ID: 1167507758

View in Genome Browser
Species Human (GRCh38)
Location 19:49880146-49880168
Sequence AAGGTACAGCAGGCCGGGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1269
Summary {0: 1, 1: 3, 2: 12, 3: 173, 4: 1080}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167507758_1167507765 11 Left 1167507758 19:49880146-49880168 CCGCACCCGGCCTGCTGTACCTT 0: 1
1: 3
2: 12
3: 173
4: 1080
Right 1167507765 19:49880180-49880202 AGTTTCCCTCTTTATTCAATGGG 0: 1
1: 0
2: 4
3: 54
4: 446
1167507758_1167507769 24 Left 1167507758 19:49880146-49880168 CCGCACCCGGCCTGCTGTACCTT 0: 1
1: 3
2: 12
3: 173
4: 1080
Right 1167507769 19:49880193-49880215 ATTCAATGGGGCTATCTTCCAGG 0: 1
1: 0
2: 0
3: 9
4: 86
1167507758_1167507770 25 Left 1167507758 19:49880146-49880168 CCGCACCCGGCCTGCTGTACCTT 0: 1
1: 3
2: 12
3: 173
4: 1080
Right 1167507770 19:49880194-49880216 TTCAATGGGGCTATCTTCCAGGG 0: 1
1: 0
2: 2
3: 6
4: 106
1167507758_1167507764 10 Left 1167507758 19:49880146-49880168 CCGCACCCGGCCTGCTGTACCTT 0: 1
1: 3
2: 12
3: 173
4: 1080
Right 1167507764 19:49880179-49880201 CAGTTTCCCTCTTTATTCAATGG 0: 1
1: 0
2: 8
3: 57
4: 509
1167507758_1167507766 12 Left 1167507758 19:49880146-49880168 CCGCACCCGGCCTGCTGTACCTT 0: 1
1: 3
2: 12
3: 173
4: 1080
Right 1167507766 19:49880181-49880203 GTTTCCCTCTTTATTCAATGGGG 0: 1
1: 0
2: 1
3: 38
4: 426

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167507758 Original CRISPR AAGGTACAGCAGGCCGGGTG CGG (reversed) Intronic
900278331 1:1848087-1848109 ATGAAAAAGCAGGCCGGGTGCGG + Intronic
900782390 1:4626601-4626623 AAGGAAGGGCAGGCCAGGTGTGG + Intergenic
900857235 1:5195964-5195986 ATGGTACACCCGGCCGGGTGTGG - Intergenic
901076272 1:6556690-6556712 AAAGAAAAGCAGGCCGGGCGCGG - Intronic
901106063 1:6757649-6757671 AATGTACATAAGGCCGGGTGCGG - Intergenic
901258036 1:7848805-7848827 GATGTACAGAAGGCCGGGTGCGG - Intronic
901304673 1:8224039-8224061 AAATTTCAGCAGGCCGGGTGTGG + Intergenic
901540442 1:9911711-9911733 AAGTGTGAGCAGGCCGGGTGCGG - Intergenic
901574354 1:10188856-10188878 ATGTGACCGCAGGCCGGGTGCGG - Intergenic
901803047 1:11720300-11720322 AATGTACATCTGGCCGGGCGCGG + Exonic
901823461 1:11845373-11845395 AAAGCTGAGCAGGCCGGGTGTGG - Intergenic
902147719 1:14417704-14417726 AACCTACATCGGGCCGGGTGTGG + Intergenic
902979124 1:20110378-20110400 AAGACAGAGGAGGCCGGGTGGGG + Intergenic
903422929 1:23231622-23231644 AAGTCACAGCAGGCTGGGCGCGG + Intergenic
903465938 1:23552872-23552894 TAGGTATAGGAGGCCGGGCGCGG + Intergenic
903474526 1:23610416-23610438 AAGCTGTAACAGGCCGGGTGTGG - Intronic
903527434 1:24002519-24002541 AAGATAAAAGAGGCCGGGTGTGG + Intergenic
903850744 1:26304392-26304414 AACATAAAGCAGGCCGGGAGCGG + Intronic
903899983 1:26637159-26637181 AAAGTAAAGGAGGCCGGGCGCGG - Intergenic
904030147 1:27528416-27528438 AAAGCACAGCAGGCCGGCCGAGG - Intergenic
904134229 1:28298798-28298820 AAGAGAAGGCAGGCCGGGTGCGG + Intergenic
904582643 1:31557713-31557735 AAGGTAAAACAGGCCGTGTGCGG - Intergenic
904728567 1:32569680-32569702 AAGGAAAAGCTGGCCGGGAGCGG - Intronic
905123604 1:35701831-35701853 AAGAGACAGGAGGCTGGGTGTGG - Intergenic
905138103 1:35816508-35816530 ATAGCACAGCAGGCCAGGTGCGG + Intronic
905163330 1:36057028-36057050 AAAGAATAGTAGGCCGGGTGCGG - Exonic
905419908 1:37834336-37834358 AAGCTACTGGAGGCCAGGTGGGG + Intronic
905699375 1:39999965-39999987 ACGGCACGGCTGGCCGGGTGGGG - Intergenic
905742153 1:40380817-40380839 AAGGTACCACAGGCTGGGTGCGG - Intronic
906072365 1:43026365-43026387 AAGGGAGAACAGGCCGGGTGCGG + Intergenic
906133561 1:43478007-43478029 AAGTGAGAGCAGGCTGGGTGTGG - Intergenic
906283608 1:44570781-44570803 AAGATAAATCAGGCCGAGTGTGG + Intronic
906362609 1:45176553-45176575 AATGTAGACCAGGCCGGGCGCGG - Intronic
906906718 1:49902456-49902478 AATGCAAATCAGGCCGGGTGTGG + Intronic
906909247 1:49928537-49928559 AAGGTACTTCAGCCCGGGTGCGG - Intronic
907024194 1:51099211-51099233 AAGATATAGCCGGCCGGGCGCGG + Intergenic
907120239 1:52002048-52002070 AAGTCAGAGTAGGCCGGGTGCGG + Intergenic
907154270 1:52318805-52318827 ACGATACAGTAGGCCAGGTGTGG + Intronic
907155082 1:52326301-52326323 AAGGTTCAGTAGGCAGGGTAGGG + Intronic
907287540 1:53391427-53391449 AAGCTCCAGGAGGCCGAGTGTGG - Intergenic
907436826 1:54455088-54455110 AAGGTAATTCAGGCCAGGTGAGG - Intergenic
907450233 1:54541646-54541668 AACGTCCATCAGGCCGGGCGTGG - Intergenic
907822549 1:57985196-57985218 ATACTAAAGCAGGCCGGGTGTGG - Intronic
908399310 1:63755547-63755569 AAGGAAGAGCAGGCTGGGCGCGG + Intergenic
909098027 1:71314099-71314121 AAGGAAAAACAGGCTGGGTGTGG - Intergenic
909899185 1:81110989-81111011 ATTCTACAGGAGGCCGGGTGTGG + Intergenic
910190735 1:84592657-84592679 AAGCTTAAGCAGGCCGGGTGTGG + Intergenic
910412647 1:86963765-86963787 ACGGGGCAGCTGGCCGGGTGGGG + Intronic
910465338 1:87493091-87493113 TGGGTACAGCATGCTGGGTGGGG + Intergenic
910707578 1:90146360-90146382 AAGGAAAAAGAGGCCGGGTGCGG + Intergenic
910823921 1:91385031-91385053 GAGGTACATGTGGCCGGGTGCGG - Intronic
911444281 1:97971134-97971156 AGGGATCAGCAGGCCGGGCGCGG + Intergenic
911454931 1:98110904-98110926 ATGGTAAAGCAGGGAGGGTGTGG - Intergenic
912685533 1:111759682-111759704 AATGAAGAGCAGGCCGGGCGCGG + Intronic
