ID: 1167501653

View in Genome Browser
Species Human (GRCh38)
Location 19:49851610-49851632
Sequence GCCCGAAGGGTGGTCCCGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167501638_1167501653 11 Left 1167501638 19:49851576-49851598 CCGCAGCCCCCGCCGCTCCGGGG No data
Right 1167501653 19:49851610-49851632 GCCCGAAGGGTGGTCCCGCCCGG No data
1167501635_1167501653 18 Left 1167501635 19:49851569-49851591 CCTTTGTCCGCAGCCCCCGCCGC No data
Right 1167501653 19:49851610-49851632 GCCCGAAGGGTGGTCCCGCCCGG No data
1167501644_1167501653 -1 Left 1167501644 19:49851588-49851610 CCGCTCCGGGGTGTCCCCTGTGG No data
Right 1167501653 19:49851610-49851632 GCCCGAAGGGTGGTCCCGCCCGG No data
1167501634_1167501653 29 Left 1167501634 19:49851558-49851580 CCGGGCTCACGCCTTTGTCCGCA No data
Right 1167501653 19:49851610-49851632 GCCCGAAGGGTGGTCCCGCCCGG No data
1167501642_1167501653 3 Left 1167501642 19:49851584-49851606 CCCGCCGCTCCGGGGTGTCCCCT No data
Right 1167501653 19:49851610-49851632 GCCCGAAGGGTGGTCCCGCCCGG No data
1167501646_1167501653 -6 Left 1167501646 19:49851593-49851615 CCGGGGTGTCCCCTGTGGCCCGA No data
Right 1167501653 19:49851610-49851632 GCCCGAAGGGTGGTCCCGCCCGG No data
1167501643_1167501653 2 Left 1167501643 19:49851585-49851607 CCGCCGCTCCGGGGTGTCCCCTG No data
Right 1167501653 19:49851610-49851632 GCCCGAAGGGTGGTCCCGCCCGG No data
1167501640_1167501653 5 Left 1167501640 19:49851582-49851604 CCCCCGCCGCTCCGGGGTGTCCC No data
Right 1167501653 19:49851610-49851632 GCCCGAAGGGTGGTCCCGCCCGG No data
1167501641_1167501653 4 Left 1167501641 19:49851583-49851605 CCCCGCCGCTCCGGGGTGTCCCC No data
Right 1167501653 19:49851610-49851632 GCCCGAAGGGTGGTCCCGCCCGG No data
1167501633_1167501653 30 Left 1167501633 19:49851557-49851579 CCCGGGCTCACGCCTTTGTCCGC No data
Right 1167501653 19:49851610-49851632 GCCCGAAGGGTGGTCCCGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167501653 Original CRISPR GCCCGAAGGGTGGTCCCGCC CGG Intronic