ID: 1167501614

View in Genome Browser
Species Human (GRCh38)
Location 19:49851513-49851535
Sequence CCGTGGAAGGCTCTGGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 228}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167501614_1167501623 4 Left 1167501614 19:49851513-49851535 CCTTTTTCCAGAGCCTTCCACGG 0: 1
1: 0
2: 2
3: 18
4: 228
Right 1167501623 19:49851540-49851562 GCCCCCCCAGCCCCTATCCCGGG 0: 1
1: 0
2: 7
3: 62
4: 612
1167501614_1167501622 3 Left 1167501614 19:49851513-49851535 CCTTTTTCCAGAGCCTTCCACGG 0: 1
1: 0
2: 2
3: 18
4: 228
Right 1167501622 19:49851539-49851561 CGCCCCCCCAGCCCCTATCCCGG 0: 1
1: 0
2: 1
3: 42
4: 376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167501614 Original CRISPR CCGTGGAAGGCTCTGGAAAA AGG (reversed) Intronic
900002397 1:21858-21880 CCCTGGCAGGGTCTGGAAATGGG - Intergenic
902724248 1:18324468-18324490 CCGTCAAAGGTTCTGGGAAATGG - Intronic
904869898 1:33610295-33610317 CAGTGGAAGAATCTGGGAAAGGG + Intronic
906507286 1:46389541-46389563 ACTTTGGAGGCTCTGGAAAAGGG - Intergenic
906950190 1:50328813-50328835 CCTTGGAAACCACTGGAAAAGGG + Intergenic
907089381 1:51710074-51710096 CTGAGGTAGGCTCTAGAAAAGGG + Intronic
907505584 1:54915677-54915699 ACTTTGGAGGCTCTGGAAAAGGG - Intergenic
907566878 1:55443695-55443717 CCTTGGAAAGCTCTGGAAATAGG + Intergenic
908643473 1:66250868-66250890 CTGTGTAAGGCTTTGCAAAATGG - Intronic
917255834 1:173115271-173115293 CCCATGAAGGCCCTGGAAAAGGG + Intergenic
919724075 1:200870809-200870831 CCCAGGAAGGATTTGGAAAATGG - Intergenic
924507360 1:244698317-244698339 CCATTGGAGCCTCTGGAAAAAGG + Intronic
924939424 1:248802499-248802521 CCGTGGAAGGCACAGGGGAAAGG - Intergenic
1064706180 10:18074681-18074703 GGTTGTAAGGCTCTGGAAAATGG + Intergenic
1064856692 10:19776261-19776283 TCGTGGGAGGCACTGGAACACGG - Intronic
1065199598 10:23300320-23300342 ACTTTGGAGGCTCTGGAAAAGGG - Intronic
1065629437 10:27662405-27662427 TTGTGGAAGGCTCTAGCAAAGGG - Intergenic
1069661159 10:70124307-70124329 CAGTGGATGCCTCTGGAGAAGGG - Intronic
1072378088 10:94838009-94838031 ACATTGGAGGCTCTGGAAAAGGG - Intronic
1073461055 10:103666094-103666116 CCGTGGAAGGCGTTGGAGCATGG - Intronic
1074718979 10:116248371-116248393 CCCTGTAAGGCTCCAGAAAAAGG - Intronic
1075688450 10:124379743-124379765 CCGTGCAAGGCTCTGGGAAGTGG - Intergenic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077341975 11:2030296-2030318 CCCTGGAAGGATCTGGAAATGGG - Intergenic
1077974860 11:7237515-7237537 ACATGGAAGGCTCTGTGAAAAGG + Intergenic
1079887162 11:26003237-26003259 ACTTTGGAGGCTCTGGAAAAGGG + Intergenic