912820165 1:112861163-112861185 AATGTAAATAAGGCCGGGTGGGG + Intergenic
913136841 1:115898851-115898873 AAGTTATAGCAGGCTGGGTATGG - Intergenic
913262561 1:117012696-117012718 AAGTAACAGCAGGCTGGGTGCGG - Intronic
914468244 1:147949949-147949971 ACGGTGCGGCTGGCCGGGTGTGG + Intronic
914683691 1:149959354-149959376 AAGACATATCAGGCCGGGTGTGG - Intronic
914760245 1:150592852-150592874 AGGGTAAACCAGGCCAGGTGCGG - Intergenic
914908072 1:151763097-151763119 AAGGTACCGCTGGCCGGGGAGGG - Exonic
915157235 1:153887794-153887816 AAATTACTGCAGGCTGGGTGTGG + Intronic
915266462 1:154721589-154721611 GAGGTAGAGTGGGCCGGGTGCGG - Intronic
915298090 1:154935980-154936002 AAAGTTAAACAGGCCGGGTGTGG - Intronic
915340831 1:155175833-155175855 GAGTTACAGCTGGCTGGGTGTGG - Intronic
915999992 1:160606324-160606346 AAGCCACAGCAGGCAGGGAGGGG - Intergenic
916752258 1:167733964-167733986 AATGCACTGTAGGCCGGGTGCGG + Intronic
916915038 1:169397248-169397270 AAGGAACAGAAGGCCGGGAAAGG - Exonic
917351308 1:174080946-174080968 AAGACACAGCAGGCAGGGAGGGG + Intergenic
917351924 1:174087320-174087342 AAGGCAGAGTAGGCCGGGTGTGG - Intergenic
917376025 1:174350112-174350134 ACGGCACGGCTGGCCGGGTGGGG + Intronic
917844238 1:179007040-179007062 AAGGTGAAGTAGGCTGGGTGTGG + Intergenic
918022714 1:180710851-180710873 ACGGGGCAGCTGGCCGGGTGGGG + Intronic
918077847 1:181183872-181183894 GATGTATAGGAGGCCGGGTGTGG - Intergenic
918228628 1:182509515-182509537 ACGGGGCAGCTGGCCGGGTGGGG + Intronic
918228723 1:182509741-182509763 ATGGCACGGCTGGCCGGGTGGGG + Intronic
918422068 1:184374236-184374258 AAGCTGAGGCAGGCCGGGTGCGG + Intergenic
918728434 1:187955915-187955937 GAGGGATAGCTGGCCGGGTGCGG - Intergenic
920000461 1:202794920-202794942 AAGTTACATGGGGCCGGGTGTGG + Intronic
920110873 1:203586258-203586280 AATGTGCAGCAGGGAGGGTGGGG - Intergenic
920451661 1:206064539-206064561 ACGGGGCAGCTGGCCGGGTGGGG - Intronic
920729921 1:208473801-208473823 ATAGGACAGCAGGCAGGGTGAGG + Intergenic
921243306 1:213209403-213209425 AATGTAAAGGAGGCCAGGTGTGG + Intronic
921767796 1:218992853-218992875 ATGGTAAACCAGGCCGGGTGCGG - Intergenic
922191609 1:223323605-223323627 CAGGTACAGGATGCAGGGTGAGG + Intronic
922285568 1:224167862-224167884 AAGAGACACCAGGCTGGGTGCGG + Intergenic
922438055 1:225625804-225625826 AAAATACAGGAGGCCAGGTGTGG - Intronic
922508014 1:226137813-226137835 ACAATACAACAGGCCGGGTGTGG - Intergenic
923521306 1:234737113-234737135 AATGTATATCAGGCCAGGTGTGG - Intergenic
923561039 1:235042019-235042041 AAGTTAAAGCAGGCTGGCTGTGG - Intergenic
923610058 1:235483446-235483468 AAAGCACACCAGGCCTGGTGCGG + Intronic
923635897 1:235695923-235695945 AGAGTACAGTAGGCTGGGTGCGG - Intronic
923757657 1:236807462-236807484 ATGGTACAGCCGGCCAGGCGCGG - Intronic
924082382 1:240412829-240412851 AAGAAACAGTAGGCCTGGTGCGG + Intronic
924229834 1:241954125-241954147 AATGAAAAGCCGGCCGGGTGCGG - Intergenic
924473201 1:244361517-244361539 AATGTAGAACAGGCCGGGCGCGG - Intronic
924473554 1:244364393-244364415 AATAAAAAGCAGGCCGGGTGTGG - Intronic
924738212 1:246778317-246778339 AAGATAAGGCAGGCCAGGTGTGG - Intergenic
924873802 1:248078190-248078212 ATGGTACAGCTGGCTGGGCGCGG + Intronic
1063351924 10:5364102-5364124 AAGGTAGGGAAGGCTGGGTGCGG - Intergenic
1063933581 10:11053902-11053924 AAGAAATATCAGGCCGGGTGCGG - Intronic
1064142543 10:12802808-12802830 AATGAAGAGCAGGCCGGGGGCGG - Intronic
1064213618 10:13381535-13381557 AAGGAAAAGGAGGCTGGGTGTGG + Intergenic
1064570918 10:16692046-16692068 AAGTTTCAGTAGGCTGGGTGCGG - Intronic
1066116400 10:32244039-32244061 AAGTTGCAGCAGGCCGGGTGCGG - Intergenic
1067040821 10:42952244-42952266 AAGGTAGAACTGGCCGGGAGAGG - Intergenic
1067110843 10:43398628-43398650 AACGTAAAACAGGCCGGGCGCGG - Intronic
1067130368 10:43558737-43558759 AAAGGAAAGTAGGCCGGGTGTGG - Intronic
1067376710 10:45733937-45733959 AACCTACAGTAGGCCGGGTGCGG + Intronic
1067884405 10:50074628-50074650 AACCTACAGTAGGCCGGGTGCGG + Intronic
1068959548 10:62852772-62852794 ATGGAATATCAGGCCGGGTGCGG - Intronic
1068989887 10:63139301-63139323 AAGGAACACCAGGCCAGGCGTGG - Intronic
1069157573 10:65050901-65050923 AAGAGAAAACAGGCCGGGTGCGG - Intergenic
1069501491 10:68956750-68956772 TGGGTACTGGAGGCCGGGTGCGG + Intronic
1069575069 10:69521217-69521239 AAGGCAGAGGAGGCCAGGTGTGG + Intergenic
1069764938 10:70848750-70848772 AAGGTACATGAGGCCAGGTGTGG - Intronic
1069979636 10:72243201-72243223 AAGGTATGGCAGGCCGGGCACGG + Intergenic
1070060034 10:72973052-72973074 AAAGGAGAGCAGGCTGGGTGTGG - Intergenic
1070071120 10:73090768-73090790 AAGTAACTGCAGGCCAGGTGCGG + Intronic
1070086610 10:73244203-73244225 AAGGAACATGAGGCCGGGTATGG + Exonic
1070176887 10:73978302-73978324 AAGTAATAGTAGGCCGGGTGCGG + Intergenic
1070602584 10:77876246-77876268 AAGGTAAAGGTGGCCAGGTGAGG + Intronic
1070831706 10:79421917-79421939 AATGTATAGAAGGCTGGGTGCGG - Intronic
1070910723 10:80115541-80115563 AAAATACAGAAGGCCGGGTGCGG - Intergenic
1071174749 10:82912933-82912955 AAAGTACTTCCGGCCGGGTGCGG + Intronic
1071297944 10:84236004-84236026 AACGTATTGCCGGCCGGGTGCGG + Intronic
1071364930 10:84889945-84889967 AATATACAGAAGGCCGGGCGCGG + Intergenic
1071417180 10:85452223-85452245 AAGCAACAGAAGGCCGGGTGCGG - Intergenic
