 CAAACAGCCCAGAGATGGATGGG - Intronic
1084972051 11:72777361-72777383 CAAGCAGCCCAGAGAGGGGCAGG + Intronic
1085398598 11:76220626-76220648 ACTATAGCCCAGAGAGGGGAAGG - Intergenic
1085446215 11:76602843-76602865 CAGAGAGCGCAGAGAGGGCCAGG - Intergenic
1085446827 11:76606389-76606411 GAGACAGCCAAGGGAGGGGGCGG - Intergenic
1085566986 11:77523067-77523089 TAGACAGCTGAGAGAGGGAAAGG + Intronic
1085782224 11:79419822-79419844 CTGAAGGCCCAGAGAAGGGAAGG - Intronic
1088342899 11:108788996-108789018 GGGCCAGCCCAGAGAGGGTACGG - Intronic
1088351405 11:108892332-108892354 CAGACCGCCTCCAGAGGGGAAGG - Intronic
1088472404 11:110200328-110200350 AAGACAGACCAGAGAGAGTAGGG - Intronic
1088582619 11:111330633-111330655 CTGCCAGCCCAGACAGGGGCTGG + Intergenic
1089100452 11:115958443-115958465 CATGCTGCCCAGGGAGGGGAGGG - Intergenic
1089138171 11:116266032-116266054 CCACCAGCCCAGAGAGGGGAAGG - Intergenic
1089662209 11:119992997-119993019 CAAAGAGCCCACACAGGGGAGGG + Intergenic
1090266825 11:125358701-125358723 CAGTTAGCCCAGGGAGAGGAAGG - Intronic
1090363422 11:126188363-126188385 CAGAAAGCCCAGGGAGGGGGAGG - Intergenic
1091215811 11:133900853-133900875 CAGACCGCTCATAGAGGGCATGG - Intergenic
1091284794 11:134402559-134402581 CTGACACCCCAGAGGAGGGAGGG - Intronic
1092123086 12:6057951-6057973 CCGCCAGCCCAGAGGGGGTAAGG + Exonic
1092495088 12:8985736-8985758 CAGCCTTCCCAGAGAGGGCATGG - Intronic
1092929402 12:13300967-13300989 CAGACATCCCACAGAGTGGGGGG + Intergenic
1093528526 12:20133866-20133888 CAGAAAGAACAGAGAGGGGCAGG + Intergenic
1096521815 12:52188787-52188809 CACACAGACAACAGAGGGGATGG - Intronic
1096882325 12:54683040-54683062 TAGACAGCCCAGAGGAGGGAAGG + Intergenic
1097013390 12:55968616-55968638 CTGTCAGCCCAGAGAGGATAAGG - Intronic
1097371280 12:58784499-58784521 CAGACAACCCACAGAGTGGGAGG + Intronic
1097501733 12:60411580-60411602 AAGTCAGGCAAGAGAGGGGAGGG - Intergenic
1097761759 12:63474283-63474305 CAGAGATTCCAGAGGGGGGAGGG - Intergenic
1102023537 12:109700066-109700088 AAGACATCCCAGAGACGGGGAGG + Intergenic
1102024809 12:109708404-109708426 CAGGAGGCCCAGAGAGGGGAGGG - Intergenic
1102416549 12:112767634-112767656 AGGACAAACCAGAGAGGGGAAGG - Intronic
1102780613 12:115561444-115561466 CAGCCAGCCCAGGGAGGAGCAGG + Intergenic
1103664494 12:122552233-122552255 CTGACAGACCAGGGAGGGGAAGG + Intronic
1103827038 12:123747288-123747310 CACACAGCTCAGAGACTGGAAGG - Intronic
1104595978 12:130120197-130120219 TCGCCAGCCCAGACAGGGGACGG - Intergenic
1105402069 13:20104935-20104957 CAGCCTGCCCAGAGAGTGCAGGG + Intergenic
1105991276 13:25623994-25624016 CTTACAGCCCAGGAAGGGGAAGG - Intronic
1106776445 13:33015107-33015129 CAGAAAGCCCAGACAAGTGAAGG - Intergenic
1107423860 13:40274359-40274381 CAGGGAGCCCAATGAGGGGAGGG - Intergenic
1107440478 13:40422980-40423002 CAGACTCCCCAGAGGGAGGAGGG - Intergenic
1110119836 13:71866820-71866842 CACACACCCCCGGGAGGGGAAGG + Intronic
1111445958 13:88345858-88345880 CGACCAGCCCAGAGAGGGGCTGG + Intergenic
1112227349 13:97552877-97552899 CAGAAAGCCAAGAGACAGGACGG + Intergenic
1113618010 13:111694752-111694774 GAGACAGCGGAGAGAGGAGAGGG - Intergenic
1113618021 13:111694811-111694833 GAGACAGCGGAGAGAGGAGAGGG - Intergenic
1113618067 13:111695046-111695068 CAGAGAGCAGAGAGAGGAGAGGG - Intergenic
1113618075 13:111695109-111695131 CAGAGAGCGGAGAGAGTGGAGGG - Intergenic
1113623543 13:111780013-111780035 GAGACAGCGGAGAGAGGAGAGGG - Intergenic
1113623554 13:111780072-111780094 GAGACAGCGGAGAGAGGAGAGGG - Intergenic
1113623600 13:111780307-111780329 CAGAGAGCAGAGAGAGGAGAGGG - Intergenic
1113623608 13:111780370-111780392 CAGAGAGCGGAGAGAGTGGAGGG - Intergenic
1113793843 13:113045392-113045414 CATGCAGCCCAGGGAGGGGCCGG - Intronic
1116747063 14:48833763-48833785 CAGACAGCTCTGACAGGGGAAGG - Intergenic
1117267116 14:54100849-54100871 CAGAGCACCCAGAGAGGGGATGG - Intergenic
1117616203 14:57536191-57536213 CAGAGAGTGAAGAGAGGGGAAGG - Intergenic
1117912671 14:60649598-60649620 CGCACCGCCCAGAGCGGGGAGGG + Intronic
1118033503 14:61840977-61840999 CAGTCACCCAAGTGAGGGGAAGG + Intergenic
1118280172 14:64421086-64421108 CAGACATGACAGAGAGGAGATGG - Intronic
1118858565 14:69643649-69643671 CAGACAGCCGTGTGTGGGGAGGG + Intronic
1119846535 14:77834706-77834728 CAGGCAGCCCACATAGGTGAGGG - Intronic
1119858565 14:77920034-77920056 CAGACAATCCACAGAGTGGAAGG - Intronic
1119892279 14:78191864-78191886 CACACAGCTCAAAGAGGGGAAGG - Intergenic