1080609013 11:33887902-33887924 CCATGGAAGACTCTTGAACAGGG + Intronic
1081658729 11:44874867-44874889 CAGTGGAATTCTCTGAAAAAGGG - Intronic
1081850677 11:46273174-46273196 CTGTGGAAGGCCCTGGAGAAAGG + Intergenic
1082946883 11:58770741-58770763 CAGGGGAAGGCTCTGGAATGCGG - Intergenic
1083738455 11:64694936-64694958 CAGTGGAAGGGTCTGGGAGAGGG - Intronic
1083944193 11:65915083-65915105 CTGTGGTAGGCTCTGGGAACAGG + Intergenic
1084085128 11:66851474-66851496 CAGTGGCAGGCTGTGGAAGAGGG + Intronic
1084698515 11:70770611-70770633 CAATGGACGGCTCTGGGAAAGGG + Intronic
1086632453 11:89039416-89039438 ACTTGGAGGACTCTGGAAAATGG - Intronic
1088860533 11:113794970-113794992 CAGTGCAAGGCACTGGAAAATGG + Intergenic
1089084816 11:115807888-115807910 GCCTGGAGGGCTCTGGAGAAAGG - Intergenic
1090959346 11:131542418-131542440 CCATGGGAGCGTCTGGAAAATGG - Intronic
1091325512 11:134683976-134683998 TTGTGGAGAGCTCTGGAAAATGG + Intergenic
1202824961 11_KI270721v1_random:85485-85507 CCCTGGAAGGATCTGGAAATGGG - Intergenic
1091648744 12:2293677-2293699 CTGTGGAAGGCTCTAGACCAGGG - Intronic
1092065755 12:5588415-5588437 CCGTGGAATGGTCTGGAAAGTGG + Intronic
1092909070 12:13129417-13129439 CTGTGGAGGGTTCTGGAACATGG + Intronic
1093348573 12:18069895-18069917 ACTTGGGAGGCTCTGGAAAAGGG + Intergenic
1093711303 12:22333243-22333265 CTGTGGATGCCTCTGGAAGATGG - Intronic
1095493682 12:42762317-42762339 CAGTGGGAGGGTCTGAAAAAGGG - Intergenic
1095783107 12:46082496-46082518 CATTGGAAGCCTCTGGAAATGGG + Intergenic
1097191256 12:57220615-57220637 CAGTGGTAGGGTCTGGAAAGAGG + Intronic
1102566731 12:113802017-113802039 CAATGGAAGGCTCTGGAAACTGG - Intergenic
1104746165 12:131211805-131211827 ATGTGGAAGTCTCTGGAGAAGGG + Intergenic
1105255582 13:18742301-18742323 CCATGGAAGGTGCTGGATAAAGG - Intergenic
1105968394 13:25405161-25405183 CCCTGGAAGGCTCAGGACAGAGG + Intronic
1106589944 13:31090460-31090482 TCTTTGCAGGCTCTGGAAAAAGG - Intergenic
1107102167 13:36605578-36605600 AGGTAGAAGGCCCTGGAAAAAGG + Intergenic
1111806196 13:93042752-93042774 ACTTTGGAGGCTCTGGAAAAGGG + Intergenic
1112207893 13:97343573-97343595 CCCTGGAAAGTTCTGGAAACTGG + Intronic
1112547618 13:100386955-100386977 CAGTGGAAGGGTCTGTAAGATGG + Intronic
1113788074 13:113013320-113013342 CCCTGCAAGGCTCTGGGGAAGGG + Intronic
1116845181 14:49858803-49858825 GCTTGGAAGGCTGTGGCAAAAGG + Intergenic
1117396129 14:55312334-55312356 CCGTGAAAGCCTCTGGGAAGGGG - Intronic
1117672441 14:58122667-58122689 ACTTTGGAGGCTCTGGAAAAGGG + Intronic
1119262280 14:73244929-73244951 GAGTGGAAGGCCCTGGGAAATGG - Intronic
