ID: 1167499132

View in Genome Browser
Species Human (GRCh38)
Location 19:49835767-49835789
Sequence TAGGGGCCTCTGGGGCCACG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 204}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167499121_1167499132 -5 Left 1167499121 19:49835749-49835771 CCCAGCCTCAGGGTACCGTAGGG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1167499132 19:49835767-49835789 TAGGGGCCTCTGGGGCCACGGGG 0: 1
1: 0
2: 1
3: 32
4: 204
1167499118_1167499132 2 Left 1167499118 19:49835742-49835764 CCGCAGCCCCAGCCTCAGGGTAC 0: 1
1: 0
2: 8
3: 89
4: 738
Right 1167499132 19:49835767-49835789 TAGGGGCCTCTGGGGCCACGGGG 0: 1
1: 0
2: 1
3: 32
4: 204
1167499109_1167499132 25 Left 1167499109 19:49835719-49835741 CCCACCAGCTCCAGCTCCGCCCA 0: 1
1: 0
2: 4
3: 51
4: 450
Right 1167499132 19:49835767-49835789 TAGGGGCCTCTGGGGCCACGGGG 0: 1
1: 0
2: 1
3: 32
4: 204
1167499112_1167499132 15 Left 1167499112 19:49835729-49835751 CCAGCTCCGCCCACCGCAGCCCC 0: 1
1: 0
2: 11
3: 181
4: 1466
Right 1167499132 19:49835767-49835789 TAGGGGCCTCTGGGGCCACGGGG 0: 1
1: 0
2: 1
3: 32
4: 204
1167499116_1167499132 5 Left 1167499116 19:49835739-49835761 CCACCGCAGCCCCAGCCTCAGGG 0: 1
1: 0
2: 8
3: 120
4: 842
Right 1167499132 19:49835767-49835789 TAGGGGCCTCTGGGGCCACGGGG 0: 1
1: 0
2: 1
3: 32
4: 204
1167499113_1167499132 9 Left 1167499113 19:49835735-49835757 CCGCCCACCGCAGCCCCAGCCTC 0: 2
1: 1
2: 39
3: 272
4: 2133
Right 1167499132 19:49835767-49835789 TAGGGGCCTCTGGGGCCACGGGG 0: 1
1: 0
2: 1
3: 32
4: 204
1167499119_1167499132 -4 Left 1167499119 19:49835748-49835770 CCCCAGCCTCAGGGTACCGTAGG 0: 1
1: 0
2: 0
3: 6
4: 149
Right 1167499132 19:49835767-49835789 TAGGGGCCTCTGGGGCCACGGGG 0: 1
1: 0
2: 1
3: 32
4: 204
1167499114_1167499132 6 Left 1167499114 19:49835738-49835760 CCCACCGCAGCCCCAGCCTCAGG 0: 1
1: 0
2: 16
3: 145
4: 1104
Right 1167499132 19:49835767-49835789 TAGGGGCCTCTGGGGCCACGGGG 0: 1
1: 0
2: 1
3: 32
4: 204
1167499111_1167499132 21 Left 1167499111 19:49835723-49835745 CCAGCTCCAGCTCCGCCCACCGC 0: 1
1: 0
2: 1
3: 68
4: 668
Right 1167499132 19:49835767-49835789 TAGGGGCCTCTGGGGCCACGGGG 0: 1
1: 0
2: 1
3: 32
4: 204
1167499123_1167499132 -6 Left 1167499123 19:49835750-49835772 CCAGCCTCAGGGTACCGTAGGGG 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1167499132 19:49835767-49835789 TAGGGGCCTCTGGGGCCACGGGG 0: 1
1: 0
2: 1
3: 32
4: 204
1167499110_1167499132 24 Left 1167499110 19:49835720-49835742 CCACCAGCTCCAGCTCCGCCCAC 0: 1
1: 1
2: 9
3: 98
4: 770
Right 1167499132 19:49835767-49835789 TAGGGGCCTCTGGGGCCACGGGG 0: 1
1: 0
2: 1
3: 32
4: 204
1167499125_1167499132 -10 Left 1167499125 19:49835754-49835776 CCTCAGGGTACCGTAGGGGCCTC 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1167499132 19:49835767-49835789 TAGGGGCCTCTGGGGCCACGGGG 0: 1
