ID: 1167499131

View in Genome Browser
Species Human (GRCh38)
Location 19:49835766-49835788
Sequence GTAGGGGCCTCTGGGGCCAC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 291}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167499111_1167499131 20 Left 1167499111 19:49835723-49835745 CCAGCTCCAGCTCCGCCCACCGC 0: 1
1: 0
2: 1
3: 68
4: 668
Right 1167499131 19:49835766-49835788 GTAGGGGCCTCTGGGGCCACGGG 0: 1
1: 0
2: 0
3: 27
4: 291
1167499113_1167499131 8 Left 1167499113 19:49835735-49835757 CCGCCCACCGCAGCCCCAGCCTC 0: 2
1: 1
2: 39
3: 272
4: 2133
Right 1167499131 19:49835766-49835788 GTAGGGGCCTCTGGGGCCACGGG 0: 1
1: 0
2: 0
3: 27
4: 291
1167499110_1167499131 23 Left 1167499110 19:49835720-49835742 CCACCAGCTCCAGCTCCGCCCAC 0: 1
1: 1
2: 9
3: 98
4: 770
Right 1167499131 19:49835766-49835788 GTAGGGGCCTCTGGGGCCACGGG 0: 1
1: 0
2: 0
3: 27
4: 291
1167499118_1167499131 1 Left 1167499118 19:49835742-49835764 CCGCAGCCCCAGCCTCAGGGTAC 0: 1
1: 0
2: 8
3: 89
4: 738
Right 1167499131 19:49835766-49835788 GTAGGGGCCTCTGGGGCCACGGG 0: 1
1: 0
2: 0
3: 27
4: 291
1167499109_1167499131 24 Left 1167499109 19:49835719-49835741 CCCACCAGCTCCAGCTCCGCCCA 0: 1
1: 0
2: 4
3: 51
4: 450
Right 1167499131 19:49835766-49835788 GTAGGGGCCTCTGGGGCCACGGG 0: 1
1: 0
2: 0
3: 27
4: 291
1167499112_1167499131 14 Left 1167499112 19:49835729-49835751 CCAGCTCCGCCCACCGCAGCCCC 0: 1
1: 0
2: 11
3: 181
4: 1466
Right 1167499131 19:49835766-49835788 GTAGGGGCCTCTGGGGCCACGGG 0: 1
1: 0
2: 0
3: 27
4: 291
1167499119_1167499131 -5 Left 1167499119 19:49835748-49835770 CCCCAGCCTCAGGGTACCGTAGG 0: 1
1: 0
2: 0
3: 6
4: 149
Right 1167499131 19:49835766-49835788 GTAGGGGCCTCTGGGGCCACGGG 0: 1
1: 0
2: 0
3: 27
4: 291
1167499123_1167499131 -7 Left 1167499123 19:49835750-49835772 CCAGCCTCAGGGTACCGTAGGGG 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1167499131 19:49835766-49835788 GTAGGGGCCTCTGGGGCCACGGG 0: 1
1: 0
2: 0
3: 27
4: 291
1167499114_1167499131 5 Left 1167499114 19:49835738-49835760 CCCACCGCAGCCCCAGCCTCAGG 0: 1
1: 0
2: 16
3: 145
4: 1104
Right 1167499131 19:49835766-49835788 GTAGGGGCCTCTGGGGCCACGGG 0: 1
1: 0
2: 0
3: 27
4: 291
1167499121_1167499131 -6 Left 1167499121 19:49835749-49835771 CCCAGCCTCAGGGTACCGTAGGG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1167499131 19:49835766-49835788 GTAGGGGCCTCTGGGGCCACGGG 0: 1
1: 0
2: 0
3: 27
4: 291
1167499116_1167499131 4 Left 1167499116 19:49835739-49835761 CCACCGCAGCCCCAGCCTCAGGG 0: 1
1: 0
2: 8
3: 120
4: 842
Right 1167499131 19:49835766-49835788 GTAGGGGCCTCTGGGGCCACGGG 0: 1
1: 0
2: 0
3: 27
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167499131 Original CRISPR GTAGGGGCCTCTGGGGCCAC GGG Exonic
900324273 1:2100377-2100399 GAAGGGGCAGCTGGGGCCTCTGG - Intronic
900324863 1:2103773-2103795 GGAAGGGCCTCTGGGGCGGCGGG + Intronic
900954753 1:5879667-5879689 GGTGGGGCCTGTGGGTCCACAGG + Intronic
901415078 1:9110989-9111011 TTAAGGGCCTGTGGGGGCACAGG - Intronic
901529106 1:9842653-9842675 CCAGAGGCCTCTGGGTCCACTGG - Intergenic
902184883 1:14717707-14717729 CCAGGGGCCTCTTGGGCCTCAGG - Intronic