1119980943 14:79080324-79080346 ACATGGAAGGATTTGGAAAATGG + Intronic
1121082950 14:91123372-91123394 CCCTGGCAGGCCCTGGCAAATGG + Intronic
1121515377 14:94546165-94546187 CTGTGCAAGGTTCTGGAAACTGG - Intergenic
1122032230 14:98920714-98920736 CTGTTCTAGGCTCTGGAAAATGG + Intergenic
1122038957 14:98968660-98968682 CCCTGGGAGACTCTGGAAATGGG + Intergenic
1123452324 15:20376678-20376700 CCATGGTAGGCTCTAGAAAAGGG - Intergenic
1125596907 15:40893335-40893357 AAGTGGAAGGCTCTGGACTAGGG - Intergenic
1126897267 15:53272363-53272385 CAATGGAGGGCTATGGAAAATGG + Intergenic
1127074280 15:55310594-55310616 ACTTTGGAGGCTCTGGAAAAGGG - Intronic
1128929915 15:71695043-71695065 CCGTGGGAGGTTTTGGAAAGAGG - Intronic
1129657797 15:77536117-77536139 CCAGGGAAAGTTCTGGAAAAGGG + Intergenic
1130968687 15:88716210-88716232 CCGTGACATGCTCTAGAAAAGGG + Intergenic
1132078340 15:98841874-98841896 CCTTGGAAAGTTCTGGAAAAGGG + Intronic
1132451115 15:101969081-101969103 CCCTGGCAGGGTCTGGAAATGGG + Intergenic
1132844851 16:1995737-1995759 CCATGGAAGGCCATGGAATAGGG - Intergenic
1135351265 16:21731083-21731105 ATGTGCAAGGTTCTGGAAAAGGG + Intronic
1135449745 16:22547209-22547231 ATGTGCAAGGTTCTGGAAAAGGG + Intergenic
1136633290 16:31502314-31502336 CCCAAGAAGGCTCTGGAAAGGGG - Intronic
1137584920 16:49658608-49658630 CTGGGGAAGGCTCTGGGATATGG + Intronic
1142525336 17:536243-536265 CCGAGGAAGGCACTAGAAATTGG - Intronic
1143522371 17:7451996-7452018 CACTGGAAGGTTCTGGAAAGAGG + Intronic
1146472245 17:33133881-33133903 CGGTGGAGGGCACAGGAAAAGGG + Intronic
1146534605 17:33639372-33639394 CCATGGAGTGTTCTGGAAAAGGG - Intronic
1151988363 17:77558236-77558258 CCCTTGAAGCCTCTGGCAAAGGG - Intergenic
1154435437 18:14338303-14338325 CCATGGAAGGTGCTGGATAAAGG + Intergenic
1157625208 18:49045186-49045208 CGGTGGAAGGCTGAGGAAGAGGG + Intronic
1157884732 18:51355711-51355733 TCATGGAAGGCTTTGGAACAAGG - Intergenic
1158547117 18:58405825-58405847 CCGTGGGAGGCTCTGGCAGGTGG - Intergenic
1160460340 18:79034222-79034244 TCGTGGAAGGCTCTGAGACATGG - Intergenic
1160460366 18:79034370-79034392 TCGTGGAAGGCTCTGAGACATGG - Intergenic
1160460470 18:79034962-79034984 TCGTGGAAGGCTCTGAGACATGG - Intergenic
1160460586 18:79035628-79035650 TCGTGGAAGGCTCTGAGACATGG - Intergenic
1160460754 18:79036590-79036612 TCGTGGAAGGCTCTGAGATATGG - Intergenic
1160460806 18:79036886-79036908 TCGTGGAAGGCTCTGAGATATGG - Intergenic
1160460877 18:79037260-79037282 CCCTGGAAGGCTCTGAGATATGG - Intergenic
1160460895 18:79037336-79037358 CCCTGGAAGGCTCTGAGATATGG - Intergenic
1160460912 18:79037412-79037434 CCTTGGAAGGCTCTGAGATATGG - Intergenic
