ID: 1167507143

View in Genome Browser
Species Human (GRCh38)
Location 19:49876797-49876819
Sequence AGGCGGGGCCATTTTTCTTA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 71}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167507143_1167507150 9 Left 1167507143 19:49876797-49876819 CCCTAAGAAAAATGGCCCCGCCT 0: 1
1: 0
2: 0
3: 2
4: 71
Right 1167507150 19:49876829-49876851 CCATTTGCCCCCAACAATAATGG 0: 1
1: 0
2: 0
3: 10
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167507143 Original CRISPR AGGCGGGGCCATTTTTCTTA GGG (reversed) Exonic
905765060 1:40593537-40593559 AGGCTGGGCTATTTTTGGTAAGG - Intergenic
910267734 1:85357355-85357377 TGGGGGCGCCATTCTTCTTAGGG - Intronic
916863061 1:168826969-168826991 AGGCTGGGCAATTTTGCTTTTGG - Intergenic
923241614 1:232090421-232090443 AGCCGGGCCCATTCTTCCTAGGG + Intergenic
924623511 1:245682319-245682341 ATACTGGGCCATTGTTCTTAGGG - Intronic
1064803271 10:19100257-19100279 AGGAAGGAACATTTTTCTTAGGG - Intronic
1074046883 10:109847494-109847516 AGCCAGGGTCATTTTTGTTAAGG - Intergenic
1076386834 10:130063086-130063108 AAGCGGGGGCATTTTCCTTGGGG + Intergenic
1077459612 11:2702256-2702278 AAACGTGGCCATTTTTCTTTGGG + Intronic
1077945397 11:6891894-6891916 AGAGATGGCCATTTTTCTTATGG - Exonic
1079087637 11:17458243-17458265 AGGCAGGGCCATCTGTCTCAGGG + Intronic
1083630860 11:64094666-64094688 GGGCGGGACCATTTGTCTTTGGG + Intronic
1086193646 11:84110655-84110677 AGGTGGGGCCTTTTCTCTGATGG - Intronic
1087183488 11:95161510-95161532 TGGAGGGGCAATTTTTCTTGTGG + Intergenic
1090944635 11:131419095-131419117 AGGCTGAGCCATTTTTTTGAGGG - Intronic
1095620593 12:44248922-44248944 ATGCTGGCCCATTTTTCTTCGGG - Intronic
1108679563 13:52768006-52768028 ATACAGGGCCATTTTTCTCAAGG + Intergenic
1113410390 13:110081240-110081262 AGGCTGGTCCATTCTTCTGATGG + Intergenic
1116656349 14:47658058-47658080 AGAGGGGGACACTTTTCTTAGGG + Intronic
1118554172 14:66995865-66995887 ACGCTGGACAATTTTTCTTACGG - Intronic
1125899147 15:43329406-43329428 AGGCGTGGCCATATCTCTTCAGG + Exonic
1127993905 15:64141335-64141357 TGGCGGGGCCAGTTGTCTTTAGG + Intronic
1128772133 15:70290522-70290544 AGGAGGAGCCACCTTTCTTAGGG + Intergenic
1130350017 15:83083214-83083236 AGGCTGAGACATTTTGCTTATGG + Intergenic
1131708028 15:95019884-95019906 ACACAGAGCCATTTTTCTTACGG + Intergenic
1131822571 15:96287547-96287569 AGACTGGGTCATTTTTCTGAAGG - Intergenic
1132676323 16:1122779-1122801 GGGAGGGCACATTTTTCTTATGG - Intergenic
1134894981 16:17877622-17877644 AGGAGTGGCCAGTTATCTTACGG - Intergenic
1136775625 16:32870373-32870395 CTGAGGGGCCATTTTTCTCAGGG - Intergenic
1136894992 16:33991139-33991161 CTGAGGGGCCATTTTTCTCAGGG + Intergenic
1139511073 16:67428904-67428926 AGGCAGAGCCATTAGTCTTATGG - Intergenic
1139709686 16:68766396-68766418 AGCCTGGGCCAGTTTTCTCAAGG - Intronic
1203078043 16_KI270728v1_random:1132482-1132504 CTGAGGGGCCATTTTTCTCAGGG - Intergenic