904265013 1:29313151-29313173 GGAGGGGCAGCTGGGGTCACGGG - Intronic
904922522 1:34020191-34020213 GGAGAGGGCTTTGGGGCCACTGG + Intronic
906312213 1:44762051-44762073 GGAGGAGGCTCTGGGGCCTCAGG + Intronic
917438381 1:175044130-175044152 GGACCGCCCTCTGGGGCCACAGG + Intergenic
917475529 1:175366044-175366066 GTAGTGGTCAATGGGGCCACTGG + Exonic
917796680 1:178537931-178537953 GCCGGGACCTCTGGGGCCAGAGG - Intronic
917972556 1:180218218-180218240 TCAGGGGCCTGTGGTGCCACTGG + Intergenic
919778530 1:201208821-201208843 GTAGGGGGTTCTGGGGCAATGGG + Exonic
922125084 1:222713417-222713439 GTAGGTTCCTCTGGGGACTCGGG + Intronic
922769809 1:228175723-228175745 GTGGGCTCCTCTGGGGCCACAGG - Exonic
922815991 1:228449828-228449850 GTAGGGCCCTGTGAGGCCTCTGG + Intergenic
1062976522 10:1687769-1687791 GGAGGGGGCTCAGGTGCCACAGG + Intronic
1066066541 10:31765275-31765297 GTGGGGGTCTCGGGGGCCAGAGG - Intergenic
1069286404 10:66720876-66720898 GTTGGGGCCTCAGAGGCTACTGG - Intronic
1069745678 10:70713456-70713478 GCAGGAGCCCCAGGGGCCACAGG + Intronic
1070931600 10:80264868-80264890 GGAGAGTGCTCTGGGGCCACAGG - Intergenic
1073098514 10:100995198-100995220 GAAGGGGCTTCTGGGGCCGATGG + Intergenic
1075416650 10:122269281-122269303 GCAGGGGCCTCAGGAGCCAGAGG - Intergenic
1076343450 10:129765371-129765393 GCAGGGGACTCTGGGGGCTCTGG - Intronic
1076472551 10:130729032-130729054 GGAGTGGCCGCTGGGGCCTCCGG + Intergenic
1076535996 10:131178110-131178132 GCAGGGTCCTCAGGGGGCACAGG - Intronic
1076725455 10:132410893-132410915 GGTTGGGCCCCTGGGGCCACAGG - Intronic
1076846822 10:133073265-133073287 GTAAGGCCACCTGGGGCCACCGG - Intronic
1076848602 10:133082127-133082149 GGTGGGGCCTGTGGGGCCTCGGG + Intronic
1077096947 11:803085-803107 GCAGGGGCCTCTGCACCCACAGG - Intronic
1077158819 11:1103473-1103495 GTGGGGGCCTCGGGGGCCATGGG - Intergenic
1077301054 11:1847160-1847182 GTAGGGGTGACTGGGGCCAGGGG - Intergenic
1077392051 11:2304723-2304745 GGAGGGGCCTATGGGACCTCGGG - Intronic
1077402886 11:2367778-2367800 CCAGAGGCTTCTGGGGCCACTGG - Intergenic
1078079573 11:8194013-8194035 CTGGGGGCCTCTGGGGTCACTGG + Intergenic
1083365879 11:62141179-62141201 GTTGAAGCCTCTGTGGCCACCGG + Intronic
1083430413 11:62611368-62611390 CTTGGGGCCTCTGGGGCTTCAGG - Intronic
1083968385 11:66057274-66057296 GTGGGGCCCACTGGGCCCACTGG - Exonic
1084167046 11:67379889-67379911 CTAGGGGCCCCTGGGGTCAAAGG + Intronic
1084425949 11:69084696-69084718 GAAGGTGTCTCTGGGGCCGCAGG + Intronic
1084576216 11:69989549-69989571 GTGGGGGTCTCCAGGGCCACTGG + Intergenic
1084646704 11:70463346-70463368 GCAGAGGACTCTGGGCCCACTGG - Intergenic
1084681586 11:70669525-70669547 GAAGGGGCCTCCAGAGCCACCGG + Intronic
1085205907 11:74731649-74731671 GAAGGGGCCACGCGGGCCACGGG + Intergenic
1086121888 11:83312971-83312993 GTAGTGAACTCTGGGGCCAATGG + Intergenic
1088608005 11:111549689-111549711 GTAGGGGCCTCCGATGCCAGCGG - Exonic
1089454482 11:118618100-118618122 GGAAGGGTCACTGGGGCCACAGG - Intronic
1090801083 11:130172731-130172753 GTAGAGGACTCTGTGGCCATAGG - Intronic
1091160909 11:133418945-133418967 CTGGGTGCCTGTGGGGCCACAGG - Intronic
1091385917 12:94574-94596 GTTGGGGCTTCTGCTGCCACTGG - Intronic