1160460930 18:79037488-79037510 CCCTGGAAGGCTCTGAGATATGG - Intergenic
1160460981 18:79037714-79037736 CCCTGGAAGGCTCTGAGACATGG - Intergenic
1160610185 18:80078385-80078407 CTGGGAAAGGCTCTAGAAAAGGG + Intronic
1160634149 19:63466-63488 CCCTGGCAGGGTCTGGAAATGGG - Intergenic
1160699575 19:499263-499285 CCGTGGAAAGATCCGGAAGAAGG - Intronic
1161474263 19:4475434-4475456 CCCAGGAAGGCTCTGGAGAAGGG - Exonic
1161631697 19:5360098-5360120 CCGTGGAAGGGTCTGGAGAAGGG - Intergenic
1161661142 19:5547017-5547039 CCATGGAGGGCTCTGGACAGAGG + Intergenic
1162719586 19:12654369-12654391 CCCTGGAAGGCCCTGGTAAGAGG - Intronic
1164118265 19:22242765-22242787 CTGTGTAAGGCTCAGGAATAAGG + Intergenic
1164323132 19:24168356-24168378 ACTTTGGAGGCTCTGGAAAAGGG - Intergenic
1167501614 19:49851513-49851535 CCGTGGAAGGCTCTGGAAAAAGG - Intronic
1167515558 19:49921398-49921420 CCCAGGAAGTCTCTGGAGAATGG - Intronic
1167556893 19:50202424-50202446 CCATGGAAGGCTCTGAACAGAGG + Intronic
924974129 2:157417-157439 ACTTTGAAGGCTCTGGAAATGGG - Intergenic
926482868 2:13421652-13421674 CCATGGTAGGGTCTAGAAAAGGG + Intergenic
926599018 2:14821585-14821607 TTGTGGAAGGATCTGGAAAAAGG - Intergenic
926613641 2:14973011-14973033 CCATGGAAGGGTGTGGGAAAAGG - Intergenic
928447338 2:31345027-31345049 CCGTGGAAAGCTCTAGAGTAGGG - Intronic
929849400 2:45570237-45570259 CTTTGGAAAGCTCTGGCAAAAGG + Intronic
930631557 2:53759625-53759647 ACTTTGAAGGCTCTGGAACAGGG + Intronic
932243003 2:70172337-70172359 CTGTGGAAGGCTCTTGAATTTGG - Intronic
933175246 2:79166607-79166629 ACTTTGGAGGCTCTGGAAAAGGG - Intergenic
936970705 2:118173785-118173807 CCATGGCAGGCACTGGAAAGGGG + Intergenic
938278508 2:130049012-130049034 CCATGGAAGGTGCTGGATAAAGG - Intergenic
938436868 2:131288340-131288362 CCATGGAAGGTGCTGGATAAAGG + Intronic
938765426 2:134457962-134457984 CTGGGGAAGGCGGTGGAAAAGGG + Intronic
942816509 2:180059562-180059584 ACTTTGGAGGCTCTGGAAAAGGG + Intergenic
943138404 2:183945711-183945733 CATGGGAAGGCTCTTGAAAAAGG - Intergenic
944039330 2:195336426-195336448 ACTTTGGAGGCTCTGGAAAAGGG - Intergenic
945175107 2:207036238-207036260 TCCTGGAAGTCTCTGGCAAAAGG - Intergenic
945299893 2:208206401-208206423 CAGCGGCAGGGTCTGGAAAAGGG + Intergenic
945695566 2:213098896-213098918 CCCTTGAAGGCACTGGATAATGG - Intronic
948223805 2:236293409-236293431 CCGTGGTAGGCCCTGGAATGTGG + Intergenic
948314864 2:237020173-237020195 TCGTGGAAGGCTCATGAAGAAGG - Intergenic
1171038928 20:21742134-21742156 TGGGGGAAGGCTCTAGAAAATGG - Intergenic
