ID: 1167499123

View in Genome Browser
Species Human (GRCh38)
Location 19:49835750-49835772
Sequence CCCCTACGGTACCCTGAGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 70}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167499123_1167499132 -6 Left 1167499123 19:49835750-49835772 CCAGCCTCAGGGTACCGTAGGGG 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1167499132 19:49835767-49835789 TAGGGGCCTCTGGGGCCACGGGG 0: 1
1: 0
2: 1
3: 32
4: 204
1167499123_1167499135 11 Left 1167499123 19:49835750-49835772 CCAGCCTCAGGGTACCGTAGGGG 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1167499135 19:49835784-49835806 ACGGGGCAGCCCCAGCCCCAAGG 0: 1
1: 0
2: 2
3: 46
4: 394
1167499123_1167499130 -8 Left 1167499123 19:49835750-49835772 CCAGCCTCAGGGTACCGTAGGGG 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1167499130 19:49835765-49835787 CGTAGGGGCCTCTGGGGCCACGG 0: 1
1: 0
2: 3
3: 17
4: 222
1167499123_1167499131 -7 Left 1167499123 19:49835750-49835772 CCAGCCTCAGGGTACCGTAGGGG 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1167499131 19:49835766-49835788 GTAGGGGCCTCTGGGGCCACGGG 0: 1
1: 0
2: 0
3: 27
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167499123 Original CRISPR CCCCTACGGTACCCTGAGGC TGG (reversed) Exonic
900174097 1:1284277-1284299 CCCCCACGGTACCTCGAGGCGGG - Intronic
902835716 1:19045436-19045458 CCCCCAGTGTCCCCTGAGGCTGG + Intergenic
910205759 1:84747491-84747513 CCTCTCCTGTGCCCTGAGGCAGG - Intergenic
910216341 1:84848308-84848330 CCCCTGCTGGGCCCTGAGGCTGG + Intronic
910324870 1:85995563-85995585 CCCCCATGGTACCCTGAGGAGGG + Intronic
919236742 1:194855323-194855345 CACCTACATTCCCCTGAGGCAGG + Intergenic
920283999 1:204866535-204866557 GCCCTACAGCACCCTGGGGCTGG + Intronic
1069534830 10:69245456-69245478 CCCCTATGGGAGGCTGAGGCAGG + Intronic
1071285862 10:84144465-84144487 CACCTACAGGAGCCTGAGGCAGG - Intronic
1072020626 10:91395985-91396007 GCCCTAGTGTACACTGAGGCAGG - Intergenic
1076674249 10:132140149-132140171 TCCCTGCGGTTCCCTGAGGGTGG - Intronic
1079983844 11:27179572-27179594 CTCCAGAGGTACCCTGAGGCAGG - Intergenic
1088605102 11:111522041-111522063 TCCCTATGGAACTCTGAGGCTGG - Intronic
1090486358 11:127115980-127116002 CCCCTCCGCAACCCTAAGGCGGG + Intergenic
1090709592 11:129373470-129373492 CCGCGGCGGGACCCTGAGGCTGG - Intergenic
1094566181 12:31600268-31600290 CCCCTTCGGTGGCCTGAGCCAGG - Intergenic
1097871997 12:64610075-64610097 CCCCTACAGGACCCTGGTGCGGG + Intergenic
1112041692 13:95553367-95553389 CCCCTACGTTCCCCGAAGGCTGG + Intronic
1113942900 13:114027860-114027882 CCCCTACGCCACCGTGACGCTGG - Exonic
1121541179 14:94727993-94728015 CCCCCACTGGTCCCTGAGGCTGG + Intergenic
1122341874 14:101033861-101033883 CCCCGACGGGACCCTGAGCATGG + Intergenic
1125914668 15:43474894-43474916 CCCCAACAGCAACCTGAGGCTGG + Intronic
1132609879 16:810344-810366 CCCCTCTGGTTCCCTGAGGAGGG + Intronic
1142072685 16:88099831-88099853 CCCCTTTGCTACCCTGAAGCAGG - Intronic
1143027745 17:3951058-3951080 CCCCTACAGAAGCCTGAGACAGG + Intronic
1147726034 17:42566748-42566770 TCCCCACGTTACCCTGAGGGCGG - Intergenic
1149597485 17:57872843-57872865 CCCCAGCGTTACCCTGAGGAGGG + Exonic
1149739689 17:59033542-59033564 CCACTACGGGAGGCTGAGGCAGG - Intronic