1121050133 14:90815031-90815053 CAGACTACCCAGAAAGGAGAGGG - Intronic
1121255537 14:92527887-92527909 CAAACAGGCCTGAGCGGGGAAGG - Intronic
1121331655 14:93053372-93053394 CAGGCAGCCGGGAGAGGGGCGGG - Intronic
1121334810 14:93070735-93070757 CAGACATCACAGAGAGTTGAAGG + Intronic
1121667386 14:95683791-95683813 CAGACAGCCTAGACAGGGCATGG - Intergenic
1121794435 14:96723690-96723712 TAGCCAGCCCAGAGCTGGGAAGG - Intergenic
1121837477 14:97105157-97105179 CATCAAGGCCAGAGAGGGGATGG - Intergenic
1121914963 14:97830383-97830405 CAGAGAGCTTTGAGAGGGGAAGG - Intergenic
1122145755 14:99688018-99688040 CAGAGGGCACAGAGAGGGGTGGG - Intronic
1122307066 14:100773023-100773045 AAGACACCCCAGGGAGGAGAAGG + Intergenic
1122425190 14:101601679-101601701 CAGAAGGCTCAGAGAGGTGAGGG - Intergenic
1122616575 14:103022081-103022103 AAGTCAGCAGAGAGAGGGGAGGG + Intronic
1122648920 14:103214425-103214447 GAGACAGTGCAGAGTGGGGAGGG + Intergenic
1122659728 14:103287332-103287354 CACACAGCACAGAGTGAGGATGG - Intergenic
1122859992 14:104578214-104578236 CAGGGAGCACAGAGAGGGGGCGG + Intronic
1123063407 14:105604699-105604721 CAGCCAACCCAGAGCTGGGAGGG - Intergenic
1123087469 14:105723485-105723507 CAGCCAACCCAGAGCCGGGAGGG - Intergenic
1123207198 14:106725047-106725069 CATACAGCCCAGATAAAGGAGGG + Intergenic
1123212222 14:106772050-106772072 CATACAGCCCAGATAAAGGAGGG + Intergenic
1124095019 15:26641366-26641388 AAGGCATCCCAGAGAGGTGAGGG - Intronic
1124491953 15:30163650-30163672 CAGTGGGCCCAGAGAGTGGATGG + Intergenic
1124751584 15:32374667-32374689 CAGTGGGCCCAGAGAGTGGATGG - Intergenic
1125334532 15:38614459-38614481 CTGGAAGCCCATAGAGGGGAAGG - Intergenic
1127647345 15:60971879-60971901 CAGACAGCCCAATGGTGGGAGGG - Intronic
1127864267 15:63019122-63019144 CTGCCAGCTCAGAGATGGGATGG - Intergenic
1127918434 15:63474270-63474292 CAGAAAGCCCAGAGAGGCCTGGG - Intergenic
1128087106 15:64894081-64894103 TAGAGGCCCCAGAGAGGGGAAGG + Intronic
1128112490 15:65085500-65085522 AACACAGCCCAGAGAGCTGAGGG - Intergenic
1128147726 15:65341726-65341748 TAGACAGCACAGACATGGGATGG - Intronic
1128326337 15:66726348-66726370 CAGACTGCACAGAGAGGCCAAGG + Intronic
1128347212 15:66862051-66862073 GAGAAACCTCAGAGAGGGGAAGG + Intergenic
1128510574 15:68311604-68311626 AAGAAAGCCCTGAGAGGGGATGG + Intronic
1129249511 15:74301172-74301194 CAGGGTGCCCAGAGAGTGGAGGG - Intronic
1129328976 15:74816996-74817018 CATTGAGCCCAGAGAGGGGAAGG + Intronic
1129361915 15:75029623-75029645 CAGCCAGGCCAGAGTGGGGGAGG + Intronic
1129800320 15:78408954-78408976 CACAGAGACCAGAAAGGGGAAGG + Intergenic
1129822930 15:78616984-78617006 CTGACAGCCCTGAGAGGGCGTGG + Intronic
1130147827 15:81288050-81288072 CAGAGAGGCCACAGAGGTGAGGG + Intronic
1130153181 15:81326809-81326831 TAGACAGACTATAGAGGGGATGG + Intergenic
1130338491 15:82978454-82978476 CAGGTAGACCAGAGTGGGGAGGG + Intronic
1131166556 15:90145850-90145872 CAGAGAGGCAAGAGAGGGGATGG + Intergenic
1132151846 15:99467609-99467631 CTGGCAGCCAAGTGAGGGGAAGG + Intergenic
1132689101 16:1174568-1174590 CAGACAGCCCTGAGCGTGGCAGG - Intronic
1133801632 16:9090453-9090475 GAGAAAGCCCCGACAGGGGAGGG + Intergenic
1133852350 16:9517346-9517368 CAGACAGCACTGGGAGGTGAAGG - Intergenic
1134765699 16:16755734-16755756 CAGACACCTCAGGGAGGGGAAGG - Intergenic
1134980354 16:18603485-18603507 CAGACACCTCAGGGAGGGGAAGG + Intergenic
1136406936 16:30053513-30053535 GAGGGGGCCCAGAGAGGGGAAGG - Intronic
1136684555 16:31986579-31986601 AAAACAGCCCAGAGAGGGGAAGG + Intergenic
1136770165 16:32830854-32830876 CATACAGCTCAAAGAGGAGAAGG - Intergenic
1136948371 16:34684329-34684351 CACACAGCTCAAAGAGGAGAAGG + Intergenic
1137548212 16:49418538-49418560 GAGACAGACCTGAGAAGGGAAGG + Intergenic
1137561480 16:49505194-49505216 CAAACAGCCAAGAGCTGGGATGG + Intronic
1137600303 16:49751945-49751967 CCCACAGCCCAGGGAGGGCAAGG + Intronic
1137906310 16:52325569-52325591 CAGACAGAGCACAGAGGGAATGG + Intergenic
1138224961 16:55285212-55285234 CAGAACCCCCAGAGAAGGGAAGG + Intergenic
1138630569 16:58291186-58291208 CAGACAGCCCACAGGAGAGAGGG - Intronic
1139192157 16:64877396-64877418 CAGACAACCCACAGAGTGGGGGG - Intergenic
1139442060 16:66973343-66973365 CGCACAGCCCAGAGAAGGCAGGG - Exonic
1139530203 16:67538906-67538928 CAGACAGCAGGGAGAGGGCATGG - Intronic
1139965648 16:70743980-70744002 CAGGCAGCCCAGGCAGGAGACGG - Intronic
1140037933 16:71385207-71385229 GGGACAGCCCAGGGAGGGGTGGG - Intronic
1140039300 16:71395256-71395278 AAGACAGACCAGAGAGGGAGTGG + Intergenic