1071798022 10:89026860-89026882 AAAGTGCAAAAGGCCGGGTGTGG + Intergenic
1072137698 10:92562847-92562869 AAAGAAAAGCAGGCTGGGTGTGG + Intronic
1072250440 10:93578124-93578146 AAAGAAGAGCAGGCCAGGTGTGG + Intronic
1072545791 10:96436974-96436996 AATGTATAGCAGGCCAGGTGCGG - Intronic
1072557950 10:96539178-96539200 ATGCAACATCAGGCCGGGTGTGG + Intronic
1072575614 10:96697432-96697454 AAAGTAAAACAGGCTGGGTGTGG + Intronic
1072626421 10:97115277-97115299 AAGGAATAGCAGGCTGGGAGTGG - Intronic
1072644356 10:97241028-97241050 AAGATACAGCAGGCTGGGTGCGG + Intronic
1072648260 10:97275716-97275738 ATGGCACAGCTGGCCGGGCGGGG - Intronic
1072811205 10:98463509-98463531 AAAGTATAGTAGGCTGGGTGTGG + Intronic
1073062279 10:100739904-100739926 AGGGGACAGCTGGCCAGGTGGGG + Intronic
1073273841 10:102290793-102290815 AAAGAAAAGCAGGCTGGGTGTGG - Intronic
1073282778 10:102366874-102366896 AAGAGACAGCAGGCTGGGTGCGG - Intronic
1073352353 10:102828861-102828883 AAAGTAGGGCAGGCCGGGCGTGG - Intergenic
1073443398 10:103565941-103565963 AAGCTACAACTGGCTGGGTGCGG - Intronic
1074450037 10:113551886-113551908 ATGGTATAGGAGGCGGGGTGGGG + Intronic
1074488617 10:113915918-113915940 AAGGAATAACAGGCCAGGTGTGG - Exonic
1074603575 10:114938537-114938559 CAGGTACTGCAGCCCGGGTGGGG + Exonic
1074920390 10:118002853-118002875 AAGAGACTGCAGGCCGTGTGTGG + Intergenic
1075106869 10:119544977-119544999 AAGGAAAAAAAGGCCGGGTGCGG + Intergenic
1075148261 10:119902064-119902086 AAGGTTAAATAGGCCGGGTGTGG + Intronic
1075359702 10:121819853-121819875 AAAGTAAAACAGGCCGGGCGTGG + Intronic
1075379358 10:122005983-122006005 AACATACAGTAGGCCAGGTGTGG - Intronic
1075819847 10:125297462-125297484 AAAGTAAAGCATGCTGGGTGTGG + Intergenic
1076036892 10:127206432-127206454 AATATACAGTAGGCCGGGCGCGG - Intronic
1076375778 10:129983737-129983759 AAGCTGCAGCAGGCAGGGAGGGG + Intergenic
1077051870 11:570260-570282 CAGGGAAAACAGGCCGGGTGTGG + Intergenic
1077088124 11:764760-764782 AAGGTGCAGAAGGTAGGGTGGGG + Intronic
1077504124 11:2922336-2922358 CAGGGACAGCAGTCAGGGTGGGG + Intronic
1077606706 11:3617221-3617243 CAGGCACAGGAGACCGGGTGGGG - Intergenic
1078219455 11:9339481-9339503 AATAAACAGCAGGCCAGGTGCGG + Intergenic
1078326186 11:10383139-10383161 AAGGTACAACTGGCCAGGCGCGG + Intronic
1078384307 11:10874319-10874341 AAGGCACTGGAGGCTGGGTGTGG - Intergenic
1078573840 11:12482334-12482356 AAAGGAAAGCTGGCCGGGTGTGG + Intronic
1078749459 11:14146438-14146460 AAGGTACAGTAGGCCAGGTGTGG - Intronic
1079039860 11:17050661-17050683 ATGGGGCAGCTGGCCGGGTGGGG + Intergenic
1079285469 11:19126638-19126660 AAGGAACAGCAGGCTGGGCATGG - Intronic
1079378388 11:19914832-19914854 CAGGAACAACAGGCCGGGCGCGG - Intronic
1080365295 11:31567221-31567243 GAAGTACTACAGGCCGGGTGCGG - Intronic
1080475945 11:32591137-32591159 AATGCACAACAGGCCTGGTGCGG - Intronic
1081228322 11:40552978-40553000 AAGGTGGATCAGGCCGGGTGCGG + Intronic
1081411070 11:42759199-42759221 AAGTGACAAGAGGCCGGGTGTGG + Intergenic
1081443651 11:43108112-43108134 AAGTTACTTAAGGCCGGGTGCGG - Intergenic
1081547994 11:44085446-44085468 AAAATAGAGCAGGCCAGGTGAGG - Intergenic
1081696635 11:45115637-45115659 AAGCTAGAGCAGGCCAGGTGTGG + Intronic
1081702099 11:45158593-45158615 CGGGTACAGCAGACAGGGTGAGG - Intronic
1082844710 11:57716688-57716710 ACGGGGCGGCAGGCCGGGTGGGG + Intronic
1083145229 11:60753075-60753097 AAGGTAGAGGAGGCTCGGTGGGG - Intergenic
1083248215 11:61446588-61446610 AAGGCACAGCAGGCAGAATGAGG + Exonic
1083382355 11:62278893-62278915 ATGGCACAGCTGGCCGGGCGGGG - Intergenic
1083465842 11:62845436-62845458 AAAGAAAAGCAGGCTGGGTGCGG - Intergenic
1083954817 11:65977476-65977498 AAGGCAGAGCAGGCCCTGTGGGG - Intronic
1084185953 11:67471315-67471337 AATGAACATGAGGCCGGGTGTGG - Intergenic
1084197948 11:67536154-67536176 TAGGTAGAGCTGGCTGGGTGTGG + Intergenic
1084198074 11:67537224-67537246 AAGCTAGGCCAGGCCGGGTGTGG + Intergenic
1084311407 11:68318333-68318355 AAAAAAAAGCAGGCCGGGTGTGG - Intronic
1084402356 11:68952002-68952024 AAAGTAAATCAGGCCAGGTGTGG - Intergenic
1084418063 11:69045255-69045277 AAAGTAAAGTAGGCTGGGTGCGG + Intergenic
1084626329 11:70310672-70310694 AAAGTACATGGGGCCGGGTGTGG - Intronic
1084724658 11:70933627-70933649 AAGCAACAACAGGCTGGGTGTGG + Intronic
1084973921 11:72786059-72786081 AGGGTGCAGCAGGCCGGGCGCGG + Intronic
1085094865 11:73752166-73752188 ATGCTACAGAAGGCTGGGTGTGG + Intronic
1085946831 11:81282532-81282554 AGAGTACAACTGGCCGGGTGTGG - Intergenic
1085985953 11:81788590-81788612 AATAGACAGCAGGCCGGGCGCGG - Intergenic
1086027069 11:82306695-82306717 GAGTTACAGCTGGCCGGGCGTGG - Intergenic
1086357942 11:86025109-86025131 AAAAAATAGCAGGCCGGGTGTGG + Intronic
1086360137 11:86049907-86049929 AAACTACATCAGGCCAGGTGAGG + Intronic
1086386679 11:86316218-86316240 AAAGAAAAGAAGGCCGGGTGTGG + Intronic
1086821186 11:91437937-91437959 AAGTTACACTAGGCTGGGTGCGG - Intergenic
1087214804 11:95482746-95482768 ATGGGGCAGCTGGCCGGGTGGGG - Intergenic
1088213803 11:107485464-107485486 AAGTAACAACAGGCCGGGCGCGG + Intergenic
1088879578 11:113962981-113963003 AAGTCACAGCAGGCCGGGTGTGG + Intergenic
1089238439 11:117053046-117053068 AAGTAACTGCAGGCCGGGCGCGG + Intronic