1: 0
2: 1
3: 32
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167499132 Original CRISPR TAGGGGCCTCTGGGGCCACG GGG Exonic
900596528 1:3482632-3482654 TGGGGGCATCTGGGGCAACCTGG + Intergenic
900612363 1:3549511-3549533 TGGGGGCTTCTGGGGGCACATGG + Intronic
900637178 1:3671663-3671685 TCGGGGCCTCTGGGAACACCTGG + Intronic
901415077 1:9110988-9111010 TAAGGGCCTGTGGGGGCACAGGG - Intronic
901529105 1:9842652-9842674 CAGAGGCCTCTGGGTCCACTGGG - Intergenic
901845673 1:11980563-11980585 GACGGGATTCTGGGGCCACGGGG + Intronic
902400819 1:16155796-16155818 TAGGGGGCACTGGGGCCCGGGGG + Intronic
902437524 1:16408153-16408175 AAGGGGCCGCTGTGGCCAAGAGG + Intronic
902809282 1:18879252-18879274 GAGGGGTCCCTGGGGCCACACGG + Intronic
903361529 1:22780242-22780264 TGGGGGTCTCTAGGGCCATGTGG + Intronic
903657961 1:24960514-24960536 AAGGGGGCTCTGGGGCGGCGGGG - Intronic
904348883 1:29892106-29892128 AAGGAGCATCTGGGGCCAAGAGG - Intergenic
905798270 1:40827599-40827621 AAGGTGCCTCTGGGGCCCTGTGG + Intronic
906718467 1:47988005-47988027 CAGGGGTGTCTGGGGCCTCGGGG + Intronic
912434868 1:109654707-109654729 TAGGGGCCACAGTGGCCACGAGG - Intergenic
915891870 1:159780965-159780987 TCGGCGCCTCCCGGGCCACGTGG - Intronic
916166898 1:161972854-161972876 TAGGGGCCACTGGGCCCTGGTGG + Intergenic
917738299 1:177939913-177939935 TAGGGGCCTGGGGGGTCACGTGG + Intronic
919778531 1:201208822-201208844 TAGGGGGTTCTGGGGCAATGGGG + Exonic
922125085 1:222713418-222713440 TAGGTTCCTCTGGGGACTCGGGG + Intronic
924928519 1:248706528-248706550 TAGGGGTCTCTGGGTCCCCCAGG - Intergenic
1063197931 10:3760254-3760276 TGGGGGCCTCTGGGTGCCCGGGG + Intergenic
1063639240 10:7814304-7814326 TGGGGGCATCTGAGGCCAAGTGG + Intergenic
1067105156 10:43361627-43361649 TGGTGGCCTGTGGGACCACGTGG + Intergenic
1069929713 10:71874242-71874264 TAGAGGCCACTGAGGCCACCTGG - Intergenic
1070813649 10:79310691-79310713 CGGGGACCTCTCGGGCCACGTGG - Intronic
1071531251 10:86391763-86391785 CAGGGACCTCCCGGGCCACGTGG - Intergenic
1072757343 10:98030105-98030127 AGGGGGCCTCTGGGGCCTGGAGG - Intronic
1075501645 10:122980336-122980358 CAGGTGCCTCTGGGGCCGCACGG + Exonic
1075654162 10:124150464-124150486 TGGGGGCCTGTGAGGCCAGGAGG + Intergenic
1076110384 10:127855464-127855486 GAGGGGCCTGTGGGGACAAGGGG - Intergenic
1076525909 10:131112332-131112354 TTGGGGCATCTGGGCCCAGGAGG - Intronic
1076706138 10:132302562-132302584 CAGGGGCCTCTGCAGCCACCAGG + Intronic
1076848603 10:133082128-133082150 GTGGGGCCTGTGGGGCCTCGGGG + Intronic
1076995661 11:296418-296440 TAGGGGCCGGGGGAGCCACGTGG - Intergenic
1077158818 11:1103472-1103494 TGGGGGCCTCGGGGGCCATGGGG - Intergenic
1077392050 11:2304722-2304744 GAGGGGCCTATGGGACCTCGGGG - Intronic
1077579053 11:3405139-3405161 AAAGGGCCTCTGGGGCCACCTGG - Intergenic