1141890970 16:86926308-86926330 CAGACAGCTCGGTGAGGGGCCGG - Intergenic
1203072585 16_KI270728v1_random:1092961-1092983 CATACAGCTCAAAGAGGAGAAGG - Intergenic
1142900731 17:3009850-3009872 CAGACAACCCAGCGAGAGAATGG + Intronic
1143499627 17:7330977-7330999 CAGCCAGCCCAGAGTCGGGAGGG + Intergenic
1143688396 17:8538605-8538627 GAGATAGCTCAGAAAGGGGAGGG - Intronic
1143743254 17:8969706-8969728 CAGAGAGGACAGAGAGAGGAAGG - Intergenic
1143891793 17:10107778-10107800 CACACAGTCCAGTGAGGGGCTGG + Intronic
1144033407 17:11342165-11342187 CAGAGGACCCAGAGAGGTGAAGG + Intronic
1144208147 17:12993650-12993672 CGGACAGCACAGGGCGGGGACGG - Intronic
1144304701 17:13957732-13957754 CAACAGGCCCAGAGAGGGGATGG - Intergenic
1144402389 17:14918805-14918827 CAAACAGCCCAGGGGTGGGAAGG + Intergenic
1144560249 17:16315412-16315434 CAGAAAGGCCAGAGTGAGGAGGG - Intronic
1144720700 17:17467854-17467876 CGGACAGCACTGAGATGGGAGGG + Intergenic
1145786256 17:27595736-27595758 CAGACAGGCCTGGGAAGGGAGGG - Intronic
1146637882 17:34519514-34519536 GAGACAGCCCAGAGAGATGGGGG + Intergenic
1147145487 17:38482260-38482282 AAAACAGCCCAGAGAGGGGAAGG + Intronic
1147578815 17:41617407-41617429 CAGACAGCTGAGCCAGGGGATGG - Intergenic
1147952934 17:44117151-44117173 CAGACTGCCCAGAGAGATTAAGG + Intronic
1148718220 17:49730937-49730959 CAGACAGCCAAGGGATGAGATGG - Intronic
1148767299 17:50046805-50046827 CACACAGCAGAGAGAAGGGAGGG - Intergenic
1148972758 17:51498634-51498656 CAGAAAGGCCATAGAGGGTAGGG + Intergenic
1149599213 17:57882314-57882336 GAGACTGCCAAGGGAGGGGAGGG + Intronic
1150228248 17:63535332-63535354 CAGACAGGAGAGAGAGGGAAAGG - Intronic
1150378203 17:64699861-64699883 CAGACACCACAGAGATGTGAAGG + Intergenic
1151272946 17:73011095-73011117 ATGACAGCCCAGGGAAGGGAAGG + Intronic
1151322028 17:73358208-73358230 CAGACAGCACACAGAGGCGAGGG + Intronic
1151440953 17:74128781-74128803 CAGAGAGGACAGAGAGGGCAAGG + Intergenic
1151572674 17:74935134-74935156 AAGACAGCAGAGAGATGGGAAGG + Intergenic
1151798722 17:76364560-76364582 CAGAGAGACCTGAGAAGGGAAGG - Intronic
1152835625 17:82528911-82528933 CATACGTCCCAGGGAGGGGAAGG - Intronic
1152948543 17:83211942-83211964 CAGCCAGGCCAGGAAGGGGAGGG - Intergenic
1203183228 17_KI270729v1_random:85809-85831 CACACAGCTCAGAGAGGAGCAGG + Intergenic
1155106046 18:22667358-22667380 GACACAGCCCAGGCAGGGGAGGG + Intergenic
1155140205 18:23037902-23037924 CAGGCAGCCAAGTGAGGAGATGG - Intergenic
1155461779 18:26091129-26091151 CCGGCAGCCCGGAGAGGGGAGGG + Intronic
1156231244 18:35155851-35155873 CAGTCAGCACATGGAGGGGAGGG + Intergenic
1156336836 18:36180055-36180077 CAGACAGACCAGGATGGGGAGGG + Intronic
1156445875 18:37236384-37236406 AGGACAGCCCAGAGGAGGGAAGG - Intergenic
1156578862 18:38351790-38351812 CTGGCTGCCCAGAGTGGGGATGG + Intergenic
1156744475 18:40372235-40372257 TAGACAGTGCAAAGAGGGGAGGG - Intergenic
1157439211 18:47697193-47697215 CAGACAGGACACAGAGGTGAGGG - Intergenic
1157544597 18:48539138-48539160 CAGACCCAGCAGAGAGGGGAGGG - Exonic
1157803885 18:50643845-50643867 CAGACTGCACAGTGAGGTGAGGG - Intronic
1159786908 18:72725759-72725781 CAGACAACCCACAGAGTGGGAGG - Intergenic
1160032239 18:75272107-75272129 TCGACAGAGCAGAGAGGGGAGGG + Intronic
1160058286 18:75507018-75507040 CAGTCATCCCTGAGAGAGGAAGG + Intergenic
1160291725 18:77600902-77600924 GTGGCAGCACAGAGAGGGGAAGG - Intergenic
1160415344 18:78706074-78706096 TTTACAGCCCAGAGAGGTGAGGG + Intergenic
1160455652 18:78997165-78997187 CATGCTGCCCAGAGGGGGGAGGG - Exonic
1160673724 19:377740-377762 CTGGGAGCCCAGAAAGGGGAGGG - Intergenic
1160748782 19:723944-723966 CCCACAGACCAGGGAGGGGAGGG + Intronic
1160849962 19:1185946-1185968 AAAAAAGCCAAGAGAGGGGATGG - Intronic
1161288124 19:3479141-3479163 CTGGGGGCCCAGAGAGGGGAGGG + Intronic
1161485701 19:4534694-4534716 GAAGCAGCCCAGAGAGGTGAAGG - Intronic
1161765114 19:6203228-6203250 CAAACAGCCCAGCTAGGGGAGGG - Intergenic
1161954998 19:7488868-7488890 GAAACGGGCCAGAGAGGGGACGG - Intronic
1162011042 19:7815330-7815352 CCCACAGTCCAGAGAGGGGATGG + Intergenic
1163099695 19:15087337-15087359 GAGGCAGCCCACAAAGGGGATGG - Exonic
1163203678 19:15787051-15787073 CACAAAGCCCACAGAGGGCAGGG - Intergenic
1163585239 19:18160397-18160419 CAGCCAGCAAAGAGAGGGGCTGG + Intronic
1164158220 19:22609557-22609579 CAGAATGCCCAGGGAGCGGAGGG - Intergenic
1164525278 19:29008917-29008939 CAAACAGCCCAAGGAGGGAAGGG - Intergenic
1164782248 19:30902333-30902355 CAGACAGTGCATAGCGGGGAAGG - Intergenic
