ID: 1167500614

View in Genome Browser
Species Human (GRCh38)
Location 19:49845033-49845055
Sequence CTGTCCTCTCAGCTTGAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167500614_1167500618 -4 Left 1167500614 19:49845033-49845055 CCACACTCAAGCTGAGAGGACAG No data
Right 1167500618 19:49845052-49845074 ACAGTGCAGACAGGAGGTGAGGG No data
1167500614_1167500616 -10 Left 1167500614 19:49845033-49845055 CCACACTCAAGCTGAGAGGACAG No data
Right 1167500616 19:49845046-49845068 GAGAGGACAGTGCAGACAGGAGG No data
1167500614_1167500621 4 Left 1167500614 19:49845033-49845055 CCACACTCAAGCTGAGAGGACAG No data
Right 1167500621 19:49845060-49845082 GACAGGAGGTGAGGGTCATGGGG No data
1167500614_1167500619 2 Left 1167500614 19:49845033-49845055 CCACACTCAAGCTGAGAGGACAG No data
Right 1167500619 19:49845058-49845080 CAGACAGGAGGTGAGGGTCATGG No data
1167500614_1167500624 18 Left 1167500614 19:49845033-49845055 CCACACTCAAGCTGAGAGGACAG No data
Right 1167500624 19:49845074-49845096 GTCATGGGGGCTGTCTTTCAGGG No data
1167500614_1167500622 5 Left 1167500614 19:49845033-49845055 CCACACTCAAGCTGAGAGGACAG No data
Right 1167500622 19:49845061-49845083 ACAGGAGGTGAGGGTCATGGGGG No data
1167500614_1167500620 3 Left 1167500614 19:49845033-49845055 CCACACTCAAGCTGAGAGGACAG No data
Right 1167500620 19:49845059-49845081 AGACAGGAGGTGAGGGTCATGGG No data
1167500614_1167500623 17 Left 1167500614 19:49845033-49845055 CCACACTCAAGCTGAGAGGACAG No data
Right 1167500623 19:49845073-49845095 GGTCATGGGGGCTGTCTTTCAGG No data
1167500614_1167500617 -5 Left 1167500614 19:49845033-49845055 CCACACTCAAGCTGAGAGGACAG No data
Right 1167500617 19:49845051-49845073 GACAGTGCAGACAGGAGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167500614 Original CRISPR CTGTCCTCTCAGCTTGAGTG TGG (reversed) Intergenic
No off target data available for this crispr