ID: 1167499121

View in Genome Browser
Species Human (GRCh38)
Location 19:49835749-49835771
Sequence CCCTACGGTACCCTGAGGCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 67}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167499121_1167499130 -7 Left 1167499121 19:49835749-49835771 CCCAGCCTCAGGGTACCGTAGGG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1167499130 19:49835765-49835787 CGTAGGGGCCTCTGGGGCCACGG 0: 1
1: 0
2: 3
3: 17
4: 222
1167499121_1167499135 12 Left 1167499121 19:49835749-49835771 CCCAGCCTCAGGGTACCGTAGGG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1167499135 19:49835784-49835806 ACGGGGCAGCCCCAGCCCCAAGG 0: 1
1: 0
2: 2
3: 46
4: 394
1167499121_1167499132 -5 Left 1167499121 19:49835749-49835771 CCCAGCCTCAGGGTACCGTAGGG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1167499132 19:49835767-49835789 TAGGGGCCTCTGGGGCCACGGGG 0: 1
1: 0
2: 1
3: 32
4: 204
1167499121_1167499131 -6 Left 1167499121 19:49835749-49835771 CCCAGCCTCAGGGTACCGTAGGG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1167499131 19:49835766-49835788 GTAGGGGCCTCTGGGGCCACGGG 0: 1
1: 0
2: 0
3: 27
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167499121 Original CRISPR CCCTACGGTACCCTGAGGCT GGG (reversed) Exonic
904048129 1:27621699-27621721 CCCCAAGGCACCCTGAGGCCAGG + Intronic
912864908 1:113248215-113248237 CCCCACTCTACCCTGAGGGTGGG + Intergenic
923795872 1:237155016-237155038 CCCTAAGGATCCTTGAGGCTTGG - Intronic
1066746186 10:38605286-38605308 CCCCAGGGTACTCAGAGGCTGGG - Intergenic
1069455863 10:68553353-68553375 CCCCAAGGTAGCCTTAGGCTGGG + Intergenic
1072578051 10:96718442-96718464 CCCTCGGGTTCCCTGAGGTTTGG - Intronic
1083782712 11:64926324-64926346 CTCTACGGTGTCCTCAGGCTTGG - Intronic
1084006586 11:66326523-66326545 CCCTGTGGGACCCTGAGACTCGG + Intergenic
1088605100 11:111522040-111522062 CCCTATGGAACTCTGAGGCTGGG - Intronic
1098782093 12:74700239-74700261 CCCAAAGGCACCCTTAGGCTTGG + Intergenic
1112041694 13:95553368-95553390 CCCTACGTTCCCCGAAGGCTGGG + Intronic
1117329771 14:54701038-54701060 CACCACTGTACCCTGGGGCTTGG - Intronic
1117565829 14:56992403-56992425 GCCTACCGTACACTGAGCCTTGG - Intergenic
1121541181 14:94727994-94728016 CCCCACTGGTCCCTGAGGCTGGG + Intergenic
1122341876 14:101033862-101033884 CCCGACGGGACCCTGAGCATGGG + Intergenic
1128608379 15:69055241-69055263 CACTACCTTACCCTGGGGCTTGG - Intronic
1132854320 16:2038059-2038081 CCCTCCAGTCCACTGAGGCTGGG - Exonic
1136736872 16:32474355-32474377 CCCTAGGGGACTCAGAGGCTGGG + Intergenic
1141574618 16:84955863-84955885 CCCAACGGTACCCCCAGGCCAGG + Intergenic
1203016197 16_KI270728v1_random:355222-355244 CCCTAGGGGACTCAGAGGCTGGG - Intergenic
1203034532 16_KI270728v1_random:628380-628402 CCCTAGGGGACTCAGAGGCTGGG - Intergenic
1147031974 17:37645796-37645818 CCCTATGGTACTCTAATGCTTGG + Intergenic
1150736974 17:67749361-67749383 CGCCACGGTACCCTTAGCCTGGG - Intergenic
1151953100 17:77366069-77366091 CCCCAGGGTACCAGGAGGCTTGG - Intronic
1152467650 17:80475107-80475129 CCCAGCTGTACGCTGAGGCTGGG + Intronic
1156662244 18:39359382-39359404 CCCTACCGAACCCTGAGGGGTGG + Intergenic
1157591878 18:48841196-48841218 ACCTACAGTTCCCTGAGACTGGG - Intronic
1158536030 18:58309145-58309167 CCATATGGGACCCTGAGGCCTGG + Intronic