1164852859 19:31499349-31499371 CCTGCAGCCCAGAGAGGTGAAGG - Intergenic
1164948305 19:32314665-32314687 AATAAAACCCAGAGAGGGGAAGG - Intergenic
1165443777 19:35845629-35845651 AGGCCAGACCAGAGAGGGGAGGG + Intronic
1165760574 19:38319100-38319122 AAGACAGCCCAGAGTGGTCAGGG - Intergenic
1165807252 19:38588064-38588086 CAGACTCCCCAGAGAATGGATGG + Intronic
1165893812 19:39130029-39130051 GTGACAGCCCAGAGAGGCCAGGG + Intronic
1166502746 19:43353621-43353643 CAGCCAGCCCAGAAAAGGGTGGG - Intergenic
1167096213 19:47376247-47376269 CAGACAACCCAGAGTGGGCAGGG + Intronic
1167107019 19:47436288-47436310 CAGACAACCCAGAGTAGGCAGGG - Intronic
1167482968 19:49744524-49744546 CAGTCAGAGCAGAGAGGGGAGGG - Intronic
1167497423 19:49827800-49827822 CAGACAGCCCAGAGAGGGGAGGG + Intronic
1167645818 19:50704226-50704248 CAGGCAGCAGAGAGAGGGCAGGG + Intronic
1167706282 19:51083017-51083039 CAGACAGGGGAGGGAGGGGATGG - Intronic
1167889430 19:52527836-52527858 GAGACAGCCCAGTGAGAGGCCGG + Intronic
1168075267 19:53978030-53978052 CAAGCAGCCCAGAGAGAGAAGGG + Intronic
1202681701 1_KI270712v1_random:11121-11143 CACACAGCTCAAAGAGGAGAAGG + Intergenic
925025440 2:603362-603384 CAAACACCTCACAGAGGGGAGGG - Intergenic
925376857 2:3392347-3392369 CAGACGGCCTAGACAAGGGAAGG + Intronic
926158203 2:10469666-10469688 CCCACAGTCCAGTGAGGGGAAGG + Intergenic
927514761 2:23665714-23665736 CAGACAGAAGAGAGAGGGAAGGG + Intronic
927887115 2:26725382-26725404 AAGTGAGCCCAGAGAGGGGTAGG + Intronic
928205644 2:29281333-29281355 CAGGCTGCCCACAGAGAGGAAGG - Intronic
928324298 2:30307525-30307547 CTGACAGGCCAGAGTAGGGAAGG - Intronic
928359504 2:30651620-30651642 CAGAGAGATCAGAGATGGGAAGG - Intergenic
928720899 2:34119667-34119689 CACACACCCCAGAGAAGGGAAGG + Intergenic
929584603 2:43105901-43105923 CAGACAGACAAGAAAGGGGGAGG - Intergenic
931149019 2:59551945-59551967 CTGACAGCCCAGATCGGGGCAGG + Intergenic
931760922 2:65416364-65416386 CACACTGCCCAGGGACGGGATGG + Intronic
932706672 2:74031318-74031340 CAGACAGGCCAGAGAGACGAGGG + Intronic
934654872 2:96112270-96112292 TGGCCAGCCCAGGGAGGGGAGGG - Intergenic
936461052 2:112714005-112714027 TACACAGCCCAGAGAAGGCAGGG - Intergenic
937316569 2:120935476-120935498 CCCACAGCCCAGAGATGGGGAGG - Intronic
937461102 2:122086873-122086895 CAGACAACCCATAGAGTGGAAGG - Intergenic
937551253 2:123095249-123095271 CAGACAGGCAGGAGATGGGAAGG - Intergenic
937886490 2:126902802-126902824 GTGACAGCCCAGAGAAGGGCAGG + Intergenic
937954815 2:127416238-127416260 CAGGCTGCCCAGAGGGCGGAAGG - Intergenic
938083356 2:128381968-128381990 CAGAGAGTCCAGAGAGGCTAAGG + Intergenic
938264394 2:129916183-129916205 CTGCCAGCCCATAAAGGGGATGG - Intergenic
938410426 2:131059281-131059303 GAGTCAGCTCAGAGAGGGGCAGG + Intronic
938597820 2:132806703-132806725 CAGACAGCCCACAGAGTGGGAGG - Intronic
938983967 2:136554890-136554912 CTGGCAGCCCAGAGTAGGGAGGG + Intergenic
940005574 2:149006812-149006834 CAGGGAGGCTAGAGAGGGGAGGG + Intronic
941830780 2:169956431-169956453 CAGAAAGGGAAGAGAGGGGATGG + Intronic
943212124 2:184980387-184980409 ATGACAGCCCAGAGAGGTCATGG - Intergenic
944221715 2:197310376-197310398 CCGACGGCCCAGGGCGGGGACGG + Intronic
944685258 2:202112320-202112342 CAGCAGGCCCAGAGAGGGCACGG + Intronic
945213744 2:207411863-207411885 CAGAAAGCCCAGACAGGCCAAGG + Intergenic
946715085 2:222545737-222545759 CAGCCACCACAGAGAAGGGAAGG - Intronic
946861800 2:224006958-224006980 CACACAGCCTGGAGAGGTGATGG - Intronic
947874527 2:233459514-233459536 CTGACTGCTCAGTGAGGGGATGG + Intronic
948631280 2:239304228-239304250 CACAAAGCCCAGAGCTGGGAAGG + Intronic
948931931 2:241137508-241137530 GAGACACCCCAGTGAGGGGCCGG + Intronic
1168841094 20:910720-910742 CAGCCATCCCACAGAGGGCAGGG - Intronic
1169001059 20:2168386-2168408 CAGACAGCTCAGAGAGGTCAAGG - Intronic
1169247912 20:4038355-4038377 CAGTCAGCCCAGAGGGCGGGTGG + Intergenic
1169676746 20:8163244-8163266 GAGACAGTGCAGAGAGGAGAGGG + Intronic
1170865776 20:20155476-20155498 CAGACAGCCCACAGAGTGGGAGG + Intronic
1172656678 20:36542123-36542145 GAGATGACCCAGAGAGGGGAAGG - Intronic
1172763127 20:37336093-37336115 CACTCCGACCAGAGAGGGGAAGG + Intergenic
1173500682 20:43550553-43550575 CTGGGAGCGCAGAGAGGGGAGGG + Intronic
1173818393 20:46005026-46005048 CAAACCTGCCAGAGAGGGGAGGG - Intergenic
1174066183 20:47867584-47867606 AAGACAGCCCTGGGAAGGGAGGG - Intergenic
1174407776 20:50313179-50313201 CATAAGACCCAGAGAGGGGAAGG + Intergenic