1089271123 11:117302041-117302063 AACGTAAAGCTGGCCGGGTGCGG + Intronic
1089501896 11:118937159-118937181 AAGGGACATCAGGCCGGGCGCGG - Intronic
1089501946 11:118937473-118937495 AAGGGACATCAAGCTGGGTGCGG - Intronic
1089746813 11:120623421-120623443 AGAGTACAGGGGGCCGGGTGCGG - Intronic
1089996685 11:122914731-122914753 AAGCACCACCAGGCCGGGTGTGG - Intronic
1090082057 11:123620181-123620203 AAGGAAAAAGAGGCCGGGTGTGG + Intronic
1090388035 11:126367855-126367877 TATGCATAGCAGGCCGGGTGTGG + Intronic
1090801666 11:130176676-130176698 AAGGAAAAGTAGGTCGGGTGCGG - Intronic
1091454802 12:599089-599111 AAAGTATTCCAGGCCGGGTGAGG + Intronic
1091497310 12:983708-983730 AAGATGCAGCCGGCCGCGTGCGG - Intronic
1091529700 12:1342172-1342194 AAGTTAATGCGGGCCGGGTGCGG + Intronic
1091751850 12:3027254-3027276 AAGGAGCAGGAGGCTGGGTGTGG - Intronic
1091785378 12:3240111-3240133 AAGGTTGTGGAGGCCGGGTGAGG - Intronic
1092178324 12:6426460-6426482 AGGGAGCATCAGGCCGGGTGCGG + Intergenic
1092186290 12:6481357-6481379 AAAATACAGAAGGCCCGGTGCGG - Intergenic
1092483301 12:8880071-8880093 AAGCTACGGAAGGCCAGGTGTGG + Intronic
1092495437 12:8988870-8988892 AAGTTAGAGTAGGCCAGGTGTGG - Intronic
1093178458 12:15940639-15940661 GAAGTAAAGCAGGCCGGATGCGG - Intronic
1093941811 12:25063340-25063362 AAAGTAAAACAGGCCGGGTGCGG - Intronic
1093973205 12:25393217-25393239 AAGGTATTGCTGGCCGGGCGTGG + Intergenic
1094208817 12:27869065-27869087 AAGGTACAATAGGCCAGGTATGG + Intergenic
1094212946 12:27911224-27911246 AAGGAAAAGATGGCCGGGTGCGG - Intergenic
1094382194 12:29855125-29855147 AAGATTCAGTTGGCCGGGTGTGG + Intergenic
1094401520 12:30066091-30066113 AAAGGAAAGGAGGCCGGGTGTGG + Intergenic
1094632666 12:32192139-32192161 AAGATAAAGCAGGCCAGGTGCGG + Intronic
1095268747 12:40191161-40191183 AAGGTAAAAGTGGCCGGGTGCGG - Intergenic
1095448356 12:42304071-42304093 AAAGTAACACAGGCCGGGTGCGG - Intronic
1095745585 12:45654718-45654740 AAAGTAAAACAGGCCGGGTGCGG + Intergenic
1095774497 12:45997444-45997466 ATGGTACAACAGGCCAAGTGTGG - Intergenic
1096106965 12:49001724-49001746 AAGATAGTGCTGGCCGGGTGCGG + Intergenic
1096129247 12:49144349-49144371 AAAGTAAAGGAGGCCGGGCGCGG - Intergenic
1096246823 12:49995056-49995078 AATGTACAGGCGGCCAGGTGCGG + Intronic
1096267310 12:50134088-50134110 AAGGTAAAACAGGCTTGGTGTGG + Intronic
1096276730 12:50215761-50215783 AAAATAAAGCAGGCCGGGCGCGG - Intronic
1096384512 12:51186196-51186218 AAACAACAACAGGCCGGGTGTGG - Intergenic
1096401935 12:51314507-51314529 AAGGTATATCTGGCTGGGTGTGG + Intronic
1096494325 12:52030717-52030739 AAGGTTAAGTAGGCCAGGTGTGG - Intronic
1097216128 12:57414538-57414560 AATGAGAAGCAGGCCGGGTGCGG + Intronic
1097702088 12:62830543-62830565 AAGGAATAACAGGCTGGGTGCGG - Intronic
1097723579 12:63049903-63049925 AACGTACAGTAGGCCAGGCGTGG + Intergenic
1097933252 12:65214283-65214305 AAGTAACAGTAGGCTGGGTGTGG - Intronic
1098069416 12:66655887-66655909 AAAGTACAGAAGGCCAGGTGCGG - Intronic
1098187686 12:67915614-67915636 AAGGACCAGGAGGCCGGGCGCGG + Intergenic
1098295693 12:69001814-69001836 AATGTAAGGTAGGCCGGGTGTGG + Intergenic
1098418349 12:70262961-70262983 AAGGCAAAATAGGCCGGGTGTGG - Intronic
1098489111 12:71054278-71054300 AAAGTACAACAGGCCTGGCGCGG - Intronic
1098946890 12:76599612-76599634 AGGTTACAGCAGGCCGGGTGTGG - Intergenic
1099169318 12:79344745-79344767 AAGTGACAGTAGGCCGGGTGTGG - Intronic
1099255272 12:80307540-80307562 ACGGGGCAGCTGGCCGGGTGGGG + Intronic
1100228980 12:92588200-92588222 AAAATAAACCAGGCCGGGTGCGG + Intergenic
1100455971 12:94752130-94752152 AAGGAAAGGAAGGCCGGGTGCGG - Intergenic
1100838299 12:98587921-98587943 AAGGAAGGGCTGGCCGGGTGTGG + Intergenic
1100942984 12:99744699-99744721 AAGATACTTCAGGCCAGGTGCGG + Intronic
1101130726 12:101688668-101688690 AAGGTACTTGAGGCTGGGTGTGG + Intergenic
1101356756 12:103986209-103986231 AATGCACTGTAGGCCGGGTGCGG - Intronic
1101985283 12:109441295-109441317 AAGGGACAGCAGGCTGAGTTTGG + Intronic
1102233869 12:111282029-111282051 AACATACCACAGGCCGGGTGTGG + Intronic
1102297018 12:111745041-111745063 AAGGTAAAGCAGCCATGGTGAGG + Exonic
1102338303 12:112101464-112101486 AAGATAATACAGGCCGGGTGCGG + Intronic
1102358123 12:112257897-112257919 AAGAAACAGCCGGCAGGGTGTGG + Intronic
1102483877 12:113243077-113243099 AAACTACATCTGGCCGGGTGCGG + Intronic
1103065847 12:117896748-117896770 AAGGTTGTGCAGGCCAGGTGTGG - Intronic
1103365662 12:120381058-120381080 GAGCTACATCTGGCCGGGTGCGG + Intergenic
1103485759 12:121281655-121281677 TAGGTGCACAAGGCCGGGTGCGG + Intronic
1103812579 12:123627554-123627576 AGGCTACAGAAGGCTGGGTGTGG + Intronic
1103924342 12:124415269-124415291 AGGGCACAGCAGGCCTGGGGTGG - Intronic
1104041093 12:125131500-125131522 AATTTACACAAGGCCGGGTGTGG - Intronic
1104426312 12:128681268-128681290 AATGAAAAACAGGCCGGGTGCGG - Intronic
1104448037 12:128848608-128848630 AAGGTGGAGGAGGCTGGGTGCGG + Intergenic
1104496467 12:129244929-129244951 AAAGAACACCAGGCCGGGCGTGG - Intronic
1104710271 12:130980686-130980708 GAGGAACTGCAGGCCGGGCGCGG - Intronic
1104905148 12:132209234-132209256 AGGTTGCAGTAGGCCGGGTGCGG + Intronic
1104999020 12:132676716-132676738 GAGGTAGAGCAGGCTGGGGGTGG - Intronic