1161181871 19:2889075-2889097 CCGAACGCTAGCCTGAGGCTCGG - Intergenic
1161321687 19:3644359-3644381 CCCTACCGGTCCCTGAGGCCAGG + Intronic
1167499121 19:49835749-49835771 CCCTACGGTACCCTGAGGCTGGG - Exonic
1167566029 19:50257622-50257644 CCCAACCGGACCCTGAGCCTAGG - Intronic
926883728 2:17577706-17577728 CTCTGGGGTCCCCTGAGGCTTGG - Intronic
928095082 2:28399545-28399567 CCCTGCTGTACCCTGTTGCTAGG - Intronic
931667779 2:64622742-64622764 CCCTCCACTCCCCTGAGGCTGGG - Intergenic
937326328 2:120991578-120991600 CCCTAGGGCAGCCTGAGGCTGGG - Exonic
947670759 2:231934057-231934079 CCCTGCTGTGCCCTGAGGCCCGG - Intergenic
1170874472 20:20237293-20237315 TCGTAAGGTACCCTGAGTCTGGG - Intronic
1171349775 20:24493767-24493789 CCCAATGGTCCCCTGAGGGTGGG - Intronic
1172588529 20:36101632-36101654 TCCTAGGGTTCCCTAAGGCTGGG + Intronic
1173115924 20:40242822-40242844 CCCTAAGGTTCCCTTAGGATGGG - Intergenic
1175918629 20:62439517-62439539 CCCACAGGCACCCTGAGGCTGGG + Intergenic
1181100817 22:20537578-20537600 CCCTACAGGGCCCTGAGGCATGG + Intronic
1181476158 22:23168909-23168931 GCCTAGTGTACCCTCAGGCTAGG - Intergenic
1183386353 22:37517802-37517824 CCCCACGGTAGGCTGAGGGTGGG - Intronic
1185122789 22:48982562-48982584 CCCCACGGAACCGTGAGGCTGGG - Intergenic
1185279432 22:49963678-49963700 CCCCACTGTCCCCTGGGGCTTGG - Exonic
954280372 3:49572967-49572989 CCCTCAGGTACTCTGAGACTTGG - Intronic
955701193 3:61683977-61683999 CCCTACGGTACCATGGAGCTGGG - Intronic
961484263 3:127206531-127206553 CCCTAGGACACCCTGAGGATGGG + Intergenic
996746546 5:126851203-126851225 CCCTGAGGTTCCCTGAGACTTGG + Intergenic
1000288195 5:159846187-159846209 CCCTTGGGGACCCTGAGGCTGGG - Intergenic
1007752904 6:44080986-44081008 CCCTACTGCTCCCTCAGGCTGGG + Intergenic
1013596144 6:111662802-111662824 CCCCACAGTGCCCTGAGGTTTGG + Intronic
1021342106 7:19478155-19478177 TCCTACAGGTCCCTGAGGCTCGG + Intergenic
1023477734 7:40599211-40599233 CCCTATGGTATCCTGTGGCAAGG - Intronic
1028983696 7:96993684-96993706 GCCTTCGGAGCCCTGAGGCTAGG + Intergenic
1029681981 7:102117665-102117687 CCCTGCGCTCCCCTGATGCTAGG - Intronic
1035125792 7:156607274-156607296 GCCCACGGTACCCTGCAGCTTGG + Intergenic
1037892096 8:22628885-22628907 CCCTACGCAACCCTGTGGCATGG + Intronic
1038380064 8:27084477-27084499 CCCTACGTTTCCCTGAGGGATGG - Intergenic
1045110835 8:98938638-98938660 CCCTGGATTACCCTGAGGCTGGG - Intronic
1046618722 8:116505135-116505157 CCCTCCAGTACCCAGAGGCTCGG + Intergenic
1049581437 8:143412927-143412949 CCCCAGGGTCCCCTGTGGCTGGG - Intergenic
1056598357 9:88026173-88026195 CCTTACAGTACTCTGAGGATGGG + Intergenic
1057485237 9:95477640-95477662 CCCCACGGCACCCTGGGACTTGG + Exonic
1058160429 9:101564482-101564504 CCCTATGGTCCCCTGGTGCTGGG - Intergenic
1060910935 9:127349841-127349863 CACTACGGTAACCAGAGACTGGG - Intronic
1062396128 9:136353596-136353618 CCCTCCCCTTCCCTGAGGCTGGG - Intronic
1189062065 X:37764954-37764976 CACTTCGGCACGCTGAGGCTGGG - Intronic
1190420827 X:50282555-50282577 ACCTACAGAACCCTGAGCCTTGG - Intronic
1198857650 X:141034490-141034512 CCTTACGGTTCCATGTGGCTGGG - Intergenic
1198905048 X:141552881-141552903 CCTTACGGTTCCATGTGGCTGGG + Intergenic
1200111824 X:153744441-153744463 CCCCACGGGACTCAGAGGCTGGG - Exonic