1174418303 20:50382542-50382564 CAGAAAACCCAGAGATGGCATGG + Intergenic
1174605612 20:51759232-51759254 CCTCCAGCCCAGAGAGGGGAAGG + Intronic
1175030220 20:55945999-55946021 TAGACAGTCCAGAGTGGGTAAGG + Intergenic
1175260964 20:57673869-57673891 AAACAAGCCCAGAGAGGGGAGGG - Intronic
1175365718 20:58454373-58454395 CAGTCAGTCCAGAGAGGAGCAGG - Intergenic
1175853345 20:62105381-62105403 CGGACAGGCCAGTGTGGGGAGGG + Intergenic
1175905610 20:62378008-62378030 AAGGGACCCCAGAGAGGGGATGG - Intergenic
1175987543 20:62771443-62771465 CAGAGACCCCAGAGAGGTCAGGG - Intergenic
1176256293 20:64154837-64154859 CTGGGAGCCCAGAGAGGGAAGGG - Intronic
1176309713 21:5143042-5143064 CAGACAGCTGGGGGAGGGGAGGG + Intronic
1178478177 21:32956049-32956071 CTGACAGCCCAGAGGGGGAAAGG + Intergenic
1178589917 21:33900943-33900965 CACACAGACCAGAGAGTGGATGG + Intronic
1178609035 21:34064412-34064434 CATTTAGCCCAGAGAAGGGAGGG + Intergenic
1178639822 21:34337014-34337036 GTGCCAGCCCAGGGAGGGGAGGG - Intergenic
1179513767 21:41892422-41892444 GATACAGCCCTGGGAGGGGAGGG + Intronic
1179847345 21:44118991-44119013 CAGACAGCTGGGGGAGGGGAGGG - Intronic
1180081491 21:45489747-45489769 CAGACAGCCGGGAGGGAGGAAGG - Intronic
1180619176 22:17148566-17148588 GGGACAGCCAAGACAGGGGAGGG + Intronic
1180725769 22:17945614-17945636 CCTACTGCCCAGGGAGGGGAGGG + Intronic
1180988012 22:19917001-19917023 CAGACAGCCCATAGAGGCACAGG - Intronic
1181886576 22:26026752-26026774 AAGAGAGCCCAGAGAGGCCAGGG + Exonic
1181999124 22:26905713-26905735 CAGAGAGAGAAGAGAGGGGAGGG + Intergenic
1182476973 22:30581704-30581726 CAGACAACCCACAGAGTGGAGGG + Intronic
1182542976 22:31055259-31055281 AAGGAGGCCCAGAGAGGGGAGGG - Intergenic
1182573301 22:31255180-31255202 GAAACAACCCAGAGAGGGAAAGG + Intronic
1182623010 22:31628007-31628029 CAGTGAGCCCAGTGAGGGCAGGG + Exonic
1183009878 22:34936151-34936173 CAGACACCCCACAGAGAGCAAGG - Intergenic
1183334705 22:37240038-37240060 CAGGCAGCCAGGAGAGGGCAGGG - Intronic
1183641598 22:39096245-39096267 CAGATAGCACTGGGAGGGGAGGG - Intergenic
1183740473 22:39666037-39666059 CTGGCATCCAAGAGAGGGGAGGG - Intronic
1183862452 22:40679751-40679773 CCCACAGCCCAGAGGAGGGAGGG - Intronic
1183985637 22:41568771-41568793 CAGAGAGACCAGAGAGCAGAAGG - Intronic
1183987352 22:41576803-41576825 TAAACAGCACAGAGAGGGCAGGG - Intronic
1184373419 22:44097107-44097129 CACACAGCTCAGAGATGGCATGG + Intronic
1184640016 22:45865732-45865754 GAGAAAACCCAGAGAGGGAAAGG - Intergenic
1184739796 22:46421229-46421251 CCAGGAGCCCAGAGAGGGGAGGG + Intronic
1184879616 22:47296683-47296705 CAGACAGCTCTGGGAGGAGAGGG + Intergenic
1185206416 22:49541546-49541568 CTGGCTGCCCAGCGAGGGGAGGG + Intronic
1185331062 22:50252226-50252248 CAGAGAGACCAGTGAGGGGCAGG - Intronic
1185368910 22:50450083-50450105 AGGGCAGCCCACAGAGGGGAGGG + Intronic
950040107 3:9914843-9914865 CTGAGAGCTCAGACAGGGGAGGG - Intronic
950175122 3:10868147-10868169 ATGCCAGCCCAGAGAGGGTATGG + Intronic
950660329 3:14463236-14463258 GAGACTGCCCAGAGAGGTGGGGG - Intronic
950709493 3:14804454-14804476 CCGCCTGCCCAGAGAGGGGCAGG + Intergenic
951098418 3:18658296-18658318 CAGACAGCCCAAGGAGGGGGTGG - Intergenic
953558181 3:43963357-43963379 CAGCCAACCCAGAGAGGAGTTGG + Intergenic
953771386 3:45780677-45780699 CTGAGAGCACAGAGAGGGGTGGG + Intronic
958666174 3:97140323-97140345 CAGAAAGCCCAGAGAGCATATGG + Intronic
960902184 3:122564268-122564290 CAGACAGCACAGGGAGGAGGGGG + Exonic
960985725 3:123279360-123279382 CAGAGGGTCCAGAGAGGGAAGGG - Intergenic
961089215 3:124094982-124095004 AAGACACAGCAGAGAGGGGAGGG + Intronic
961324299 3:126101168-126101190 CAGCCAGCCCGGGGAGGGAAAGG + Intronic
961468049 3:127093222-127093244 CAGACATCCCAGAGATGAAAAGG - Intergenic
961555844 3:127696227-127696249 CAGACAGGCCAGGGAGAGCAAGG - Intronic
961661609 3:128471670-128471692 AATAGAGCCCAGAGAGGGGCAGG + Intergenic
962866750 3:139453552-139453574 CAGAAAGCCCACAGGGTGGAGGG - Intronic
963057709 3:141200963-141200985 CAGACAAGCCAGAGAGAAGAAGG + Intergenic
964081829 3:152768252-152768274 CAGCCTGTCCACAGAGGGGAGGG + Intergenic
964852371 3:161108671-161108693 CAGGCATCTCAGAGAGGAGAGGG - Intronic
965537364 3:169837064-169837086 CAGACAGCCCAGTAAGGAGCAGG + Intronic
966319310 3:178683319-178683341 TAGATGGCACAGAGAGGGGAGGG + Intronic
967062205 3:185882260-185882282 CAGGGTGCCCAGAGGGGGGAGGG + Intergenic
967135492 3:186509535-186509557 CACACAGCTCTGAGTGGGGAGGG + Intergenic
967771764 3:193341577-193341599 CAGACAGCTCAGAGTGGAGTGGG + Intronic