1171880394 20:30614269-30614291 CCATGGAAGGTGCTGGATAAAGG - Intergenic
1172032047 20:31989188-31989210 CCATGGGAGGATCTGGGAAAGGG + Intronic
1172228250 20:33319752-33319774 CCGTGTCAGCCTCTGTAAAATGG - Intergenic
1174547954 20:51340405-51340427 GAGAGGAAGGCTCTGTAAAAAGG - Intergenic
1177263494 21:18756637-18756659 ACTTTGGAGGCTCTGGAAAAGGG - Intergenic
1177896276 21:26858608-26858630 ACTTTGGAGGCTCTGGAAAAGGG + Intergenic
1178134425 21:29610918-29610940 CCATGGAAGCCTCTGGATATGGG - Intronic
1178772060 21:35514724-35514746 CCTTGGAAGGATCTAGAGAAGGG - Intronic
1184988516 22:48152587-48152609 CCCTGGCAGGCTCTGGTACATGG - Intergenic
1185234985 22:49706918-49706940 CCGTGCAAGGCTCTGCGGAAGGG + Intergenic
950537641 3:13589327-13589349 CCTTAGAAAGCTCTGGAAAGTGG - Intronic
951753096 3:26058911-26058933 TCTTGGCAGGCTATGGAAAATGG - Intergenic
952512520 3:34071466-34071488 CTGCAGAAGGCTCTGGAAAGAGG + Intergenic
952922208 3:38293308-38293330 ACTTTGGAGGCTCTGGAAAAGGG - Intronic
954827788 3:53390408-53390430 CTGTGGAAGGCTCTTCAAAATGG - Intergenic
955573299 3:60331000-60331022 CCTTGGAAGAATCTTGAAAAGGG - Intronic
958629788 3:96670726-96670748 ACTTTGGAGGCTCTGGAAAAGGG - Intergenic
960277500 3:115744598-115744620 ACTTTGGAGGCTCTGGAAAAGGG + Intergenic
961485401 3:127212402-127212424 TTCTGGAAGGCTCTGGAACATGG + Intergenic
962423225 3:135246329-135246351 ACTTGGAAGGAACTGGAAAAGGG + Intronic
962495459 3:135935435-135935457 ACTTTGGAGGCTCTGGAAAAGGG + Intergenic
963187965 3:142439797-142439819 ACTTTGGAGGCTCTGGAAAAGGG + Intronic
963915784 3:150857877-150857899 ACTTTGGAGGCTCTGGAAAAGGG + Intergenic
964953442 3:162324901-162324923 ACTTTGGAGGCTCTGGAAAAGGG + Intergenic
966957569 3:184899056-184899078 CTGGGGAAGGCTCCTGAAAATGG + Intronic
967623580 3:191662129-191662151 ACTTTGGAGGCTCTGGAAAAGGG + Intergenic
968201131 3:196756399-196756421 CAGTGGAACGCACTGGAAAGGGG - Intronic
969644967 4:8422772-8422794 ACTTTGGAGGCTCTGGAAAAGGG + Intronic
971562425 4:28097396-28097418 CCAGGGAAAGCTCTGGAAATTGG - Intergenic
973636194 4:52863379-52863401 CCCTGGGAAGCGCTGGAAAATGG - Intronic
974520484 4:62975546-62975568 ACTTTGGAGGCTCTGGAAAAGGG + Intergenic
974906884 4:68068806-68068828 CTGTGGCAGGCTGTGGAATAAGG - Exonic
975313799 4:72929993-72930015 ACTTTGGAGGCTCTGGAAAAGGG - Intergenic
981252672 4:142623069-142623091 CCGTGGAAATCACTTGAAAATGG + Intronic
984723766 4:183000932-183000954 ACTTTGGAGGCTCTGGAAAAGGG + Intergenic
985590795 5:764150-764172 CCGGGCAAGTCTCTGGTAAATGG - Intronic
988000423 5:25340958-25340980 CTGTGGAAGACTGTGGAAGATGG + Intergenic