1077902300 11:6499017-6499039 TGGGTGCCTCTGGGGTCACTTGG + Intronic
1078172370 11:8938029-8938051 CCGGGGCCTCTGGGTGCACGTGG + Exonic
1078857141 11:15215473-15215495 TTGGGGCCTCTGGGGAGAAGAGG - Intronic
1079351840 11:19698389-19698411 CAGGGCTCTCTGGGCCCACGGGG - Intronic
1081793868 11:45806339-45806361 GAGTGGCAGCTGGGGCCACGGGG + Intronic
1081969065 11:47186027-47186049 GAGGACCCTCTGGGGCCTCGGGG + Intronic
1084236075 11:67788658-67788680 AAAGGGCCTCTGGGGCCACCTGG - Intergenic
1084266698 11:68008745-68008767 CCGGGGCCTCTGGGCCAACGTGG - Intronic
1084786934 11:71448114-71448136 GAGGGGCCGCTGGGGCTCCGGGG - Intronic
1084836325 11:71804332-71804354 AAAGGGCCTCTGGGGCCACCTGG + Intergenic
1085205908 11:74731650-74731672 AAGGGGCCACGCGGGCCACGGGG + Intergenic
1088350074 11:108876438-108876460 GAGGGGCCTTTGGAGCCATGAGG + Intronic
1088753380 11:112864926-112864948 CTGGGGCCTCTAGGGCAACGCGG + Intergenic
1089046054 11:115503400-115503422 TCGCGGCCTCTGCGGCCAGGCGG - Intronic
1091164649 11:133464451-133464473 TGGGGCGCTCTGGGGCCATGTGG + Intronic
1092406984 12:8228022-8228044 AAAGGGCCTCTGGGGCCACCTGG - Intergenic
1092943062 12:13428296-13428318 AAGGGGTGTCTGGGGCCACCAGG + Intergenic
1097357780 12:58621167-58621189 AAGGGGCCTCTGGGCCCACCAGG - Intronic
1102370924 12:112381966-112381988 CCGCGGCCTCTGGGGCCCCGAGG + Exonic
1102432489 12:112894502-112894524 AAGGGGCCTTTGGGGTCAAGAGG + Intronic
1102525986 12:113512645-113512667 TGGGGGCCTCTGGGGAGAGGTGG - Intergenic
1103732634 12:123038011-123038033 AAGGGGCCTCTGGGCCCTCCAGG - Intronic
1104861003 12:131923460-131923482 GAGGGGCTTTCGGGGCCACGTGG + Intergenic
1105303005 13:19152031-19152053 CAGCCGCCTCTGGGGCCACCGGG + Intergenic
1112438608 13:99408962-99408984 TGCGGGCCACTGGGGCCAGGAGG + Intergenic
1112666190 13:101576592-101576614 TAGGGCCCAATGGGGCCACGTGG + Intronic
1113788778 13:113016471-113016493 TCAGGGTCTCTGGGCCCACGTGG - Intronic
1119486134 14:74988206-74988228 TAGGGGCCACTTGGGGCACGAGG + Intergenic
1119768503 14:77205735-77205757 GAGGGGCTCCTGGGGCCAAGAGG + Intronic
1121326060 14:93020211-93020233 AAGAGGACTCTGGGGCCACTGGG - Intronic
1122202201 14:100129423-100129445 AAGGGGCCTCAGGGGCCATCTGG - Intronic
1122411205 14:101527042-101527064 AAGGGGCAGCTGGGGACACGGGG + Intergenic
1123116220 14:105895264-105895286 GAGGGGCTTCTGGGACCACTGGG + Intergenic
1123192696 14:106586309-106586331 CAGGGGCATCTGGAGCCACAAGG - Intergenic
1123216069 14:106810372-106810394 CAGGGGCATCTGAGACCACGAGG - Intergenic
1124244202 15:28056062-28056084 CAGGGGCCCCTGGAGCCTCGTGG + Intronic
1128154572 15:65384643-65384665 TCAGGGCCTCTGGGGACAGGAGG + Intronic
1128506673 15:68277821-68277843 TAGGGGCCCCCGGGGCGATGCGG - Exonic
1129767746 15:78180970-78180992 CAGGGGCATCTGGGGCCCAGGGG + Intronic
1131912636 15:97224545-97224567 TTGGGGAGGCTGGGGCCACGCGG - Intergenic