967821285 3:193841693-193841715 GAAGCAGCCCAGAGAGGGAAGGG + Intergenic
967937234 3:194738817-194738839 CAGCCAGCCCCATGAGGGGAGGG + Intergenic
968360651 3:198144582-198144604 CAGAAGGCCCAGGGAGAGGAGGG + Intergenic
968641649 4:1717821-1717843 CAGACAGCCCAGCCTGGGCACGG + Intronic
968657534 4:1785194-1785216 AAGGCATCCCAGAGAAGGGAGGG + Intergenic
968718489 4:2179870-2179892 CAGACAGCCCAGTGACAGGCTGG - Intronic
969121360 4:4913782-4913804 GAAATAGCCCAGAGAGGGAAAGG + Intergenic
969182413 4:5452264-5452286 CAGAGAGGCCAGCGAGTGGAGGG + Intronic
969452995 4:7285630-7285652 CAGACAGCTGGCAGAGGGGATGG + Intronic
969471668 4:7392726-7392748 CAGGCATCACAGAGGGGGGAGGG + Intronic
969520363 4:7674656-7674678 CAGGCAGGGCAGTGAGGGGAAGG + Intronic
970300124 4:14672373-14672395 CATAGAGCCAGGAGAGGGGAAGG + Intergenic
970855053 4:20641483-20641505 CAGACAACCCATAGAATGGAGGG - Intergenic
970929851 4:21496883-21496905 CAGACAGAGCAGGGCGGGGATGG - Intronic
971551540 4:27964256-27964278 CAGACAGACAAGACAGGGAAGGG - Intergenic
971875784 4:32306542-32306564 GAGACAACTCAAAGAGGGGAGGG + Intergenic
973244106 4:47991599-47991621 CAGACAACCCACAGAGTGGGAGG - Intronic
974069367 4:57110205-57110227 CAGGCAGCCCAGCGGGGGCAGGG + Exonic
974383171 4:61169116-61169138 CAGACAACCCACAGAATGGAAGG + Intergenic
975816512 4:78222666-78222688 CAGACAACCCACAGGTGGGATGG - Intronic
977115273 4:93016544-93016566 CCAACTGCCCAGAGAGGGGATGG - Intronic
977881634 4:102211275-102211297 CAGGCAGCAAAGAGATGGGAGGG + Intergenic
981538461 4:145824468-145824490 AACACAGCCCAGAGATAGGAAGG + Intronic
984257953 4:177409677-177409699 GAGACAGCCCAGGGAGGGTGTGG + Intergenic
985313167 4:188626052-188626074 AAGACAAGACAGAGAGGGGACGG - Intergenic
985326013 4:188771108-188771130 CAGACAACCCACAGAGTGGGAGG - Intergenic
986024492 5:3837898-3837920 CAGGCTGCCCAGACTGGGGAAGG + Intergenic
986132380 5:4943129-4943151 AGGAGAGGCCAGAGAGGGGAAGG + Intergenic
986433065 5:7700834-7700856 CAGACAGATCAGAAATGGGAGGG + Intronic
987777237 5:22383851-22383873 CAGTCCTCCCAGAGAAGGGAGGG - Intronic
989101568 5:37828163-37828185 CATTCTGCCCAGCGAGGGGATGG - Intronic
989275447 5:39583311-39583333 AAGACAGACCAGAGAGAGAACGG - Intergenic
992023479 5:72648482-72648504 CAGAAAGCACAGAGAGGCCATGG - Intergenic
992200094 5:74374718-74374740 GAGACAGGGCAGACAGGGGAAGG - Intergenic
992738184 5:79744817-79744839 CAGAAAGCCCAGATATGGAATGG - Intronic
992827217 5:80562385-80562407 TAGACATCCCAGAGAGCGGGAGG - Intronic
993524965 5:88954073-88954095 CAGACAGCACAGAGGAGGGAGGG - Intergenic
993965231 5:94352126-94352148 CAGACAACCCACAGAGTGGGAGG + Intronic
994072804 5:95620763-95620785 CAGCCAGCCCAGGGCGGCGAGGG - Exonic
995293325 5:110486251-110486273 CAGACAACCCACAGAGTGGGAGG - Intronic
996318020 5:122183104-122183126 CAGAAAGCTCAGGGAGAGGAAGG - Intergenic
997359893 5:133288393-133288415 CAGACAGGCCTGGGAGGGGCAGG - Intronic
997432394 5:133849361-133849383 CAGACTGCCCAGAGCAGGGCAGG - Intergenic
997604529 5:135164563-135164585 CAGACAGGGCAGAGAGGTGAGGG + Intronic
997887372 5:137642304-137642326 CAGAGTGCTCAGAGATGGGAAGG - Intronic
997975913 5:138441122-138441144 CACATGGCACAGAGAGGGGAGGG + Intronic
999197605 5:149793124-149793146 CAGCCACCCCAGGGTGGGGAAGG - Intronic
999606702 5:153324450-153324472 CAGAAATCCCAGTGAGGGGATGG - Intergenic
999637695 5:153639959-153639981 AATGCAGCCCAGAGAGGAGAAGG + Intronic
999732193 5:154483050-154483072 AAACTAGCCCAGAGAGGGGAAGG + Intergenic
1000998337 5:167981209-167981231 CAGACTGCCCTGGGTGGGGATGG - Intronic
1001492420 5:172165085-172165107 CAGCCAGCCCAGTCAGGGGCTGG + Intronic
1001822338 5:174720278-174720300 CCCACAGCCTGGAGAGGGGATGG - Intergenic
1001978514 5:176021114-176021136 CACAGATCCCAGAGAGAGGAGGG + Intronic
1002202728 5:177539483-177539505 CAGCCATGCCAGAGAGGGAAGGG - Intronic
1002206887 5:177569137-177569159 CAGACAGTGCAGGGAGGTGAGGG - Intergenic
1002238903 5:177822648-177822670 CACAGATCCCAGAGAGAGGAGGG - Intergenic
1002284166 5:178151290-178151312 CAGGCAGCCCACGGAGGGGCTGG + Intronic
1002632588 5:180591226-180591248 GAGACAGCCCTGAGAGGGGGAGG + Intronic
1002742722 5:181445141-181445163 CAGCCAGGCCAGGAAGGGGAGGG - Intergenic
1003092793 6:3118488-3118510 GAGCCAGCACCGAGAGGGGACGG + Intronic
1003096669 6:3147798-3147820 CTGACAGCCAGGAGAGGAGATGG + Intronic
1003504458 6:6728324-6728346 CAGACAGTGCACAGCGGGGAAGG - Intergenic
1004835481 6:19526974-19526996 CAGACAACCCACAGAGTGGGAGG - Intergenic