1093179507 12:15951145-15951167 GCAGGGGTCTGTGGGGCCAAGGG - Intronic
1094088616 12:26622772-26622794 GTAGGGGTCTGTAGGGCCCCAGG - Intronic
1096551821 12:52378133-52378155 GCAGGGGACGCTGGGGACACAGG + Exonic
1096654319 12:53079213-53079235 GGCGGGGGCTCTGGGGCCAGGGG - Intronic
1098364740 12:69690494-69690516 GGAGAGGCCTCTGGGGCCTCTGG - Intronic
1099388809 12:82052331-82052353 GTTGGGGTGTCTGTGGCCACTGG + Intergenic
1100855339 12:98752688-98752710 GTGTGGGCTCCTGGGGCCACTGG - Intronic
1105303004 13:19152030-19152052 CCAGCCGCCTCTGGGGCCACCGG + Intergenic
1106433886 13:29707375-29707397 GATGGGGCTGCTGGGGCCACAGG - Intergenic
1107331837 13:39309826-39309848 GTTGATGCTTCTGGGGCCACTGG + Intergenic
1108464420 13:50700526-50700548 AGAGGGGCCTCTGGGGCCCAGGG - Intronic
1108662240 13:52597786-52597808 GTAGAGGCCAAAGGGGCCACAGG - Intergenic
1113079135 13:106498743-106498765 GTAGGTTCCTCTGAAGCCACAGG + Intronic
1113708944 13:112451845-112451867 GCAGGGGCCTTTCGGGCCAGGGG - Intergenic
1113799294 13:113078169-113078191 GACTTGGCCTCTGGGGCCACAGG - Intronic
1114055777 14:18966006-18966028 GAGGGGGCATTTGGGGCCACAGG - Intergenic
1114106770 14:19435758-19435780 GAGGGGGCATTTGGGGCCACAGG + Intergenic
1116336707 14:43666072-43666094 CTAGGGGACTCTGTGCCCACCGG - Intergenic
1116397186 14:44461075-44461097 GTAGTGGCCTCTAGGTCTACCGG - Intergenic
1116397510 14:44464192-44464214 GTAGTGGCCTCTAGGTCTACCGG + Intergenic
1118747610 14:68785520-68785542 GGTGGGGCCTCTGTGGCTACTGG - Intergenic
1119777840 14:77259354-77259376 GTTGCGTCCTCTGGGGCCCCCGG + Exonic
1121031134 14:90659617-90659639 GAAGGGGCCAATGGGGCCAGCGG + Intronic
1121096062 14:91218809-91218831 GTGGGGGACTCAGGGTCCACTGG + Intronic
1121326061 14:93020212-93020234 AAAGAGGACTCTGGGGCCACTGG - Intronic
1121716610 14:96080705-96080727 GCAGGGCCCTCTGAGGCCCCTGG + Intronic
1121911565 14:97796766-97796788 GTCTGGGCCCCTGGGGCTACTGG - Intergenic
1122206632 14:100150925-100150947 GCTGGGGCCTCCGGAGCCACTGG + Intronic
1122414141 14:101540773-101540795 GCCAGGGCCTCTGGGGCCACAGG + Intergenic
1122597531 14:102903664-102903686 GTAGGGGCAGCTGCAGCCACGGG + Intronic
1123116219 14:105895263-105895285 GGAGGGGCTTCTGGGACCACTGG + Intergenic
1123478527 15:20610579-20610601 GGAGGGTGCACTGGGGCCACAGG - Intergenic
1123639486 15:22389806-22389828 GGAGGGTGCACTGGGGCCACAGG + Intergenic
1124414413 15:29463166-29463188 GTTGGAGCCACTGGGGCCCCAGG + Intronic
1124422852 15:29537764-29537786 GTAGGGGCCTCCTGAGTCACTGG - Intronic
1124626834 15:31312524-31312546 GTGGGGGGCTCCTGGGCCACCGG + Intergenic
1126695444 15:51321793-51321815 TCATGGGCCTCTGGGGCCAGAGG - Intronic
1126794583 15:52249787-52249809 GTTGGGGACTCTGGGACCAAAGG + Intronic
1128159367 15:65413408-65413430 GTAGGTTCCTCTGGGGCCTTGGG - Intronic
1129239368 15:74242522-74242544 GCAGGGCCCTGAGGGGCCACTGG - Intronic
1130259683 15:82345399-82345421 GCTGGGGGCTCTGGGGCCAGGGG + Exonic
1130281552 15:82523610-82523632 GCTGGGGGCTCTGGGGCCAGGGG - Intergenic
1130472925 15:84239793-84239815 GCTGGGGGCTCTGGGGCCAGGGG - Exonic
1130484631 15:84391920-84391942 GCTGGGGGCTCTGGGGCCAGGGG - Intergenic