1132146529 15:99432926-99432948 TGGGGGCCTCTGGGGAAAGGGGG - Intergenic
1132580251 16:681374-681396 GTGGGGCCTCTGGGGCCAGGCGG + Intronic
1132619080 16:855901-855923 TGAGGGCCTCTGGGTCCACCCGG + Intronic
1132810502 16:1794564-1794586 CAGGGGCCTCTGGAGGCAGGTGG - Intronic
1133479138 16:6152718-6152740 TATGGGTCTGTGGGCCCACGTGG - Intronic
1136009900 16:27356669-27356691 TGGGGGCATCTGGGGGCATGTGG + Intronic
1136374485 16:29857197-29857219 CGGGGGCCTCTTGGGCCACTTGG + Intergenic
1136873316 16:33827707-33827729 CAGGGGCATCTGAGACCACGAGG + Intergenic
1139268465 16:65660834-65660856 GAGGGGCATCAGGGGCCAAGGGG - Intergenic
1139341483 16:66270586-66270608 CAGGGGGCGCTGTGGCCACGCGG - Intergenic
1139956976 16:70697827-70697849 TGGGGGCATCTGGGGCCAAGTGG - Intronic
1141249844 16:82345434-82345456 TGGGGGACTCTGGGGCTAAGAGG - Intergenic
1142031406 16:87840288-87840310 TTGGGGCCTCTGGGGCCAGCAGG - Intronic
1142150354 16:88509940-88509962 CAGGGGCCTCTGGGGCCTCGGGG + Intronic
1203098859 16_KI270728v1_random:1288348-1288370 CAGGGGCATCTGAGACCACGAGG - Intergenic
1143611762 17:8022044-8022066 CAGGGGCCGCTGAGGCCACAGGG + Intergenic
1145979457 17:29003285-29003307 CAGGGGCGTCTTGGGCCACGGGG - Intronic
1147330851 17:39698582-39698604 CAGGGGCCTCTGGGACCAAGAGG - Intronic
1147651372 17:42063923-42063945 AGGGGGCATCTGGAGCCACGTGG - Intronic
1148478047 17:47941905-47941927 TCGGGGCTTCTGGGGCCACCCGG + Intronic
1150726296 17:67654011-67654033 TGGGGGCCTCTGGAACCTCGTGG - Intronic
1151555041 17:74842571-74842593 TGGGGGCCTCTGGGGCACAGGGG - Exonic
1152744419 17:82032272-82032294 TAGGGGCGTCTGGGGTCGAGAGG - Intronic
1152812500 17:82388702-82388724 TCGGGGCCTGTGAGGCCACAGGG - Intergenic
1155335751 18:24763874-24763896 TGAGGCCCTCTGGGGACACGAGG - Intergenic
1156627888 18:38931626-38931648 AAGGGTGCTCAGGGGCCACGGGG + Intergenic
1158940460 18:62402513-62402535 TAGGGGACACTGGGGCCAGTGGG - Intergenic
1160419214 18:78732633-78732655 TGGGGGATTCTGGGGCCATGGGG - Intergenic
1161009743 19:1954479-1954501 TAGGTGCCTCTGAGGGCACTGGG + Intronic
1161087560 19:2342179-2342201 GAGGGGACTCTGGGGCTTCGTGG + Intronic
1161655623 19:5512864-5512886 CCTGGGCCTCTGTGGCCACGTGG - Intergenic
1161698386 19:5782735-5782757 CAGGGGCCTCCTGGGGCACGAGG - Intergenic
1162416998 19:10544172-10544194 TCTGGGCCTCTGGGACCCCGCGG - Exonic
1162523794 19:11196464-11196486 TCGGGGTCACTGGGGCCATGGGG + Intronic
1162924591 19:13923836-13923858 AAAGGGCCACTGGGGCCACGTGG - Intronic
1164809954 19:31147914-31147936 TAGGGGTCTCTGGAGCCTGGAGG + Intergenic
1165093363 19:33397760-33397782 CAGGGGTGTCTGGGGCCACAAGG - Intronic
1165733009 19:38158459-38158481 GTGGAGCCTCTTGGGCCACGGGG + Intronic
1166379889 19:42350382-42350404 CAGGTGCCTGTGGGGCCACCAGG + Exonic