1005812578 6:29528745-29528767 CACACAGCCAGGACAGGGGACGG + Intergenic
1005900523 6:30213342-30213364 CAGACCGCCGTGAGAGAGGAGGG - Exonic
1006314377 6:33281364-33281386 CACACAGCCCAGCAAGGGGAAGG + Intronic
1006914775 6:37587206-37587228 GAGACAGCCCAGCTAGGGCAGGG - Intergenic
1007250168 6:40489955-40489977 CAGAAAGGCCAGAGAGGTCAAGG - Intronic
1007268617 6:40618317-40618339 CAGACAGACCCAAGAGAGGAGGG + Intergenic
1007384560 6:41511944-41511966 CAGACAGCCCTGGTAGAGGAGGG + Intergenic
1007627275 6:43253668-43253690 CAGGAAGCCCACAGAGTGGATGG - Exonic
1007816290 6:44527760-44527782 AAGGCAGCCCAGGGAGGGCAGGG + Intergenic
1007958498 6:45938217-45938239 CACACAGAGCAGAAAGGGGATGG + Intronic
1009784687 6:68319804-68319826 CAAAAAGCCCAAAGAGGGTAGGG - Intergenic
1010193325 6:73215079-73215101 AAGACAGAGGAGAGAGGGGAAGG - Intronic
1010196868 6:73248309-73248331 AAGACAGAGGAGAGAGGGGAAGG - Intronic
1013367461 6:109446721-109446743 CAGACAGACCACAAAGCGGAAGG - Exonic
1013599291 6:111689457-111689479 AACACAGCCCAGAGAGATGAGGG + Intronic
1013655527 6:112242923-112242945 CAGAGGGTCCAGAGAGGAGAAGG - Intronic
1014758363 6:125327052-125327074 CAGAAGGACCAGAGGGGGGAAGG - Intergenic
1015770313 6:136761830-136761852 CCGACAGCACAGAGAAGCGATGG + Intronic
1015920793 6:138264654-138264676 CAGGGAGTCTAGAGAGGGGAGGG - Intronic
1015922821 6:138282322-138282344 CAGACACTCCAGAGAGGGCAGGG - Intronic
1017856743 6:158356503-158356525 ATGAGAGCCCAGAGAGGGTAGGG + Intronic
1018076196 6:160215799-160215821 CACACTGGCCAGAGATGGGAAGG - Intronic
1018202744 6:161410569-161410591 CACACAGCAGCGAGAGGGGAAGG + Intronic
1018848575 6:167572079-167572101 CTGACACCCCAGAGTGGGGATGG + Intergenic
1019247857 6:170720880-170720902 CAGCCAGGCCAGGAAGGGGAGGG - Intergenic
1019259353 7:72050-72072 CAGAAGGCCCAGGGAGAGGAGGG - Intergenic
1019916948 7:4139839-4139861 AAGACAGCCCAGACAGCGCAGGG - Intronic
1020444400 7:8254369-8254391 CAGGCAGTCCAGGCAGGGGAAGG + Intronic
1020473062 7:8561420-8561442 AAAACAGCCCAGAGGAGGGAAGG - Intronic
1021274733 7:18636292-18636314 CAGACAGCCCAGGGCAGGGGGGG - Intronic
1022196132 7:28069108-28069130 CTGACAAGGCAGAGAGGGGATGG + Intronic
1022902728 7:34826537-34826559 CAGAAAGCCCAGCTAGGTGAGGG + Intronic
1023122673 7:36925402-36925424 CAGCCAGCCCAGAGAGGCCAAGG - Intronic
1024294288 7:47830382-47830404 AACAGAGCACAGAGAGGGGAAGG + Intronic
1024545980 7:50518947-50518969 CAGACAACCCACAGAGTGGGAGG + Intronic
1024783430 7:52878234-52878256 CAGACAATACAGAGTGGGGAAGG + Intergenic
1024952023 7:54873264-54873286 CAAACAACACAGAGAAGGGATGG + Intergenic
1027190251 7:75992339-75992361 AACAGGGCCCAGAGAGGGGAGGG + Intronic
1027787016 7:82592732-82592754 CAGCCCACCCAGAGAGGTGATGG - Intergenic
1028179778 7:87705474-87705496 CAGACAGCAGAGAAAGGGAATGG - Intronic
1029647468 7:101867268-101867290 CAGAAAGATCAGAGAAGGGAAGG + Intronic
1030246214 7:107386871-107386893 CAGAGAGCCTAAAAAGGGGAAGG + Intronic
1030326179 7:108220906-108220928 CAGACAACCCACAGAGTGGGAGG + Intronic
1030797812 7:113810498-113810520 CAAACAGGCCAGAGAAGGAAGGG + Intergenic
1030914530 7:115296211-115296233 CATACAGTCAAGAGAGGGGTAGG + Intergenic
1032751526 7:134846378-134846400 CTGCCAGACCAGAGAGTGGAGGG + Intronic
1032813664 7:135449004-135449026 CAGACAGGAGAGAGAGGGAAAGG + Intronic
1033033092 7:137846312-137846334 CAGACATCCCCGGGAGGAGAGGG + Intronic
1033270637 7:139930034-139930056 GAGGCAGGCCAGAGAGGGCATGG - Intronic
1034820946 7:154215794-154215816 CTGGCGACCCAGAGAGGGGAAGG - Intronic
1034971431 7:155422187-155422209 CAGACAGCACAGGGAGAGAAGGG + Intergenic
1035172224 7:157023193-157023215 CACAGAGACCAGAGTGGGGAAGG + Intergenic
1035265534 7:157688808-157688830 GAGAAAGCCCAGGCAGGGGACGG - Intronic
1035266646 7:157693135-157693157 AAGACAGCGGAGAGAAGGGACGG + Intronic
1035500260 8:86984-87006 CAGCCAGGCCAGGAAGGGGAGGG + Intergenic
1035599997 8:891769-891791 CAGCCAGCCCAGGACGGGGAGGG + Intergenic
1036212307 8:6852363-6852385 CAGACAGCACAAAGAGGGCAGGG - Intergenic
1036616292 8:10390241-10390263 CAGGCAGCCCTGAGAGGAGGGGG + Intronic
1036642395 8:10592588-10592610 GAGACAGCCCTGGGAGGGGCAGG - Intergenic
1037951285 8:23019903-23019925 CAGGCAGGAGAGAGAGGGGAAGG + Intronic
1039831962 8:41222547-41222569 CAGCTAGTCCACAGAGGGGAAGG - Intergenic
1039832102 8:41223616-41223638 CAGAGAGCCAAGAGGGAGGAAGG + Intergenic
1040486989 8:47883049-47883071 CAGTGAGCCAAGACAGGGGAAGG - Intronic