1105016628 12:132789683-132789705 AAAATACAGCAGGCCGGGCGCGG + Intronic
1105016636 12:132789741-132789763 AAAATACAGCAGGCCGGGCGCGG + Intronic
1105297569 13:19102805-19102827 TAAAGACAGCAGGCCGGGTGTGG + Intergenic
1105945502 13:25186264-25186286 AAGGCACAGGAGGGTGGGTGAGG + Intergenic
1105976736 13:25480144-25480166 ATGGGGCAGCTGGCCGGGTGGGG + Intronic
1106199093 13:27521305-27521327 AAGTAAAAGCAGGCTGGGTGCGG + Intergenic
1106229980 13:27814227-27814249 AGGGTGCAGCGGGCAGGGTGAGG + Intergenic
1106259958 13:28057747-28057769 AACACACAGGAGGCCGGGTGCGG + Intronic
1107475442 13:40731279-40731301 AAGACAGAGGAGGCCGGGTGTGG + Intronic
1107528352 13:41256612-41256634 ATTCTACAACAGGCCGGGTGCGG - Intronic
1107931099 13:45308336-45308358 AAGGTAAATTGGGCCGGGTGAGG + Intergenic
1108921597 13:55681394-55681416 AATGTAGAGAAGGCCAGGTGTGG - Intergenic
1109092925 13:58071402-58071424 AAGATACATCAGGCCAGGTGCGG - Intergenic
1110517029 13:76425548-76425570 AATGTACTTAAGGCCGGGTGCGG - Intergenic
1110617586 13:77558521-77558543 ATGGTACCGGAGGCCGGGCGTGG + Intronic
1111487512 13:88923472-88923494 AAAGAATAACAGGCCGGGTGCGG + Intergenic
1111547879 13:89767649-89767671 AAGATACCGGAGGCCGGGCGCGG + Intergenic
1111643859 13:91005586-91005608 AAAGTACTGAAGGCCGGGCGCGG + Intergenic
1111840874 13:93449536-93449558 AAGGGACTGTAGGCCGGGCGCGG + Intronic
1111920941 13:94410706-94410728 AAGGTTCTCTAGGCCGGGTGCGG + Intergenic
1112756283 13:102637839-102637861 AAGGTATAACTGGCTGGGTGTGG - Intronic
1112875552 13:104033731-104033753 ATGGTAAAGAAGGCCAGGTGGGG - Intergenic
1114270344 14:21097288-21097310 AAGGTACAGCAGGAGGCGAGAGG + Intronic
1114279229 14:21175660-21175682 AGGTAACAGCAGGCCAGGTGTGG + Intergenic
1114416591 14:22548948-22548970 TAAGAAAAGCAGGCCGGGTGTGG - Intergenic
1114416815 14:22550450-22550472 AAGGCAGAGCAGGCTGGGTGGGG - Intergenic
1114912839 14:27221522-27221544 AAGGAGGAACAGGCCGGGTGCGG + Intergenic
1115164330 14:30430753-30430775 AAGGTACAGAGGGCTGGGTGCGG - Intergenic
1115225978 14:31102718-31102740 AACTGACAGCAGGCCGGGCGCGG - Intronic
1115311311 14:31981019-31981041 AATGTAGAGAAGGCCGGGCGCGG - Intergenic
1115376074 14:32677114-32677136 GAGGTCTTGCAGGCCGGGTGCGG - Intronic
1115493919 14:33984440-33984462 ATGGGGCAGCTGGCCGGGTGGGG + Intronic
1115915592 14:38309729-38309751 AAGGTACGCCAGGCATGGTGGGG + Intergenic
1116830708 14:49716672-49716694 AAGGTATAGCAAGCCGGGCGTGG - Intronic
1116884689 14:50208359-50208381 AAGCTACAATAGGCTGGGTGCGG + Intronic
1117147608 14:52850809-52850831 AGGGCAGAGTAGGCCGGGTGTGG + Intergenic
1117239805 14:53818616-53818638 AAAGCAAAACAGGCCGGGTGTGG + Intergenic
1117376771 14:55124744-55124766 AAGAGACAGCAGGCTGGGCGCGG - Intronic
1117386649 14:55221022-55221044 CAGTTACATCAGGCCTGGTGCGG + Intergenic
1117477337 14:56109836-56109858 AAGTGAATGCAGGCCGGGTGTGG + Intergenic
1117820422 14:59643506-59643528 AAAGTTCAGGAGGCCAGGTGTGG - Intronic
1117909271 14:60620722-60620744 AGAGAACAACAGGCCGGGTGTGG - Intergenic
1118028898 14:61800106-61800128 AAGGGAGGCCAGGCCGGGTGTGG - Intergenic
1118825748 14:69379228-69379250 AAGCTAAAATAGGCCGGGTGCGG - Intergenic
1119248805 14:73134816-73134838 ATGGTACAATAGGCAGGGTGCGG - Intergenic
1119753988 14:77100857-77100879 AAAGTGAATCAGGCCGGGTGTGG - Intronic
1119848830 14:77850943-77850965 AAGATACATCGGGCCGGGTGTGG - Intronic
1120124345 14:80723114-80723136 AAGATAAAGAGGGCCGGGTGCGG - Intronic
1120505773 14:85352686-85352708 ACGGGGCAGCTGGCCGGGTGGGG + Intergenic
1120713368 14:87815825-87815847 AAGGTACAGGAGCCGGGGTGAGG - Intergenic
1120971646 14:90213087-90213109 AATGTAATGCAGGCTGGGTGTGG - Intergenic
1121055011 14:90845277-90845299 ATGACACAGTAGGCCGGGTGTGG - Intergenic
1121122727 14:91386151-91386173 AAAGTAGAGCAGGCCGGGCGCGG + Intronic
1121300750 14:92868778-92868800 AAAGTTCTGGAGGCCGGGTGCGG + Intergenic
1122096700 14:99377653-99377675 AAGGCAGAGGAGGCCGGGCGCGG + Intergenic
1122100164 14:99402163-99402185 AAGGTAGAGCAGGAGGGGAGGGG - Intronic
1122424449 14:101597605-101597627 ATGATACAACAGGCCGGGCGCGG - Intergenic
1122535409 14:102458495-102458517 TCGGAACAGCAGGCCGGGTCTGG - Intronic
1122673317 14:103389072-103389094 AAGAAAAGGCAGGCCGGGTGTGG + Intronic
1122705078 14:103615825-103615847 AAGGTGATACAGGCCGGGTGCGG - Intronic
1123159549 14:106264649-106264671 AGTGTGCAGGAGGCCGGGTGAGG - Intergenic
1123167899 14:106344056-106344078 AATGCACAGGAGGCCAGGTGGGG - Intergenic
1202879811 14_KI270722v1_random:47260-47282 AAGAACAAGCAGGCCGGGTGCGG + Intergenic
1123414247 15:20083454-20083476 AAGGGAAGGCAGGCAGGGTGGGG + Intergenic
1123523589 15:21090565-21090587 AAGGGAAGGCAGGCAGGGTGGGG + Intergenic
1123694101 15:22864442-22864464 AGAGGACAGCAGGCCGGGCGTGG - Intronic
1124246179 15:28072297-28072319 ATAGTGGAGCAGGCCGGGTGCGG + Intronic
1124611390 15:31211861-31211883 AAGATAAAACAGGCTGGGTGTGG + Intergenic
1125521408 15:40349834-40349856 AAGCCACCACAGGCCGGGTGTGG + Intergenic
1125632460 15:41158448-41158470 AAGCTACAGTAGGCCGGGCGCGG + Intergenic
1125708416 15:41763451-41763473 AAGAAACAGTAGGCCGGATGCGG + Intronic
1125823862 15:42658820-42658842 AAAGAAAAGCAGGCCAGGTGTGG + Intronic
1125911429 15:43443114-43443136 ATGTTACTGCTGGCCGGGTGTGG - Intronic