1130491353 15:84433765-84433787 GCTGGGGGCTCTGGGGCCAGGGG + Intergenic
1130502969 15:84512806-84512828 GCTGGGGGCTCTGGGGCCAGGGG + Intergenic
1130595217 15:85244429-85244451 GCTGGGGGCTCTGGGGCCAGGGG - Intergenic
1131034264 15:89210846-89210868 GTGGGAGCCTCTGAGGTCACTGG - Intronic
1131048046 15:89328652-89328674 GGAGGGGGCTCTGGGGACATGGG - Intronic
1132118736 15:99158532-99158554 GTATGGGCCACTGGGAGCACAGG + Intronic
1132872943 16:2123738-2123760 GCAGGGTCCTCTGGGGTCCCAGG + Intronic
1133130117 16:3671644-3671666 CTAGGGCCCTCTGGGGGCAAAGG + Intronic
1133237375 16:4393587-4393609 GTAGGGGGCTCTGGGGCTCCGGG + Intronic
1133271502 16:4612903-4612925 GCAGGAGCATCTGGGGCCTCTGG - Intronic
1133738601 16:8634218-8634240 GTAGGGTCCTCTTGGGCACCTGG - Intronic
1134530773 16:14981641-14981663 GTAGTGGTCTCTGGGAACACAGG + Intronic
1134829225 16:17309927-17309949 GTAGGGGCCCCAGGGGCCAGGGG + Intronic
1136116430 16:28097625-28097647 GTGGGTGCCACAGGGGCCACAGG + Intergenic
1136237476 16:28923902-28923924 GCTGGGGCGTCTGGGGCCAGAGG + Intronic
1136533867 16:30887825-30887847 AAAGGGGCCCCTGGGGCAACAGG + Intronic
1138478132 16:57284084-57284106 GTGGGGGCTTCTGTGGCCGCTGG + Intronic
1138584412 16:57960779-57960801 GGGGGGGCTTCTGGGGCCCCAGG - Intronic
1139296932 16:65909402-65909424 GAGGGGGCCTCTGGGGCTGCAGG - Intergenic
1139849578 16:69942489-69942511 GTAGGTCCCTCTGGGGACAAGGG - Intergenic
1139865575 16:70059383-70059405 GTAGTGGTCTCTGGGAACACAGG - Intergenic
1142150353 16:88509939-88509961 ACAGGGGCCTCTGGGGCCTCGGG + Intronic
1142764578 17:2058053-2058075 GAAGTGGCCGCTGGGGCCGCCGG + Exonic
1143183761 17:4998777-4998799 TTGGGGTCCACTGGGGCCACAGG + Intronic
1143611761 17:8022043-8022065 CCAGGGGCCGCTGAGGCCACAGG + Intergenic
1145979458 17:29003286-29003308 TCAGGGGCGTCTTGGGCCACGGG - Intronic
1146352976 17:32111465-32111487 CCAGGGGCCTCCTGGGCCACGGG - Intergenic
1146397817 17:32482829-32482851 GCGGGGGGCTCTGGGACCACTGG + Exonic
1146559711 17:33857542-33857564 TCAGAGGCCTCTGGGGCCACTGG + Intronic
1147210232 17:38869050-38869072 GTAGGGATTTCTGCGGCCACGGG - Intergenic
1147562984 17:41520330-41520352 GATGGGGGCTCTTGGGCCACAGG - Exonic
1148238117 17:45982955-45982977 GGAGAGGCCTCTGGGGTCTCTGG + Intronic
1148842714 17:50508979-50509001 AGAGGGGCCTCAGGGACCACTGG + Intronic
1148936168 17:51166143-51166165 GTAGGAGCTTTTGGGGTCACGGG + Intronic
1149980494 17:61307212-61307234 GTGGGGTATTCTGGGGCCACAGG - Intronic
1150361056 17:64534442-64534464 TGAAGGGCTTCTGGGGCCACTGG + Intronic
1150612696 17:66746998-66747020 GTAGGGGGTTCTCGGGACACAGG - Intronic
1151475573 17:74342845-74342867 GTTGGGGCCTCTGGGGCTGGAGG - Intronic
1151782815 17:76258556-76258578 CTGGGGGCCTCTTGGGGCACTGG + Intergenic
1151958165 17:77390955-77390977 GTATGGGCCTCTTGAGCCAGAGG + Intronic
1151987875 17:77555794-77555816 GGAGGGGGCTCGGGGGCTACAGG - Intergenic
1152363313 17:79842250-79842272 GAAGGGCCCTCTGGGGCATCAGG - Intergenic
1152460881 17:80441768-80441790 GCTGGGGCCACTGGGGCCGCTGG - Intergenic
1152597240 17:81243801-81243823 GGAGGGGGCTGTGGGGCCAGGGG - Intergenic
1152812501 17:82388703-82388725 GTCGGGGCCTGTGAGGCCACAGG - Intergenic