1145910404 17:28538926-28538948 TGGCCTGGCCATTTTGCTTAGGG - Intronic
1156733478 18:40224432-40224454 AGGCCGGGCATTTTTTTTTAAGG + Intergenic
1165325970 19:35114984-35115006 AGGCGGGGCCAGTTCCCATAAGG - Intergenic
1167507143 19:49876797-49876819 AGGCGGGGCCATTTTTCTTAGGG - Exonic
925361028 2:3280456-3280478 AGGCGGGGCCAGTCTTCCCAGGG - Intronic
937755735 2:125535815-125535837 AGGAGGGGATATTTTTCTAAGGG + Intergenic
947115725 2:226768201-226768223 AGGGTGGGCCATTTTTGATAAGG - Intronic
1169917959 20:10702562-10702584 AGGCAGGGCCTCTTTTCATATGG - Intergenic
1171042368 20:21777172-21777194 AGGCAGCTCTATTTTTCTTAGGG + Intergenic
1171077897 20:22147934-22147956 ATGCAGAGCCATTTTTCTTAAGG - Intergenic
1171373136 20:24674467-24674489 AGGCAGGGCCTTGTTTCTAATGG + Intergenic
1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG + Intronic
956164557 3:66386586-66386608 AGGCAGAGCCAGTTGTCTTAAGG - Intronic
957217330 3:77337320-77337342 AAGAGATGCCATTTTTCTTAGGG - Intronic
964901148 3:161659975-161659997 AGTCGGGGCCTTGTTACTTAGGG + Intergenic
965556355 3:170022173-170022195 AGGCCTGGGCATTTTTCTTGTGG - Intergenic
966385825 3:179396953-179396975 AGGTTGGACCATCTTTCTTATGG - Intergenic
981874894 4:149530133-149530155 AGATGGGGACATTTTTCTTTGGG - Intergenic
982324572 4:154116725-154116747 AGGTGGGGCAAATTTTCTTCTGG + Intergenic
984492020 4:180446214-180446236 AGGCAGAGCCATATTTCTTGAGG + Intergenic
985197785 4:187450790-187450812 AGGAGCGTCAATTTTTCTTAAGG - Intergenic
989208594 5:38836085-38836107 AGGAGGGCTGATTTTTCTTATGG - Intergenic
991663226 5:68970828-68970850 AGGCGTGGGCATTTTACTCATGG - Intergenic
995727017 5:115191893-115191915 AGGCTGGGACTTTTTTCCTAGGG + Intergenic
1009486144 6:64224918-64224940 AAGAGGGGCCATTTTTCCTTGGG - Intronic
1019194972 6:170275888-170275910 AGGTGGGGCCAGGTGTCTTATGG - Intergenic
1029371225 7:100152115-100152137 ACGCAGGGACATGTTTCTTAAGG - Intronic
1030221836 7:107106318-107106340 AGGCCGAGCCATTTTTCTTGTGG - Intronic
1030739580 7:113092321-113092343 AAGAGGAGCCATATTTCTTATGG + Intergenic
1034398709 7:150847248-150847270 AGGCAGGGCCATTGGTCATAAGG - Intronic
1034419797 7:150983762-150983784 AGGCTGGGACATTTGTCTGAAGG + Intergenic
1037537321 8:19836731-19836753 AGGCAGGGACATCTTTCTTTTGG + Intronic
1038885974 8:31663445-31663467 AGGAGGGGCCATTCTTTTTTGGG + Intronic
1043830311 8:84980499-84980521 AGTCCAGGCCATTTTTGTTAAGG - Intergenic
1050113609 9:2241475-2241497 TGTCGGGGCCATTTGTCTTCAGG + Intergenic
1053434390 9:38065908-38065930 AGGCAGGGCCATTATTGTGAGGG - Intronic
1187113965 X:16330691-16330713 AGAGGGGCCCATTTTTCTCATGG - Intergenic
1188246620 X:27842352-27842374 AGTTGGGGCCAATTTTGTTATGG - Intergenic
1194399710 X:93428455-93428477 AGGAGTGGCCACTTTTCGTAAGG - Intergenic
1198695613 X:139333771-139333793 AGCCGGGGCCCTTTTTGCTATGG + Intergenic
1200104284 X:153703679-153703701 CTGAGGGGCCATTTTTCTCAGGG + Intronic