ID: 1167504449

View in Genome Browser
Species Human (GRCh38)
Location 19:49863728-49863750
Sequence CCACGCACGCAGGCTTGTAC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 44}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167504449_1167504456 1 Left 1167504449 19:49863728-49863750 CCGGTACAAGCCTGCGTGCGTGG 0: 1
1: 0
2: 0
3: 6
4: 44
Right 1167504456 19:49863752-49863774 CACCAGCACCTGTGGATGGGAGG 0: 1
1: 0
2: 2
3: 38
4: 533
1167504449_1167504457 2 Left 1167504449 19:49863728-49863750 CCGGTACAAGCCTGCGTGCGTGG 0: 1
1: 0
2: 0
3: 6
4: 44
Right 1167504457 19:49863753-49863775 ACCAGCACCTGTGGATGGGAGGG 0: 1
1: 0
2: 4
3: 27
4: 322
1167504449_1167504453 -3 Left 1167504449 19:49863728-49863750 CCGGTACAAGCCTGCGTGCGTGG 0: 1
1: 0
2: 0
3: 6
4: 44
Right 1167504453 19:49863748-49863770 TGGCCACCAGCACCTGTGGATGG 0: 1
1: 0
2: 3
3: 30
4: 258
1167504449_1167504459 3 Left 1167504449 19:49863728-49863750 CCGGTACAAGCCTGCGTGCGTGG 0: 1
1: 0
2: 0
3: 6
4: 44
Right 1167504459 19:49863754-49863776 CCAGCACCTGTGGATGGGAGGGG 0: 1
1: 0
2: 3
3: 46
4: 393
1167504449_1167504460 4 Left 1167504449 19:49863728-49863750 CCGGTACAAGCCTGCGTGCGTGG 0: 1
1: 0
2: 0
3: 6
4: 44
Right 1167504460 19:49863755-49863777 CAGCACCTGTGGATGGGAGGGGG 0: 1
1: 0
2: 6
3: 48
4: 446
1167504449_1167504454 -2 Left 1167504449 19:49863728-49863750 CCGGTACAAGCCTGCGTGCGTGG 0: 1
1: 0
2: 0
3: 6
4: 44
Right 1167504454 19:49863749-49863771 GGCCACCAGCACCTGTGGATGGG 0: 1
1: 0
2: 2
3: 11
4: 164
1167504449_1167504452 -7 Left 1167504449 19:49863728-49863750 CCGGTACAAGCCTGCGTGCGTGG 0: 1
1: 0
2: 0
3: 6
4: 44
Right 1167504452 19:49863744-49863766 TGCGTGGCCACCAGCACCTGTGG 0: 1
1: 0
2: 1
3: 16
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167504449 Original CRISPR CCACGCACGCAGGCTTGTAC CGG (reversed) Exonic
900598216 1:3492061-3492083 CCACGCACGCAGTCCTGCACAGG - Intronic
900598222 1:3492108-3492130 CCACGCACGCAGTCCTGCACGGG - Intronic
900743589 1:4345141-4345163 GCACGCACGCAGGGGTGTCCGGG - Intergenic
901217809 1:7564561-7564583 ACACACACGCAGGCATGCACAGG - Intronic
905201921 1:36321640-36321662 CCAAGCACGCATGCTTACACCGG + Intronic
905971637 1:42146195-42146217 CCACGCACACAGGCTGACACAGG + Intergenic
916074783 1:161193972-161193994 CCACCCATGCAGGCCTGTGCGGG + Exonic
1064344930 10:14523408-14523430 CTACGCACGCAGGCATGTGGTGG + Intronic
1065916654 10:30358803-30358825 CCACCCAGGCAGGCTTGGAAAGG - Intronic
1069757137 10:70780219-70780241 CCCTGCACGCAGCCTTGCACAGG - Intronic
1071816711 10:89239745-89239767 CCACGCACCCAGGATGGTGCTGG + Intronic
1072418347 10:95268505-95268527 CCACGCAGGAAGGCTTCCACCGG + Intronic
1074519605 10:114207041-114207063 CCACACACACAAGCTTTTACAGG - Intronic