1152848257 17:82615828-82615850 CCAGGGGCCTCCTGGGCCACGGG - Exonic
1153515311 18:5895864-5895886 TTTGGGGCCTCTGGGGCCCGCGG - Exonic
1156627887 18:38931625-38931647 GAAGGGTGCTCAGGGGCCACGGG + Intergenic
1157605665 18:48924423-48924445 GTGGGGGCCTCTGGGGGCAGAGG + Intronic
1158940461 18:62402514-62402536 CTAGGGGACACTGGGGCCAGTGG - Intergenic
1160367050 18:78335427-78335449 GGAGGGGCCTATGAGGCCAGAGG + Intergenic
1160419215 18:78732634-78732656 GTGGGGGATTCTGGGGCCATGGG - Intergenic
1160568715 18:79802298-79802320 GGAGGGGCGTCTGGGGACCCTGG + Intergenic
1160749620 19:727727-727749 GGTGGGGCCTCGGGGGCCGCTGG + Intronic
1161009742 19:1954478-1954500 CTAGGTGCCTCTGAGGGCACTGG + Intronic
1161321679 19:3644342-3644364 GTAGGGGTCTGGTGGGCCACAGG - Intronic
1161469950 19:4452250-4452272 GCAGTGGCCTCTGGGGACTCTGG + Intronic
1161470847 19:4456203-4456225 GTGGGGGGTGCTGGGGCCACTGG - Intronic
1161714624 19:5868251-5868273 GTGGGGGGATCTGGGGCCCCAGG + Intronic
1163574831 19:18104540-18104562 GTAGGGGCCGATGGCGTCACTGG + Intronic
1163612576 19:18308997-18309019 GGTGGGGCCTCTGGGGTCCCCGG - Intronic
1163655486 19:18543062-18543084 GGGGGGGCGTCTGGGGACACTGG - Intronic
1163777563 19:19227185-19227207 GAGGGGGCTTCTGGGGCCAGAGG - Intronic
1164028632 19:21379629-21379651 GTAGGGGCCTTTGAAGACACTGG - Intergenic
1164649094 19:29879328-29879350 GTAGTCGCCTTTGGCGCCACTGG + Intergenic
1165854186 19:38870105-38870127 GGCGGGGCCTCCGGGGGCACAGG - Exonic
1166747374 19:45147703-45147725 GCAGGGGCCTGGGGGGCCATGGG + Intronic
1167141102 19:47651321-47651343 GTGGGCGCCTCAGGGACCACGGG - Intronic
1167252158 19:48405112-48405134 GGCGGGGGCTCTGGGGCCCCTGG + Exonic
1167391897 19:49200676-49200698 GGAGGGGCTCCTGAGGCCACGGG + Exonic
1167499131 19:49835766-49835788 GTAGGGGCCTCTGGGGCCACGGG + Exonic
1167539235 19:50074761-50074783 GAAGGATCTTCTGGGGCCACAGG - Intergenic
1167630472 19:50623097-50623119 GAAGGATCTTCTGGGGCCACAGG + Intronic
1168271979 19:55254999-55255021 GAAAGGGCCACTGGGGCCAGAGG + Intronic
1168308874 19:55451139-55451161 GTCGGCGCCTCTGGGGTCTCGGG + Intergenic
925325903 2:3021900-3021922 GTAGGGGCCACTGGAGCCCCTGG + Intergenic
925761998 2:7193868-7193890 GGTGGGGCCTCTGGGGGCAGGGG + Intergenic
927949711 2:27159293-27159315 GCTGGGGCCTCTGGGGCCCAAGG - Intergenic
929535981 2:42784386-42784408 GTATGTGGCTCTGGAGCCACTGG + Intronic
929780823 2:44955767-44955789 GCAGCGCGCTCTGGGGCCACTGG + Intergenic
931253780 2:60553850-60553872 GGAGGGGGCGCTGGGGCCGCGGG + Intergenic
932408774 2:71532520-71532542 GCAGGGATCTCTGGGGCCACAGG + Intronic
933689976 2:85172298-85172320 GTGGTGGCCACAGGGGCCACGGG - Intronic
935587610 2:104815869-104815891 GCAAAGGCCTCTGAGGCCACAGG + Intergenic
935820220 2:106886668-106886690 GGAGGGGGCTCTGGGGCGAGCGG - Intronic
936345769 2:111673771-111673793 GCAGGGGTCTCTGGGGCTGCCGG - Intergenic
937383044 2:121398932-121398954 GAAGGGGCTTCTGGGACCCCAGG - Intronic
937887233 2:126908228-126908250 GAGGGGGCTTCTGGGACCACAGG - Intergenic
937968180 2:127530470-127530492 GTAGGGGCTTCTGAGGCCCTGGG - Intergenic
938337127 2:130510284-130510306 GAGGGGGCATTTGGGGCCACAGG + Intergenic