1125912391 15:43452902-43452924 AAAGTACTCCAGGCCGGGCGCGG + Intronic
1126116010 15:45208216-45208238 AAGAAAGAGCAGGCCAGGTGAGG - Intergenic
1126583090 15:50258868-50258890 AAGGAAGGGCAGGCCGGGTGCGG + Intronic
1127098404 15:55536137-55536159 GAAATATAGCAGGCCGGGTGCGG - Intergenic
1127272362 15:57413146-57413168 AAGGAGAAGAAGGCCGGGTGTGG - Intronic
1127791534 15:62402949-62402971 AAAAAACAGCAGGCTGGGTGTGG + Intronic
1128121319 15:65149569-65149591 ATGGTAAATAAGGCCGGGTGTGG + Exonic
1128126140 15:65194477-65194499 CAGGGACTGCAGGCTGGGTGGGG - Intergenic
1128874648 15:71192190-71192212 AAGGTCAAGAAGGCCAGGTGCGG - Intronic
1128979796 15:72178016-72178038 AAGCTAAAGCCGGCCAGGTGCGG - Intronic
1129080281 15:73033365-73033387 AAGGTGCTGTAGGCCGGGTGCGG + Intergenic
1129171537 15:73811064-73811086 AAGGGACTGCATGCCGGGTGAGG + Intergenic
1130169533 15:81497387-81497409 AAGGCACAGAAGGCCTGCTGCGG - Intergenic
1130222688 15:82033843-82033865 AAAGTAAAGCTGGCCGGGCGCGG - Intergenic
1130544620 15:84845766-84845788 ATAGCACTGCAGGCCGGGTGTGG + Intronic
1130620710 15:85459487-85459509 AAGAAAAAGCAGGCTGGGTGTGG - Intronic
1130685259 15:86031544-86031566 AAGCTCCATCAGGCTGGGTGCGG - Intergenic
1130751276 15:86715766-86715788 AATATAAATCAGGCCGGGTGCGG + Intronic
1131104037 15:89718048-89718070 AAGTTACATTAGGCCAGGTGGGG + Intronic
1131823132 15:96293221-96293243 AAGGCACACTAGGCTGGGTGTGG + Intergenic
1132000964 15:98179737-98179759 AAGGAACCACAGGCCGGGCGCGG - Intergenic
1132015234 15:98309464-98309486 AAAGAAGAGGAGGCCGGGTGAGG - Intergenic
1132364710 15:101249091-101249113 AATGTAATGCAGGCCGGGCGCGG - Intronic
1132412029 15:101587741-101587763 AATGCTCAGCAGGCCTGGTGTGG + Intergenic
1132423928 15:101698044-101698066 AAGCTACCCCAGGCCGGGCGCGG + Intronic
1132561108 16:594432-594454 TGGGTACAGCAGGCAGCGTGTGG - Intronic
1132813119 16:1811420-1811442 AAAGAACAACAGGCCGGGCGCGG + Intronic
1132984053 16:2754578-2754600 AAGGAAAACCAGGCCGGGTACGG - Intronic
1133070035 16:3239988-3240010 AAGAAACTGCCGGCCGGGTGCGG - Intergenic
1133094321 16:3431031-3431053 AAGAGACTGCAGGCCGGGTGTGG - Intronic
1133104963 16:3501490-3501512 ACCGAACAGCAGGCCGGGCGCGG + Intronic
1133157875 16:3888566-3888588 AACTGAAAGCAGGCCGGGTGCGG - Intergenic
1134476873 16:14581627-14581649 AAGGGTCAGGAGGCTGGGTGCGG + Intronic
1134628407 16:15739389-15739411 AGAGTGCGGCAGGCCGGGTGCGG - Intronic
1134653772 16:15930943-15930965 AAAGTTCTGCAGGCCAGGTGTGG - Intergenic
1135021317 16:18965398-18965420 AACACAAAGCAGGCCGGGTGCGG + Intergenic
1135064461 16:19297955-19297977 TATGTACAGGTGGCCGGGTGCGG + Intronic
1135292278 16:21250204-21250226 AAGATACAGCAGAACAGGTGGGG + Exonic
1135546536 16:23370841-23370863 AAGGAACAGCACTCCAGGTGAGG + Intronic
1135553469 16:23416317-23416339 AAGAAACATCAGGCTGGGTGTGG - Intronic
1135558489 16:23456563-23456585 AAGGGACTTCTGGCCGGGTGCGG - Intergenic
1135731644 16:24899690-24899712 AAAGTACCGCAGGCCAGCTGTGG - Intronic
1135872326 16:26162368-26162390 AAAGGACGCCAGGCCGGGTGCGG + Intergenic
1136502843 16:30682052-30682074 TACGTATAGGAGGCCGGGTGCGG + Intergenic
1136574790 16:31117079-31117101 AAGGTTCAGCTGGCCGGGCACGG + Intronic
1136624543 16:31454014-31454036 ATAATAAAGCAGGCCGGGTGTGG + Intergenic
1137973015 16:53004341-53004363 AAGGTACAGTAGACCAGGTGCGG - Intergenic
1138699277 16:58846152-58846174 ACGGGGCAGCTGGCCGGGTGGGG + Intergenic
1138817501 16:60219851-60219873 GAGTTACAACTGGCCGGGTGTGG - Intergenic
1139464946 16:67149470-67149492 AAGGTGCGGAAGGCAGGGTGAGG + Exonic
1139568372 16:67794455-67794477 AATACACAGCAGGCCGGGTGTGG - Intronic
1139682559 16:68576454-68576476 AAGCTCCAGCAGGCCGGGCACGG + Intergenic
1139718223 16:68831378-68831400 AAGCTAAAGCAGTCCGGGCGTGG - Intronic
1140409212 16:74731432-74731454 AAGGCAGAGATGGCCGGGTGTGG - Intronic
1140592613 16:76371573-76371595 AAGTGACAACAGGCCAGGTGTGG - Intronic
1141073238 16:80977779-80977801 AGGCTACTTCAGGCCGGGTGCGG + Intronic
1141528993 16:84633109-84633131 AAGTAAAAGCAGGCTGGGTGCGG + Intergenic
1141560783 16:84866524-84866546 AAGCTGCCTCAGGCCGGGTGCGG - Intronic
1141731720 16:85827454-85827476 GATGTAAAGCAGGCTGGGTGTGG + Intergenic
1142133624 16:88441996-88442018 AGGGCACAGGAGGCTGGGTGGGG - Intergenic
1142279651 16:89141260-89141282 AAGGCACAGCAAGGCGGGTGAGG + Intronic
1142426140 16:90003288-90003310 AAGGTAGCCCAGGCCGGGGGAGG - Intergenic
1142484530 17:237855-237877 ATGACACAGCAGGCCGGGTGCGG + Intronic
1142512998 17:409688-409710 AAGGTACAGGAGGCCGAGCACGG + Intergenic
1142607387 17:1089667-1089689 AAGGAAATGCAGGCCGGGCGCGG + Intronic
1142745013 17:1951999-1952021 CAGGGACAGCAGGACGGCTGAGG + Intronic
1142746566 17:1961989-1962011 AAAGAAAAGCAGGCCGGGCGTGG + Intronic
1142756985 17:2022440-2022462 ATGATACAGGAGGCCAGGTGTGG - Intronic
1142814674 17:2415770-2415792 TGGGTTCAGAAGGCCGGGTGCGG - Intronic
1142838491 17:2607774-2607796 AAGGGACATCAAGCCGGGTGCGG - Intronic
1142842546 17:2644954-2644976 AATGTTCATCAGGCCAGGTGTGG + Intronic
1143028154 17:3953056-3953078 AGGGTACAGCAGGGCGGGGCGGG + Intronic
1143201246 17:5115259-5115281 AAGGAACAGAGGGCCGGATGTGG + Intronic
1143263706 17:5619778-5619800 ATGGTCCAGCAGGCAGGGTACGG + Intergenic