1077097266 11:804426-804448 GCACGCAGGCAGGCCTGTCCAGG + Exonic
1082005964 11:47419121-47419143 CCACACACACAGCCTTGCACTGG + Exonic
1082120796 11:48378041-48378063 CCATGCTCCCAGACTTGTACTGG + Intergenic
1085330905 11:75650129-75650151 TCACGCACCCAGGCCTTTACAGG + Intronic
1098672163 12:73245470-73245492 ACACACACACAGGCATGTACAGG + Intergenic
1103440885 12:120962123-120962145 ACACGCACGCACGCATGTACAGG - Intergenic
1105913342 13:24891429-24891451 CCAGGAACTCAGGCTTGGACAGG - Intronic
1122126541 14:99581521-99581543 CCAGGCAGGCAGGCCTGCACCGG - Intronic
1124707010 15:31974598-31974620 CCAAGCACCCAGGCTTGCAGTGG - Intergenic
1126793500 15:52241783-52241805 CCACGCAGGCTGGAGTGTACTGG + Intronic
1130258708 15:82337909-82337931 CCACCCAGGCAGGCTTGGAAAGG - Intergenic
1130269977 15:82441175-82441197 CCACCCAGGCAGGCTTGGAAAGG + Intergenic
1130406357 15:83605757-83605779 CCACACTCGCGGGCTTGGACAGG - Intronic
1130490361 15:84426297-84426319 CCACCCAGGCAGGCTTGGAAAGG - Intergenic
1134451156 16:14364589-14364611 ACCCGCACGCAGGCATGCACCGG + Intergenic
1141077423 16:81020180-81020202 CCACGTAGGTAGGTTTGTACTGG - Exonic
1151298043 17:73200061-73200083 CCACCCATGCAGCCTTGTACGGG + Intronic
1156940285 18:42758948-42758970 CCAAGCCCTCAGGCTTGGACTGG + Intronic
1167293504 19:48636759-48636781 CCCCGCACGCAGGTTTCTATGGG + Intronic
1167504449 19:49863728-49863750 CCACGCACGCAGGCTTGTACCGG - Exonic
927653407 2:24926433-24926455 CCAGGCACCCAGGCTGGTGCTGG + Intergenic
929780700 2:44955239-44955261 CCACGCACGCAGACACGCACTGG - Intergenic
1168962495 20:1878890-1878912 GCATGTACGCAGGCATGTACAGG - Intergenic
1170810714 20:19672061-19672083 CCACCCACTCATGCTTGGACTGG + Intronic
961013324 3:123449550-123449572 CGACGCAGGCAGGCTTCTCCCGG + Exonic
968478604 4:824361-824383 CCACCCACGCAGCCCTGCACAGG - Intronic
998769352 5:145524330-145524352 CCACGCACGGATTCTTGTTCTGG - Intronic
1019597690 7:1865917-1865939 TCACGCTGGCAGGCTTGTCCAGG - Intronic
1035344429 7:158188727-158188749 CCACGCTCGCCGCCTTGTATGGG + Intronic
1037404984 8:18532760-18532782 CCTCGCATGCTGGCTTTTACAGG - Exonic
1040907226 8:52481013-52481035 CCTGGCACGCAGGCTTGTGTGGG - Intergenic
1050933788 9:11366886-11366908 CCACGCACGCAGGCTCCCACAGG - Intergenic
1188519919 X:31027097-31027119 ACATGCACGCATGCTTGTACAGG + Intergenic
1193793422 X:85844162-85844184 CCACACACTCAGGATTGGACAGG + Intergenic
1202367865 Y:24179265-24179287 CCACCCAGGCAGGCTTGGAAAGG + Intergenic
1202376975 Y:24246643-24246665 CCACCCAGGCAGGCTTGGAAAGG - Intergenic
1202493805 Y:25423478-25423500 CCACCCAGGCAGGCTTGGAAAGG + Intergenic
1202502918 Y:25490852-25490874 CCACCCAGGCAGGCTTGGAAAGG - Intergenic