938352710 2:130610447-130610469 GAGGGGGCATTTGGGGCCACAGG - Intergenic
938473955 2:131590612-131590634 GAGGGGGCATTTGGGGCCACAGG - Intergenic
938711953 2:133982580-133982602 GTAAGGGCCTCTGGGGCAGCTGG - Intergenic
938728852 2:134130310-134130332 GTAGGGGAGGCTGGGGCTACTGG - Intronic
940774767 2:157875083-157875105 ATGTGGGCCTCTGGGGCCGCTGG - Exonic
941218224 2:162740000-162740022 ATAGTGGCCTCTTGGGGCACTGG - Intronic
946952768 2:224895244-224895266 AAAGGTGCTTCTGGGGCCACAGG + Intronic
948276043 2:236709560-236709582 CTATGGGCCTCAGGGACCACAGG + Intergenic
948660146 2:239501915-239501937 GGAGGGCCCTTTGTGGCCACTGG + Intergenic
948690124 2:239696763-239696785 GTAGGGGCCTGAGAGGCCCCTGG - Intergenic
948753997 2:240148757-240148779 ATACGGGTCTCTGGGGACACGGG + Intergenic
948797302 2:240411652-240411674 GTGAGGGCCTCTTGGGCCACAGG - Intergenic
948805843 2:240453246-240453268 GTAGGTGCAGCTGGGGCGACGGG - Intronic
948906878 2:240983877-240983899 GCAGGGGCCTCTGGGGCTCTGGG - Intronic
1168877497 20:1181455-1181477 GTTGGGGCCACTGGGCCCAGGGG + Exonic
1169971266 20:11271552-11271574 ATAGTGGCCTCTGGGGGCGCCGG - Intergenic
1170426615 20:16241514-16241536 TTGGGGGCCTCTAGGACCACAGG - Intergenic
1172203154 20:33140817-33140839 TGGGGGGCCTCTGTGGCCACGGG + Intergenic
1172612615 20:36262939-36262961 GTCTGGGCCTCTGGAGACACCGG + Intronic
1173056136 20:39614948-39614970 GTAGTTGCCTCTGGGGTCAGTGG - Intergenic
1173557274 20:43974740-43974762 GTAGTGCCCCCTAGGGCCACAGG - Intronic
1173669724 20:44790369-44790391 GGAGGGGTCTATGGGACCACAGG - Intronic
1175850309 20:62087106-62087128 TTAGGGGTCTCTGAGACCACCGG + Intergenic
1175893211 20:62324414-62324436 GTAGGGGCTGGTGGGGCCAGGGG - Intronic
1176130735 20:63495775-63495797 CTGGGGGCCCCTGGGGTCACTGG - Intronic
1176204813 20:63882531-63882553 GCAGGGGCCTCTGGGGGCCGAGG + Intronic
1176302148 21:5103614-5103636 GTCGGGGCCTCCGAGGCCTCTGG + Intergenic
1179279823 21:39924940-39924962 ACAGGCTCCTCTGGGGCCACAGG + Intronic
1179660064 21:42868636-42868658 GTAGGGGCCTTGGGCCCCACAGG + Intronic
1180474254 22:15688557-15688579 GAGGGGGCATTTGGGGCCACAGG - Intergenic
1180855847 22:19044244-19044266 CAAGGGGCCTCTGGGGCCCCTGG - Intronic
1180933799 22:19611025-19611047 GGAGGGGCCTCTGGGCATACGGG - Intergenic
1182805217 22:33064078-33064100 GTTGGGGCATCAGGGGCCAAGGG - Intergenic
1183067849 22:35375842-35375864 GTGGGGGCAACTGGGGCCCCTGG + Intergenic
1183508495 22:38222065-38222087 GTTGGGGCATGTGGGGCCAGAGG + Intronic
1183949330 22:41343898-41343920 GTAGGGCCCTGAGGGGCCGCGGG + Intronic
1184688839 22:46108415-46108437 TGAGGGGCCTGTGGGGACACTGG - Intronic
1185322214 22:50206839-50206861 GCAGGGGGCTCCAGGGCCACGGG + Intronic
950413446 3:12854228-12854250 GTAAGGGGCTCTGGGACCTCAGG - Intronic
950577437 3:13840904-13840926 GTAGGGGACTATGGGACCCCAGG - Intronic
950655237 3:14432461-14432483 GTAGGGGCCCCTGGAGCCTGCGG - Intronic
950792947 3:15487831-15487853 GCAGGCACCTCTGGGTCCACAGG + Intronic
953451784 3:43012233-43012255 GAAGGGGCTTCTGAGGTCACAGG + Intronic
953904699 3:46862653-46862675 GGAAGGGCTCCTGGGGCCACTGG + Intronic
953992987 3:47498259-47498281 GCAGGGGCCTCCTGGGCAACAGG - Intronic