1143456554 17:7071584-7071606 AAGGTATGACAGGCCAGGTGCGG - Intergenic
1143975481 17:10826252-10826274 AAAATATAGCTGGCCGGGTGCGG - Intronic
1144264625 17:13556215-13556237 AAGGCAAAGCCGGCCGGGCGCGG + Intronic
1144348968 17:14375908-14375930 ATGGTGAAGAAGGCCGGGTGCGG - Intergenic
1144394695 17:14832839-14832861 AAGAAAAAGCAGGCCGGGCGCGG - Intergenic
1144446933 17:15340257-15340279 AAGTAACAGTAGGCCGGGCGCGG + Intronic
1144551649 17:16246227-16246249 TAAGTACTTCAGGCCGGGTGCGG + Intronic
1144555000 17:16274430-16274452 GAAGTAAAGGAGGCCGGGTGCGG + Intronic
1144600826 17:16611424-16611446 AGTGTAAAGCAGGCCGAGTGTGG - Intergenic
1144694456 17:17292600-17292622 AAGGAACAGGCGGCCGGGTGTGG - Intergenic
1144745721 17:17612992-17613014 AAGGTAGAGCTGGCCGGGCGCGG + Intergenic
1145081654 17:19899243-19899265 GAGGTAAAGGAGGCCAGGTGTGG - Intergenic
1145083534 17:19916031-19916053 AAGGAACAGCAAGCCCCGTGTGG - Intronic
1145094167 17:20009856-20009878 AAGGCACAACAGGGAGGGTGCGG - Intronic
1146007995 17:29173674-29173696 AAGTAACGGCAGGCCGGGTGCGG - Intronic
1146069723 17:29668956-29668978 TGAGTAGAGCAGGCCGGGTGTGG + Intronic
1146198534 17:30833970-30833992 AAGTTAAACCAGGCCAGGTGCGG - Intronic
1146230332 17:31102450-31102472 AAGGGAGAGTAGGCCAGGTGCGG + Intronic
1146696613 17:34913469-34913491 AAGGAAGTGAAGGCCGGGTGTGG + Intergenic
1146721511 17:35127278-35127300 AAGGTCCAGCAGGCCCCTTGTGG - Exonic
1146756304 17:35434592-35434614 AAGCTAGCGCAGGCCGGGTGCGG + Intergenic
1146859520 17:36284827-36284849 AAAGTAAAACAGGCTGGGTGCGG - Intronic
1146961923 17:36988020-36988042 AAGTTACATGAGGCTGGGTGTGG + Intronic
1147006735 17:37409377-37409399 AAGTGAAAGCAGGCTGGGTGTGG - Intronic
1147089844 17:38088913-38088935 AAAGTAAAACAGGCTGGGTGCGG - Intergenic
1147107367 17:38231607-38231629 AAAGTAAAACAGGCTGGGTGCGG + Intergenic
1147115548 17:38296797-38296819 AAGGAAAAGGAGGCCGGGCGCGG - Intergenic
1147327280 17:39675513-39675535 AAGGAACAGCAGGCCAGGCCGGG + Intronic
1147737191 17:42647097-42647119 AAGGTACTTTAGGCTGGGTGTGG + Intergenic
1147942598 17:44059872-44059894 AAGTTAGAGTAGGCCGGGTGTGG + Intronic
1148008311 17:44453120-44453142 GAGATACTGAAGGCCGGGTGTGG - Intronic
1148010526 17:44476493-44476515 AAAGTAAAACAGGCTGGGTGCGG - Intronic
1148097822 17:45066000-45066022 AAGGGGCAGGAGGCTGGGTGTGG - Intronic
1148109059 17:45134484-45134506 AAGATACAATAGGCCGGGCGCGG + Intronic
1148112538 17:45154122-45154144 AAGAAATAGGAGGCCGGGTGTGG - Intergenic
1148114290 17:45166085-45166107 AAGATGCAGCGGGCCGGGCGTGG - Intronic
1148414130 17:47492823-47492845 AAGGAAAAGGAGGCCGGGCGCGG + Intergenic
1148452949 17:47792032-47792054 AAGGAAAAGGAGGCCAGGTGCGG - Intergenic
1148917043 17:50990316-50990338 AAGATACTGTAGGCCGGGCGTGG - Intronic
1149177637 17:53893084-53893106 AAGGTACAACCGGCTGGGAGTGG - Intergenic
1149779472 17:59386030-59386052 AAAGGAAAACAGGCCGGGTGCGG + Intronic
1150158236 17:62871916-62871938 AAAGTATGGCAGGCCAGGTGCGG + Intergenic
1150366751 17:64594694-64594716 AAGTTACATTAGGCCGGGCGCGG + Intronic
1150835678 17:68562112-68562134 AAGGTACTGGGGGCCGGGCGTGG - Intronic
1151226744 17:72653727-72653749 AAAGTGCAGCAGGCCGGGTGAGG - Intronic
1151260185 17:72910040-72910062 AAAGTTGAGGAGGCCGGGTGCGG - Intronic
1151699034 17:75732794-75732816 ATGGGACAGCAGGCCAGGCGAGG + Intronic
1152043298 17:77919035-77919057 AAGGTAATGCTGGCCGGGCGCGG - Intergenic
1152078023 17:78170406-78170428 AGGGGACAGCAGGCTGGGCGAGG + Intronic
1152086374 17:78221623-78221645 AAGACAAAACAGGCCGGGTGCGG - Intronic
1152513061 17:80803374-80803396 CAGACACAGCAGGACGGGTGGGG - Intronic
1152565733 17:81099554-81099576 AAGGCACAGAAGCCTGGGTGTGG - Intronic
1152706300 17:81845311-81845333 AAGGCAGAGCAGGCCCGGTCCGG + Intronic
1152775506 17:82199185-82199207 AAGCTATAGCAGGCTGGGTGTGG + Intronic
1152853678 17:82651536-82651558 AATCTACAGTAGGCCGGGCGCGG + Intergenic
1152872502 17:82764352-82764374 AGGAGAAAGCAGGCCGGGTGCGG + Intronic
1152982237 18:289531-289553 AAGGGGCAACAGGCCGGGCGTGG + Intergenic
1153201278 18:2650117-2650139 AACGTGATGCAGGCCGGGTGCGG + Intergenic
1153557349 18:6329441-6329463 AAGAAACAGAAGGCTGGGTGCGG - Intronic
1155164991 18:23224857-23224879 AAGAAAAAGAAGGCCGGGTGCGG - Intronic
1155311298 18:24526564-24526586 AAGGCATTTCAGGCCGGGTGTGG - Intergenic
1155472904 18:26209187-26209209 AAAGTAAAGCAGGCTGGGTGTGG + Intergenic
1155519099 18:26651491-26651513 AAGGTAAAGTTGGCCGAGTGTGG + Intronic
1155899085 18:31365145-31365167 AAGGTGTAACAGGCCAGGTGCGG + Intergenic
1156537844 18:37880907-37880929 TAGGAGGAGCAGGCCGGGTGCGG - Intergenic
1156606014 18:38668363-38668385 GATGCAAAGCAGGCCGGGTGCGG + Intergenic
1157128065 18:44976477-44976499 TAGGCACAGCAGGGCGGATGAGG - Intronic
1157245376 18:46049589-46049611 AATGAACAACCGGCCGGGTGAGG + Intronic
1157247398 18:46066737-46066759 AGGGTGGAACAGGCCGGGTGCGG + Intronic
1157344783 18:46816756-46816778 AAATTACAGCAAGCTGGGTGCGG - Intronic
1157542662 18:48522905-48522927 TAGGTACCGCAGGCCAGGTGGGG + Intergenic
1157662123 18:49454607-49454629 AATCTGCTGCAGGCCGGGTGCGG + Intronic
1157891239 18:51420120-51420142 AAGTTGCTGCAGGCCGGGCGCGG - Intergenic
1158208576 18:55021712-55021734 GAGGTAGAGCCGGCCAGGTGCGG + Intergenic