1040694722 8:49981821-49981843 CTGAAAGCCCAAAGAGGGCAAGG - Intronic
1041351928 8:56955775-56955797 CTTACAGCCCATGGAGGGGAAGG - Intergenic
1041746835 8:61216387-61216409 CAGACAGACTAGAGGGTGGATGG - Intronic
1044620795 8:94188850-94188872 CAGACAGCCTCGAGGGTGGATGG + Intronic
1045697387 8:104824838-104824860 AATACATTCCAGAGAGGGGAAGG - Intronic
1045714573 8:105026393-105026415 CTGCCAGCCCAGGGAGGGCATGG + Intronic
1047059741 8:121211527-121211549 CAGACAACCCACAGAATGGAAGG - Intergenic
1047512691 8:125527879-125527901 GTAACAGCCCAGAGATGGGAAGG - Intergenic
1049184083 8:141239894-141239916 CACACAACCCAGGGAGTGGAGGG + Intronic
1049502404 8:142974499-142974521 GAGGCAGCACAGCGAGGGGAGGG - Intergenic
1049513692 8:143042715-143042737 CAGGTAGCCCAGAGAGCTGAGGG + Intronic
1049740932 8:144240513-144240535 CAGCCAGCCCTGTGAGGGGTCGG + Intronic
1049840334 8:144766947-144766969 CAGAGAGCCTGGAGAGGGGCAGG - Intergenic
1051819889 9:21152018-21152040 CAGGCAGCCTAAATAGGGGATGG + Intergenic
1052977367 9:34421179-34421201 CAAGCAGGTCAGAGAGGGGAAGG + Intronic
1053015274 9:34658405-34658427 CAGACACTCCTGAGAGGGGAGGG - Intronic
1056066744 9:82943430-82943452 CTGACTTCCCAGAGAGGTGATGG + Intergenic
1056588079 9:87941364-87941386 CAAACAGACCAGAGAGTGAATGG + Intergenic
1056608589 9:88109050-88109072 CAAACAGTCCAGAGGGTGGAAGG - Intergenic
1056608788 9:88111581-88111603 CAAACAGACCAGAGAGTGAATGG - Intergenic
1056792358 9:89634018-89634040 CAGACGGGCCAGAGATGGGAGGG + Intergenic
1057437520 9:95056029-95056051 CAGACAGACTGGAGAGGGGGAGG + Intronic
1058961034 9:109993272-109993294 GAGAAAGCCCACAGAGAGGAAGG - Intronic
1060022038 9:120140120-120140142 CAGCCTACCCAGAAAGGGGAAGG - Intergenic
1060050029 9:120371952-120371974 CTGACAGCTCAGAGAGGGAAAGG - Intergenic
1060229190 9:121814454-121814476 AGGGAAGCCCAGAGAGGGGAGGG - Intergenic
1060662437 9:125412135-125412157 CAGAGAGCCCTGAGAGGGACTGG + Intergenic
1061423551 9:130485177-130485199 CCATCAGTCCAGAGAGGGGAGGG - Intronic
1061669716 9:132182041-132182063 CCGGCAGCCCAGAGAAGGGAGGG + Intronic
1061869881 9:133515009-133515031 AGGACAGCAGAGAGAGGGGATGG - Intronic
1061948322 9:133921080-133921102 CGTGCAGCCCTGAGAGGGGAAGG + Intronic
1062110027 9:134777261-134777283 CGCACAGCCCAGAGAGGGACAGG - Intronic
1062170329 9:135131305-135131327 CAGACTGCCTAGACATGGGAGGG - Intergenic
1062203412 9:135321271-135321293 CAGGCAGGCCAGAGAGTGCAGGG + Intergenic
1062217429 9:135396886-135396908 GATGCAGTCCAGAGAGGGGAAGG - Intergenic
1062309984 9:135930318-135930340 CAGCCAGCCCTGAAACGGGACGG + Intergenic
1062489085 9:136795842-136795864 CAGACAGCACAGAGAGGTCAGGG + Intronic
1062617977 9:137406778-137406800 CAGACACCCCAGAGGAGGGCTGG - Intronic
1062745352 9:138208413-138208435 CAGAAGGCCCAGGGAGAGGAGGG + Intergenic
1203608627 Un_KI270748v1:76359-76381 CAGCCAGGCCAGGAAGGGGAGGG - Intergenic
1185478077 X:427194-427216 CGGACACCCCAGAGACAGGACGG + Intergenic
1185478133 X:427437-427459 CAGAGACCCCAGAGACAGGACGG + Intergenic
1186834626 X:13425303-13425325 CAAAGAGCCCAGAGGAGGGAGGG + Intergenic
1187469205 X:19553158-19553180 CAGAGAGCCAGGGGAGGGGATGG + Intronic
1187615386 X:20988164-20988186 GAGAAAGCCCAGAGGTGGGAAGG + Intergenic
1188976864 X:36686158-36686180 CAGACAGAGCAGAGTGGAGATGG - Intergenic
1191100769 X:56724887-56724909 CAGACAACCCAGAGAGTGGGAGG + Intergenic
1191105694 X:56770818-56770840 GAGACAGGGCAGAAAGGGGAGGG - Intergenic
1191106687 X:56776220-56776242 GAGACAGGGCAGAAAGGGGAGGG - Intergenic
1192630061 X:72770258-72770280 CTGACAGCCCACAGAGTGCAGGG - Intergenic
1192651649 X:72950546-72950568 CTGACAGCCCACAGAGTGCAGGG + Intergenic
1192796970 X:74431997-74432019 CTGAGAGCCCAGGGAGAGGAGGG + Intronic
1196246497 X:113405832-113405854 CAGACAACCCACAGAGTGGAAGG + Intergenic
1196294807 X:113985406-113985428 GAGACATCCCAGAGAGGGACTGG - Intergenic
1196424562 X:115556833-115556855 CAGAAAGTCGGGAGAGGGGAGGG + Intergenic
1198320296 X:135513334-135513356 CAGAGGGGCCAGAGAGAGGATGG - Intergenic
1199663860 X:150081289-150081311 CAGAAAGCCCAGGGAGGGAGGGG + Intergenic
1199714733 X:150499022-150499044 CAGATAGCCCAAAGAGGTGAAGG - Intronic
1200125257 X:153810445-153810467 CAGTCAGCACAGAGAGGGCAGGG + Intronic
1200236727 X:154471355-154471377 CAGGCAGCCCAGGGAGGGGCAGG - Intronic
1200696658 Y:6366955-6366977 CAGAGAGCCCAGAGAGCCAAGGG - Intergenic
1201037455 Y:9797744-9797766 CAGAGAGCCCAGAGAGCCAAGGG + Intergenic
1201489351 Y:14524382-14524404 CAGAGAGCCTTGAGATGGGATGG - Intronic