954907910 3:54078267-54078289 GGAGGGGTCTATGAGGCCACAGG - Intergenic
956049678 3:65234450-65234472 GTAGGGGGCTGTGGGGGCCCAGG + Intergenic
960115082 3:113885259-113885281 GTGGGGGCCTCCGGGGCCGGCGG + Intronic
960993452 3:123326162-123326184 GAAGTGGCCTCTTGGGCCCCGGG - Intronic
961356792 3:126344526-126344548 GCAGGGGTCTCTGAGGCCACAGG + Intronic
961449131 3:126994636-126994658 GTAGAGGCCTGTGTGGCCAGCGG - Intronic
961791909 3:129382327-129382349 GTAAGGGGCTCTGGGACCTCAGG + Intergenic
962199899 3:133392551-133392573 GTAGGTGAGTCTGGGGCCAGGGG - Intronic
966104566 3:176321236-176321258 CTGGGGACCTCTGGGGCCAGGGG + Intergenic
968600184 4:1505063-1505085 AGAGTGGCCTCTGGGGCCACTGG + Intergenic
968878958 4:3288814-3288836 CTGGGGGCCTCAGGGGCCCCAGG + Intergenic
969292537 4:6249261-6249283 GCAGGGGCCGCAGGAGCCACAGG - Intergenic
969450672 4:7271290-7271312 TTAGGGCCGTGTGGGGCCACTGG - Intronic
969456631 4:7303899-7303921 GCAGGGGCCTGAGGGGCCAAGGG + Intronic
978458317 4:108920586-108920608 TTAGGGTCCTCTAGGGCCTCCGG - Exonic
978493380 4:109333126-109333148 GTAGCGCCCTCTGGGGCCAAAGG + Intergenic
981300940 4:143185197-143185219 GTACGGGCCTCTGGCGCCTTAGG + Exonic
981367492 4:143920064-143920086 CTAGGGGCCTCTGTGGCCCTGGG + Intergenic
984431867 4:179660848-179660870 GCTGTGGCCTGTGGGGCCACTGG - Intergenic
985669619 5:1200768-1200790 CAAGGGCCCTCTGGGGTCACGGG - Intergenic
991929520 5:71738796-71738818 GTAGGAGTCTCTGGGGCCTGAGG + Intergenic
992940074 5:81751950-81751972 GCAGGGGCCGCTGCGGCCGCAGG - Intergenic
995537014 5:113146673-113146695 TTAGCGGCCTCTGGGACCAAAGG + Intronic
996455068 5:123672190-123672212 GGAGGCTCTTCTGGGGCCACTGG + Intergenic
997204214 5:132032363-132032385 GTGCAGGCCTCTAGGGCCACAGG - Intergenic
998349765 5:141492806-141492828 GAAGGGGCCGCTGGTGCCACTGG - Intronic
998680072 5:144457360-144457382 GTGGTGGCCTCTAGGGGCACTGG + Intronic
999135449 5:149315915-149315937 GTAGGAGCCTCTGGGGGCTCAGG + Intronic
1001879680 5:175232534-175232556 GTAAGGGGCTCAGGGACCACGGG - Intergenic
1002081579 5:176740650-176740672 GCAGAGGCCTCTGGGGCCAGAGG + Intergenic
1002169247 5:177366249-177366271 GAAGGGGCTGCTGGGACCACTGG - Exonic
1002424530 5:179167360-179167382 CTTGGGGCCGCTGGGGCCCCGGG - Intronic
1002517047 5:179766431-179766453 GTAGGGGCCTCCGGGCCGAGGGG - Exonic
1002924039 6:1594687-1594709 CTTGGGCCCTCGGGGGCCACGGG + Intergenic
1006334971 6:33415636-33415658 GCAGGGACCTCTGGGGACAGTGG + Exonic
1006736479 6:36277215-36277237 GCAGGGGGCTCTTGGACCACAGG - Intronic
1007431915 6:41781380-41781402 GAGGGGGCGTCTGGGGCCCCAGG - Exonic
1008033860 6:46725818-46725840 GAAGGGGCCAAGGGGGCCACGGG + Intronic
1008588031 6:52966604-52966626 GCAGGGGTCTCTGGGGCCTCAGG + Intergenic
1011099883 6:83709021-83709043 GTACTGGCTTCTGGGGCCAGGGG - Intronic
1015787219 6:136930306-136930328 GCAGAGGCCACTGGGGCCATTGG - Intergenic
1016649394 6:146447084-146447106 TTGGGAGCCTCTGGGGCCATGGG - Intergenic
1019093084 6:169556167-169556189 GTAGGAGCCTTGGGGGCCTCAGG + Intronic
1019709383 7:2511369-2511391 GGAGGGGGCTCCGGGGTCACAGG - Intergenic
1022137840 7:27466226-27466248 GCAGGGTCCTCGGGGGCAACCGG + Intergenic