1161038825 19:2099357-2099379 CCCCCACGTTGCCCTGGGGCAGG - Exonic
1163607289 19:18282023-18282045 CCCCTCCAGTCCCCGGAGGCCGG - Intergenic
1166204788 19:41262685-41262707 CCACTACGGTCCGCAGAGGCAGG - Intronic
1167011749 19:46813329-46813351 TCCCCACGGTAGCCCGAGGCTGG - Intergenic
1167499123 19:49835750-49835772 CCCCTACGGTACCCTGAGGCTGG - Exonic
926637027 2:15191875-15191897 CCTCAAAGGGACCCTGAGGCTGG - Intronic
931667781 2:64622743-64622765 CCCCTCCACTCCCCTGAGGCTGG - Intergenic
932947572 2:76254504-76254526 CTCCTACGCTACCCTGAGCAGGG - Intergenic
937326330 2:120991579-120991601 TCCCTAGGGCAGCCTGAGGCTGG - Exonic
946411481 2:219517325-219517347 GCCCTCTGGTACCCTGGGGCTGG + Intronic
1170874473 20:20237294-20237316 CTCGTAAGGTACCCTGAGTCTGG - Intronic
1172588528 20:36101631-36101653 CTCCTAGGGTTCCCTAAGGCTGG + Intronic
1176145476 20:63563487-63563509 CCCCTACGGCTCCCTGCAGCTGG - Exonic
1180848386 22:18997205-18997227 CCCCTACAGTTCCATGGGGCAGG - Intergenic
1182269046 22:29141957-29141979 TCCCTAAGGTCCCCTGAAGCAGG - Exonic
1184308949 22:43628641-43628663 TCCCTGCGATACCCTGAAGCAGG - Intronic
1185122791 22:48982563-48982585 TCCCCACGGAACCGTGAGGCTGG - Intergenic
1185165952 22:49262350-49262372 CCCCTGCGGTACCCAGGGGGAGG - Intergenic
952485689 3:33807544-33807566 CACCTACGGCCCCCTGGGGCAGG + Intronic
954480272 3:50793468-50793490 CACCTACGGGAGGCTGAGGCAGG - Intronic
955701195 3:61683978-61684000 GCCCTACGGTACCATGGAGCTGG - Intronic
961484261 3:127206530-127206552 CCCCTAGGACACCCTGAGGATGG + Intergenic
961532538 3:127548009-127548031 CCCCTACGGCCTCCAGAGGCCGG + Intergenic
963375393 3:144457610-144457632 CCCATGGGGTCCCCTGAGGCTGG - Intergenic
985517249 5:353393-353415 CCACTACGGATCCCTGAGGAGGG - Intronic
985775807 5:1841167-1841189 CCCCTCCTGTCCCCTGAGGAGGG - Intergenic
997361892 5:133300456-133300478 CCCCTACTGTGCCCTGAGCATGG + Intronic
998093441 5:139383897-139383919 CCCCTCAGGGTCCCTGAGGCAGG + Intronic
1000288197 5:159846188-159846210 TCCCTTGGGGACCCTGAGGCTGG - Intergenic
1013304845 6:108838503-108838525 CCCCTAGGGCACTCTGAGGTGGG - Intergenic
1018920369 6:168168195-168168217 CCCCCTGGGTCCCCTGAGGCTGG - Intergenic
1019427474 7:984341-984363 CCCCTTAGGTCCCCTCAGGCCGG - Intronic
1024543745 7:50500162-50500184 ACCCCACGGTACCCTGACACTGG - Intronic
1028995293 7:97093310-97093332 CCCCCACACTCCCCTGAGGCAGG - Intergenic
1035767446 8:2118724-2118746 CCCCTGCAGGACCCAGAGGCTGG + Intronic
1040787072 8:51178618-51178640 CCCAGAGGGTACCCTGAGTCTGG + Intergenic
1042105820 8:65325508-65325530 CCTCTTCAGTACCCTGAGGAAGG + Intergenic
1045110837 8:98938639-98938661 CCCCTGGATTACCCTGAGGCTGG - Intronic
1049020026 8:139950115-139950137 CCCCCACGGTCACCTGAAGCTGG - Intronic
1049343210 8:142124816-142124838 CCCCTGGGGTCCCCTGAGGCTGG + Intergenic
1052746813 9:32449324-32449346 CCCCTACTGTACCCTGTTCCCGG + Intronic
1062636320 9:137493503-137493525 CCCCAACCGTGCCCTGAAGCAGG - Intronic
1188111230 X:26197882-26197904 TCCCTGTGGTAACCTGAGGCTGG - Intergenic
1190292235 X:49000739-49000761 GCCCTATAGGACCCTGAGGCTGG + Intronic
1192594295 X:72389905-72389927 CCCCCATGGTACCCTCAGCCTGG - Intronic
1200243078 X:154507900-154507922 CGCCTGCCGTGCCCTGAGGCTGG - Intronic