1166747375 19:45147704-45147726 CAGGGGCCTGGGGGGCCATGGGG + Intronic
1167499132 19:49835767-49835789 TAGGGGCCTCTGGGGCCACGGGG + Exonic
925325904 2:3021901-3021923 TAGGGGCCACTGGAGCCCCTGGG + Intergenic
933656495 2:84891565-84891587 ATGGGGCCTCGGGGGCCAAGTGG - Intronic
933689975 2:85172297-85172319 TGGTGGCCACAGGGGCCACGGGG - Intronic
934675756 2:96248646-96248668 TGGGGGCATCTGGGGCTACATGG + Exonic
942278659 2:174340715-174340737 TAGGCGCCCCTGGGGGCGCGGGG + Intergenic
942278702 2:174340876-174340898 CACAGGCCTCTGGGGCCCCGAGG - Intergenic
942484264 2:176422784-176422806 TTGTGGCCTTTGGGGCCAGGTGG - Intergenic
948753998 2:240148758-240148780 TACGGGTCTCTGGGGACACGGGG + Intergenic
948797301 2:240411651-240411673 TGAGGGCCTCTTGGGCCACAGGG - Intergenic
948906877 2:240983876-240983898 CAGGGGCCTCTGGGGCTCTGGGG - Intronic
1169120460 20:3092877-3092899 TAGGGGCCGCCGGGCCGACGGGG - Intergenic
1169971265 20:11271551-11271573 TAGTGGCCTCTGGGGGCGCCGGG - Intergenic
1173841120 20:46157935-46157957 CAGGGGCCGCTGGGTCCAGGTGG - Intergenic
1174111490 20:48200936-48200958 GAGGGCTCTCTGGGGCCACGAGG + Intergenic
1175862620 20:62158216-62158238 TGGGGGCTGCTGGGGGCACGGGG + Intronic
1175893210 20:62324413-62324435 TAGGGGCTGGTGGGGCCAGGGGG - Intronic
1176130734 20:63495774-63495796 TGGGGGCCCCTGGGGTCACTGGG - Intronic
1178125584 21:29512290-29512312 TGGGGGGCTCTGGGGTCCCGTGG + Intronic
1180007134 21:45028020-45028042 CAGGGGCTTCTGGGGCCCAGGGG - Intergenic
1180045028 21:45301345-45301367 CAGGGGCGGCCGGGGCCACGGGG - Intergenic
1180045773 21:45304445-45304467 GAGGGGCCTGTGGGGTCAGGTGG - Intergenic
1180855846 22:19044243-19044265 AAGGGGCCTCTGGGGCCCCTGGG - Intronic
1181573817 22:23781692-23781714 ATGAGGCCTCTGGGGCCCCGAGG + Intronic
1182943790 22:34303186-34303208 TTTGGGCCTCTGGGGCAATGAGG - Intergenic
1183224256 22:36538555-36538577 TTGGGGCCTCTCGGGCCTCTCGG - Intergenic
1183464726 22:37973795-37973817 TGGGGGCCCCTGGGGCCCCGCGG + Exonic
1183486282 22:38089217-38089239 CAGGGGCCTCGGGGGCTGCGGGG + Exonic
1183949331 22:41343899-41343921 TAGGGCCCTGAGGGGCCGCGGGG + Intronic
1183969931 22:41469194-41469216 CAGGGACCTCTGGGTTCACGGGG + Intronic
1184662153 22:45970435-45970457 GAGGGGCCTCTGGGGCAAGGTGG - Intronic
1184688838 22:46108414-46108436 GAGGGGCCTGTGGGGACACTGGG - Intronic
1185302770 22:50091115-50091137 TCAGGGCCTCTGGATCCACGAGG + Intronic
949501358 3:4683307-4683329 TAGGTGCATCTGGGCCCAAGGGG + Intronic
950533601 3:13567110-13567132 TGGGGGCCTGGGGGGCCAAGGGG + Intronic
950533789 3:13568149-13568171 AGGGAGCCTCTGGGGCCTCGAGG - Intronic
950543323 3:13625042-13625064 TGGTGGCCTCTGTGGCCCCGGGG + Intronic
957052043 3:75418457-75418479 AAAGGGCCTCTGGGGCCACCTGG - Intergenic
958562365 3:95763388-95763410 TAGTGGCCTCTGCTGCCACTTGG - Intergenic
960938913 3:122921030-122921052 CAGAGGCCTGTGGGGCCAAGAGG - Intronic