1022895567 7:34747472-34747494 GCAGGGCCTTCTTGGGCCACGGG - Intronic
1023565315 7:41518500-41518522 GTAGGGGACTCTTGGGCCTTTGG - Intergenic
1024516991 7:50267594-50267616 GCAGGGGCCTCGGGAGCCAGAGG - Intergenic
1027190352 7:75992748-75992770 GTGGGGGTCTCTGGGCTCACAGG - Intronic
1027199571 7:76054851-76054873 CTAGGGGCCTCTGGAGGCATCGG + Exonic
1027238814 7:76314189-76314211 AGAGGGGTCTTTGGGGCCACGGG - Intergenic
1029253083 7:99250848-99250870 GGAGGGGCACCTGGGGACACGGG - Intergenic
1029302771 7:99598249-99598271 GCCGGGGCCTCTGGGGCCAACGG + Intronic
1029620790 7:101688681-101688703 GGAGAGGCCCCTGGGACCACGGG - Intergenic
1029670799 7:102029397-102029419 GTAGGTTCCTCTTGGGACACAGG + Intronic
1032335208 7:131018516-131018538 GGAAGGGCCTCTCAGGCCACTGG + Intergenic
1033021009 7:137724238-137724260 GGAGAGGCATCTGGGGCCAGAGG + Intronic
1034910612 7:154995228-154995250 GGAGGGGCCACTGTGACCACAGG + Intronic
1035285730 7:157805788-157805810 GTGGGGGCTCCTGGGGCCTCTGG - Intronic
1036646270 8:10612775-10612797 GCAGTGGCCTGTGGGGCCACGGG - Exonic
1037811389 8:22089164-22089186 GCCGGGGCCGCCGGGGCCACGGG + Intronic
1038433537 8:27518908-27518930 ATAGGGGCTCCTGGGGTCACTGG - Intronic
1040683898 8:49847188-49847210 GGAAGGGCCTCTGGGGGCTCTGG + Intergenic
1047494764 8:125401742-125401764 GCAGGGGATTCTGGGGGCACAGG - Intergenic
1048992978 8:139772240-139772262 GCACGGGCCTGTAGGGCCACAGG - Intronic
1049734813 8:144199339-144199361 TCAGAGGCCTCTGGAGCCACAGG - Intronic
1052376470 9:27723590-27723612 GTAGGGACCTCTGGGGCATTGGG - Intergenic
1053752302 9:41269133-41269155 CAAGGGGCCTCTAGAGCCACTGG + Intergenic
1057199949 9:93134469-93134491 GCAGGGTCCTCTGGGGCCATCGG - Intergenic
1057274436 9:93668809-93668831 CTAGGGGCCACTGAGGCCGCCGG + Intronic
1057486953 9:95493130-95493152 GTATGGGCCTCTGGGTCAGCTGG - Intronic
1059770054 9:117415570-117415592 GAAGGGGGCTCTGAGGCTACAGG - Intergenic
1060295903 9:122342854-122342876 TTAGAGGCCTCTGGGGCCCGGGG + Intergenic
1060804310 9:126564918-126564940 GCAGGTGGCTCTGGGGACACAGG + Intergenic
1061005854 9:127928112-127928134 GTAGGGGCCGCCGGGGCCCAGGG + Exonic
1061316558 9:129799893-129799915 CATGGGGCCGCTGGGGCCACCGG - Intergenic
1061435162 9:130556618-130556640 GGCGGGGCGTCTGGGACCACCGG - Intergenic
1061726924 9:132587167-132587189 GACGGGACCTCTGGGGCCCCGGG - Intronic
1062116579 9:134812618-134812640 GGAGGGTCCTCGGGGGCCAGGGG - Exonic
1062666257 9:137674459-137674481 GTCAGGGCATCTGGGGACACTGG - Intronic
1187501740 X:19844632-19844654 GTAGGGGACTCAAGGCCCACAGG - Intronic
1191249953 X:58255534-58255556 GCTGGGCCCTCTGGGGTCACCGG - Intergenic
1196983326 X:121239799-121239821 GTAGTGGCCCCTGGCACCACAGG + Intergenic
1200074647 X:153545017-153545039 GAAGGGCCCTCTGTGCCCACAGG + Intronic
1201057642 Y:10011582-10011604 GTGTGGGCCTCTGTGGGCACAGG + Intergenic
1202366941 Y:24172106-24172128 GCTGGGGGCTCTGGGGCCAGGGG - Intergenic
1202373465 Y:24213377-24213399 GCTGGGGGCTCTGGGGCCAGGGG + Intergenic
1202497316 Y:25456743-25456765 GCTGGGGGCTCTGGGGCCAGGGG - Intergenic
1202503841 Y:25498017-25498039 GCTGGGGGCTCTGGGGCCAGGGG + Intergenic