988457076 5:31395854-31395876 ACTTTGGAGGCTCTGGAAAAGGG - Intergenic
988957164 5:36331315-36331337 ACTTTGGAGGCTCTGGAAAATGG - Intergenic
990137107 5:52659664-52659686 CCATAGAAGACTCTGGAAATAGG + Intergenic
995069570 5:107904089-107904111 CAGTGGAGAGCTCTGGAAAGGGG - Intronic
995465664 5:112447587-112447609 ACTTTGGAGGCTCTGGAAAAGGG + Intergenic
996024805 5:118632815-118632837 CCTTTGCAGGCTCTGGAAGAGGG - Intergenic
999137672 5:149333380-149333402 CCCTGGAGGGCTCTGGAGCAGGG - Intronic
1000220300 5:159208787-159208809 CTCTGGAAGGGTCTTGAAAAAGG + Intronic
1000349821 5:160344562-160344584 CCAAAGATGGCTCTGGAAAATGG - Intronic
1000998321 5:167981140-167981162 CCATGGAAAGCTCTGGAGCAGGG - Intronic
1002308255 5:178296972-178296994 CCGTGGGAAGCCCTGGAAAGGGG - Intronic
1003371949 6:5537266-5537288 CTGTGGAAGGCACTGGGGAAGGG - Intronic
1004199077 6:13531294-13531316 CAGTGGGAGGGTGTGGAAAATGG - Intergenic
1004236833 6:13881924-13881946 ACTTTGGAGGCTCTGGAAAAGGG + Intergenic
1006450237 6:34101708-34101730 CCCTGGAAGGTTGTGTAAAACGG + Intronic
1009544800 6:65008508-65008530 ACTTCGGAGGCTCTGGAAAAGGG + Intronic
1010842635 6:80665250-80665272 AGGTGGAAGGTTCTGGAAATTGG - Intergenic
1010893521 6:81340911-81340933 ACTTTGGAGGCTCTGGAAAAGGG + Intergenic
1011539841 6:88417617-88417639 ACTTTGGAGGCTCTGGAAAAGGG - Intergenic
1013543563 6:111134604-111134626 ACTTTGGAGGCTCTGGAAAAGGG + Intronic
1014817073 6:125947744-125947766 CCCTGGAATGCTCTTGAGAAAGG + Intergenic
1017876042 6:158524959-158524981 CCGTGGAAGGCTCTGGGCAGAGG - Intergenic
1018907869 6:168085704-168085726 CCATGGAAGGCTTTGGAGCAGGG - Intergenic
1018918687 6:168155324-168155346 CATTGTGAGGCTCTGGAAAAGGG - Intergenic
1019752622 7:2741408-2741430 TGGTGGAAGCCTCTGGAAACTGG - Intronic
1019907728 7:4077358-4077380 TGGTGGAATGCTCTGGAGAATGG - Intronic
1023170524 7:37386438-37386460 CTGTGGGAGGCTCTGTACAAGGG - Intronic
1024838288 7:53551245-53551267 TAGTGGAAGTCTCCGGAAAAAGG - Intergenic
1026164256 7:67895955-67895977 CCATGCAATGCACTGGAAAAGGG - Intergenic
1028413439 7:90555646-90555668 GCTTGCAAGGCTGTGGAAAAAGG + Intronic
1028588567 7:92474089-92474111 ACTTTGGAGGCTCTGGAAAAGGG - Intronic
1032671088 7:134083015-134083037 CTTTGGAAGGAACTGGAAAAGGG + Intergenic
1033280725 7:140004729-140004751 CTGGGGAAGGCTGTGGAAAGGGG - Intronic
1035054862 7:156028536-156028558 GCGTGGAGGCCTCAGGAAAATGG + Intergenic
1035282438 7:157786484-157786506 CTGTGGATGGCACTGGAAACTGG + Intronic
1036810428 8:11864578-11864600 CCTTGGAAGGATCAGGAAACAGG + Intronic
1037410389 8:18589656-18589678 CAGTGGCAGGGTCTGGAGAAGGG + Intronic