960978795 3:123202214-123202236 GAGGGTTCTCTGGGGCCAGGCGG + Intronic
961885652 3:130094689-130094711 AAAGGGCCTCTGGGGCCACCTGG - Intronic
968508714 4:985339-985361 GAGGAGCCTCTGAGGCCTCGGGG - Intronic
968614454 4:1571089-1571111 TGGGGGCCTCAGGGGCCAGGAGG + Intergenic
968994844 4:3938832-3938854 AAAGGGCCTCTGGGGCCACCTGG - Intergenic
969450671 4:7271289-7271311 TAGGGCCGTGTGGGGCCACTGGG - Intronic
969456632 4:7303900-7303922 CAGGGGCCTGAGGGGCCAAGGGG + Intronic
969759158 4:9169962-9169984 AAAGGGCCTCTGGGGCCACCTGG + Intergenic
970364210 4:15341979-15342001 TGGGGCCCTCTGGGGCCCTGGGG - Intronic
970432382 4:16000934-16000956 TAGGGGCCTGGGGACCCACGAGG + Intronic
978458316 4:108920585-108920607 TAGGGTCCTCTAGGGCCTCCGGG - Exonic
981355959 4:143789408-143789430 TAGGGGCCCCTGTGGCCCTGGGG + Intergenic
981367493 4:143920065-143920087 TAGGGGCCTCTGTGGCCCTGGGG + Intergenic
981377282 4:144030299-144030321 TAGGGGCTTCTGTGGCCCTGGGG + Intergenic
982745916 4:159103769-159103791 TCGGGCCCGCTGGGGCCAGGAGG + Intergenic
985669618 5:1200767-1200789 AAGGGCCCTCTGGGGTCACGGGG - Intergenic
986758530 5:10859230-10859252 TGGGGTCCTCTGGGGACACCTGG + Intergenic
986826579 5:11528867-11528889 CAGCAGCCTCTGGGGCCACCTGG - Intronic
987950266 5:24665509-24665531 AAGGGGCCTTTGGGAGCACGAGG - Intergenic
991183256 5:63778930-63778952 TAGGGGCCCCAGGGGCAAGGGGG + Intergenic
993033492 5:82731087-82731109 TAGGGGTGTCTGGGGACCCGTGG - Intergenic
993593328 5:89823187-89823209 TAGGAGGCTCTGGGGCCCAGTGG - Intergenic
993973917 5:94453567-94453589 TAGGTGGCTCAGGGGCCAGGTGG + Intronic
999296221 5:150461204-150461226 TCGGTGCCCCTGGGGCCACACGG + Intergenic
1002006525 5:176238754-176238776 TCCGGGCCTCTCGGGCCCCGGGG + Intronic
1002219853 5:177671882-177671904 TCCGGGCCTCTCGGGCCCCGGGG - Intergenic
1002455478 5:179343892-179343914 TAGTGGCCCCGGGCGCCACGAGG + Exonic
1002637674 5:180616198-180616220 TAGGGTCCCCTGGGGGCAGGAGG + Intronic
1003407730 6:5837568-5837590 TCTGGGCCACTGGGGCCACTTGG + Intergenic
1006535552 6:34696394-34696416 CAGCGGCCTCGGGGGCCCCGAGG - Intronic
1007612751 6:43160964-43160986 CAGGGGCCTCAGGGCCCAGGAGG - Exonic
1007819815 6:44552991-44553013 TCGGGGCCTCTGGGTCAACCAGG - Intergenic
1008588032 6:52966605-52966627 CAGGGGTCTCTGGGGCCTCAGGG + Intergenic
1010969308 6:82247413-82247435 GAGGGGACTCTGTGGCCCCGAGG - Intronic
1013182804 6:107732233-107732255 TAGGGCCCTCTGTGGCCTCCTGG + Intronic
1017051266 6:150395898-150395920 TAGGGGACTCAGTGGCCAAGGGG - Intronic
1017103084 6:150865683-150865705 TAGGGGCCCCTGGGACGAGGAGG + Exonic
1017993469 6:159510318-159510340 GAGGGGCCTCGGGGGCCACCCGG - Intergenic
1018537243 6:164834164-164834186 TAGGTGCCTTTGGAGCCAAGTGG - Intergenic
1018998757 6:168729727-168729749 GAGGGGCCTCTTGGGCCCCCTGG + Intergenic