1038348922 8:26758680-26758702 CACTGGAAGGACCTGGAAAATGG - Intronic
1040129283 8:43775577-43775599 CCATTGAAGTCTATGGAAAAAGG + Intergenic
1041663849 8:60423735-60423757 ACTTTGGAGGCTCTGGAAAAGGG - Intergenic
1045111406 8:98941440-98941462 CAGTGGAAGGCTGAGGAGAAGGG + Intronic
1045295044 8:100865237-100865259 CCGTGGGAGGCTTTGCAAAGAGG - Intergenic
1047443859 8:124902385-124902407 ACTTTGGAGGCTCTGGAAAAGGG - Intergenic
1049180702 8:141220645-141220667 CCGTGGGAGGCGCGGGAGAAGGG + Intronic
1049885203 9:21971-21993 CCCTGGCAGGGTCTGGAAATGGG - Intergenic
1052538502 9:29777473-29777495 ACTTTGGAGGCTCTGGAAAAGGG - Intergenic
1052647536 9:31254913-31254935 CCAGGAAAGGCTCTAGAAAAGGG + Intergenic
1052881530 9:33603649-33603671 CCATGGAAGGTTCTGGATAAAGG + Intergenic
1053494786 9:38542191-38542213 CCATGGAAGGTTCTGGATAAAGG - Intronic
1053667406 9:40325829-40325851 CCATGGAAGGTGCTGGATAAAGG + Intronic
1053916985 9:42950933-42950955 CCATGGAAGGTGCTGGATAAAGG + Intergenic
1054378551 9:64465857-64465879 CCATGGAAGGTGCTGGATAAAGG + Intergenic
1054517204 9:66050456-66050478 CCATGGAAGGTGCTGGATAAAGG - Intergenic
1055735852 9:79329302-79329324 CCATGGAAAGATCTAGAAAAGGG + Intergenic
1055829007 9:80358683-80358705 CTGTGGAAGGTCCTGGAAGAAGG + Intergenic
1056137350 9:83643305-83643327 CAGTGGAAGGCATTAGAAAATGG - Intronic
1057095084 9:92299270-92299292 CCATGGGAGGCACTGGCAAATGG - Intronic
1057853222 9:98581188-98581210 CCAGGGAGGGCTCTGGAAGAGGG + Intronic
1058775567 9:108280007-108280029 CCTTGGAAGGCTTTGGACAGAGG + Intergenic
1059953730 9:119494550-119494572 TCTAGGAAGGCTCTCGAAAAGGG - Intergenic
1060969595 9:127730568-127730590 CCCTGGACAGCTCTGGGAAAAGG - Intronic
1062518186 9:136946401-136946423 GCGTGGAGGGCTCTGGAAACGGG - Intronic
1062560233 9:137138387-137138409 ATGGGTAAGGCTCTGGAAAAGGG + Intronic
1185609562 X:1386443-1386465 CCGGGGAAGGCTCTAGAAAAGGG - Exonic
1186254230 X:7701824-7701846 ACTTTGGAGGCTCTGGAAAAGGG - Intergenic
1187014280 X:15310110-15310132 CTGTGGCAGTTTCTGGAAAAGGG - Intronic
1189098900 X:38168745-38168767 CTGTGGATGGCTCTGGGAAGTGG + Intronic
1190098397 X:47501282-47501304 CCATTGGAGCCTCTGGAAAAAGG + Intergenic
1192827272 X:74710806-74710828 CTTTGGAAGGCTGAGGAAAAAGG + Intergenic
1193306727 X:79959641-79959663 GCCTTGGAGGCTCTGGAAAAGGG + Intergenic
1195921640 X:109989678-109989700 CTGGGGGAGGCTCTGGAAAGTGG + Intergenic
1196286845 X:113892702-113892724 CTGAGAAAGGCTCTGGACAAAGG - Intergenic
1196425934 X:115569693-115569715 CCATGGAAGGGTCTGTGAAATGG - Intronic
1201377524 Y:13339335-13339357 CAGGGGAAGTCTCTGGAATATGG - Intronic