1019618506 7:1978081-1978103 AAAGGGCCTCTGGAGGCACGCGG - Intronic
1020319105 7:6927155-6927177 AAAGGGCCTCTGGGGCCACCTGG - Intergenic
1022451374 7:30518569-30518591 TGTGGGCCACTGGGGCCACTAGG + Intronic
1027199572 7:76054852-76054874 TAGGGGCCTCTGGAGGCATCGGG + Exonic
1029515380 7:101020234-101020256 TGGGGGCCTCTTGGGCAGCGGGG - Intronic
1031629679 7:124032312-124032334 CCGGCGCCCCTGGGGCCACGGGG + Exonic
1035155523 7:156909075-156909097 TAGGGGGCGCTGAGGCCACACGG + Intergenic
1035280203 7:157773579-157773601 TAGTGGGCTGTGGGGCCAGGCGG + Intronic
1036381306 8:8237993-8238015 AAAGGGCCTCTGGGGCCACCTGG + Intergenic
1036847356 8:12178999-12179021 AAAGGGCCTCTGGGGCGACCTGG - Intergenic
1036868721 8:12421320-12421342 AAAGGGCCTCTGGGGCGACCTGG - Intergenic
1037811391 8:22089165-22089187 CCGGGGCCGCCGGGGCCACGGGG + Intronic
1040469758 8:47727436-47727458 AAGAGGCCTCTGGGGCCCAGTGG + Intronic
1040596072 8:48839038-48839060 TGGAGGGCTCTGGGGCCACATGG + Intergenic
1047403156 8:124562787-124562809 TGGGGGCCTCTGGCGGCATGGGG + Exonic
1049184353 8:141241669-141241691 CAGGGTCCTCTGGGGACAGGTGG + Intronic
1049686078 8:143939801-143939823 TAGGGGGACCTGGGGACACGGGG + Intronic
1053752303 9:41269134-41269156 AAGGGGCCTCTAGAGCCACTGGG + Intergenic
1053752752 9:41273391-41273413 AAGGGCCCTCTGCAGCCACGGGG + Intergenic
1054258277 9:62837743-62837765 AAGGGCCCTCTGCAGCCACGGGG + Intergenic
1056713551 9:89010471-89010493 TGGGGGTCTCTAGGGCCACTCGG + Intergenic
1059439799 9:114300658-114300680 CAGGGCCCTCGGGGGCCACCTGG + Exonic
1061000460 9:127899525-127899547 GAGGGGGCTCGGGGGCCGCGGGG - Exonic
1061264268 9:129496485-129496507 TAGGAGTCCCTCGGGCCACGGGG + Intergenic
1061297313 9:129683811-129683833 CAGGGGCCTCTGGGGCTCAGAGG + Intronic
1061513210 9:131073286-131073308 CACGGGCCTCTGTGGCCAGGTGG - Exonic
1061548484 9:131318429-131318451 GAGGGGCCGCCTGGGCCACGTGG - Intergenic
1061607299 9:131720599-131720621 CAGGGTCATCTGGGGCCAGGTGG - Intronic
1061836750 9:133334450-133334472 CAGCAGCCTCTGGGGCCAGGAGG - Exonic
1062116578 9:134812617-134812639 GAGGGTCCTCGGGGGCCAGGGGG - Exonic
1062117530 9:134817513-134817535 TAAAGGCCTCTCAGGCCACGTGG - Intronic
1062343445 9:136103901-136103923 TAGGGGCCTCCGGGGCGGGGAGG + Intergenic
1202800496 9_KI270719v1_random:170632-170654 AAGGGCCCTCTGCAGCCACGGGG - Intergenic
1185641592 X:1591868-1591890 TAGGGGCCTCGGAGGTGACGGGG + Intronic
1185809001 X:3087716-3087738 AAGGGGCATCTGGAGCCACCAGG - Intronic
1190060859 X:47210931-47210953 TAGGGTCTTCTGGGGTCAGGTGG + Intronic
1190152215 X:47957936-47957958 TGTGGGCCTCTGGGCCCATGTGG + Intronic
1190160447 X:48028196-48028218 TGTGGGCCTCTGGGCCCATGTGG - Intronic
1194977324 X:100408700-100408722 CCGCGGCCTCCGGGGCCACGGGG - Exonic
1195788841 X:108559124-108559146 GAAGGGCCTCCGGGGCCTCGGGG + Exonic