1158345625 18:56513683-56513705 CAGTTAATGCAGGCCGGGTGCGG + Intergenic
1158711982 18:59845828-59845850 AGAGTACAGTAGGCTGGGTGTGG + Intergenic
1158969234 18:62650992-62651014 AAGGTACAATAGGCGGGGCGCGG - Intergenic
1159566600 18:70058224-70058246 AAAGTAAAACAGGCCGGGTGCGG + Intronic
1159611702 18:70532974-70532996 AAGGTACAGAGGCCCAGGTGAGG + Intergenic
1159742158 18:72185190-72185212 AAGCCACTGTAGGCCGGGTGCGG - Intergenic
1160187234 18:76685368-76685390 AAAGAAAAGCTGGCCGGGTGCGG - Intergenic
1160200204 18:76789303-76789325 AAATTACATTAGGCCGGGTGAGG + Intergenic
1160513268 18:79464383-79464405 ATGAAACAGCAGGCCGGGCGCGG - Intronic
1160531389 18:79567076-79567098 AAGGTACAGCAGGAGGATTGTGG - Intergenic
1160709956 19:546973-546995 AACGCACATCAGGCCGGATGTGG - Intronic
1160731970 19:645310-645332 ACGGGTCAGCAGGCCGGGCGCGG + Intergenic
1160978188 19:1804201-1804223 ACCGTCAAGCAGGCCGGGTGTGG + Intronic
1161073179 19:2272449-2272471 AAGGGACCCCAGGCCGGGAGCGG - Intronic
1161346058 19:3769376-3769398 AAGCTAAACCAGGCCAGGTGCGG - Exonic
1161652896 19:5496237-5496259 GAGGTAGAGCAGGCAGGATGTGG + Intergenic
1161723400 19:5915627-5915649 AGGGAGCAGCAGTCCGGGTGCGG - Exonic
1161814685 19:6492748-6492770 AGGTTGCAGTAGGCCGGGTGCGG + Intergenic
1162041404 19:7973101-7973123 AGGACACTGCAGGCCGGGTGTGG - Intronic
1162515918 19:11147582-11147604 AAAGTATAGCAGGCCAAGTGTGG - Intronic
1162518253 19:11163169-11163191 AAAGTACATGAGGCCGGGCGCGG - Intergenic
1162598261 19:11646163-11646185 AATGTAGAACAGGCCAGGTGCGG - Intergenic
1162599007 19:11652898-11652920 AATGTAAAGCCGGCTGGGTGCGG + Intergenic
1162641223 19:12011878-12011900 AAGATGGAGCCGGCCGGGTGTGG - Intergenic
1162646990 19:12057136-12057158 AAGGAAAAACAGGCTGGGTGCGG + Intergenic
1162808085 19:13149469-13149491 AAGGTCCTGCAGGCGGGGAGTGG - Intronic
1162840976 19:13356202-13356224 AAGGAACACCATGCAGGGTGGGG + Intronic
1162886877 19:13703413-13703435 ATGGCACGGCTGGCCGGGTGGGG - Intergenic
1162941791 19:14014863-14014885 AAAGTAGATGAGGCCGGGTGCGG + Intergenic
1163082252 19:14952629-14952651 AAGGTGATCCAGGCCGGGTGCGG - Intronic
1163355375 19:16807201-16807223 TATGAACACCAGGCCGGGTGTGG + Intronic
1163393093 19:17042428-17042450 AAGTCACAAGAGGCCGGGTGCGG + Intergenic
1163600789 19:18247972-18247994 CAGGTTCAGCAGCCTGGGTGGGG + Intronic
1163689901 19:18732798-18732820 TAACTACAGGAGGCCGGGTGTGG + Intronic
1163784939 19:19270153-19270175 AAGGTGCAGGAGGCAGGGAGAGG - Exonic
1163787427 19:19282268-19282290 AAAGTTCAGGAGGCTGGGTGTGG - Intronic
1163895375 19:20053638-20053660 AAAGTAAAACAGGCTGGGTGTGG + Intergenic
1163995285 19:21039754-21039776 AAGCAAAAGTAGGCCGGGTGCGG - Intronic
1164618296 19:29679552-29679574 AAGGGAGAGCTGGCTGGGTGCGG - Intergenic
1164624661 19:29718116-29718138 AAGAAACAACAGGCCGGGCGCGG - Intergenic
1164960959 19:32429135-32429157 ACTGTACAGCTGGCCGGGTGTGG - Intronic
1164968492 19:32509342-32509364 TATGAACAACAGGCCGGGTGCGG - Intergenic
1165003864 19:32788400-32788422 AAAGTAAAGCAGGCTGGGTGTGG - Intronic
1165025293 19:32956342-32956364 AAGAAAAAACAGGCCGGGTGCGG - Intronic
1165034680 19:33024143-33024165 ACTGCACAGGAGGCCGGGTGTGG + Intronic
1165047880 19:33120566-33120588 AAGGTAAAAGAGGCTGGGTGCGG + Intronic
1165077133 19:33286085-33286107 GAGGTGCCCCAGGCCGGGTGTGG - Intergenic
1165077239 19:33286696-33286718 AAGGCAGAGAAGGCCGGGTGCGG - Intergenic
1165192955 19:34079468-34079490 ATGGCACGGCTGGCCGGGTGGGG + Intergenic
1165309434 19:35021607-35021629 TAGGGACAGAAGGCCGGCTGGGG + Intronic
1165591981 19:36976618-36976640 ATGGTAGAGCTGGCCGGGTGCGG + Intronic
1165594658 19:37002474-37002496 AAAGTAAAGTCGGCCGGGTGCGG + Intergenic
1165659357 19:37562090-37562112 AAGATAATGTAGGCCGGGTGCGG + Intronic
1165709279 19:37998489-37998511 AAAATACTTCAGGCCGGGTGTGG + Intronic
1166028566 19:40108739-40108761 ATGGCACAGCTGGCCGGGCGGGG + Intergenic
1166037012 19:40175900-40175922 AATAAAAAGCAGGCCGGGTGCGG - Intergenic
1166335006 19:42100458-42100480 AATGTAAGCCAGGCCGGGTGTGG + Intronic
1166639678 19:44484868-44484890 GATGTTTAGCAGGCCGGGTGCGG + Intronic
1166822503 19:45589132-45589154 AGGGGACAGCAGGTCGTGTGGGG - Intronic
1166865333 19:45832717-45832739 AATGTACAGCAGGCTGGGCGTGG + Intronic
1167004280 19:46765540-46765562 AAAGTAGAGCAGGCCTGGCGTGG + Intronic
1167130148 19:47579962-47579984 AAGGTACAGTAGACCAGGCGTGG + Intergenic
1167174227 19:47854191-47854213 AAGGGACTTCAGGCCGGGTGTGG + Intergenic
1167256322 19:48431873-48431895 AAAGGAAAGCAGGCCGGGCGCGG - Intronic
1167256371 19:48432198-48432220 AAGAAAAAGAAGGCCGGGTGCGG - Intronic
1167270530 19:48503336-48503358 AAGGTAGAGTGGGCCGGGTGCGG - Intronic
1167393721 19:49213279-49213301 AAAGTACTGGAGGCCGGGTACGG - Intergenic
1167410024 19:49339047-49339069 AAGGTACGGCAGGAGGGGCGGGG + Intronic
1167507758 19:49880146-49880168 AAGGTACAGCAGGCCGGGTGCGG - Intronic
1167597341 19:50434765-50434787 AAGGAACAGCAGGCAGGGCAGGG + Intronic
1167687628 19:50966505-50966527 AATGTAAATCAGGCTGGGTGTGG + Intronic
1167887437 19:52513438-52513460 AAGGGATATCAGGCTGGGTGTGG + Intergenic
1168035650 19:53717366-53717388 AAGGGACCTCAGGCTGGGTGTGG + Intergenic
1168091761 19:54090199-54090221 AAAATACAGTAGGCCAGGTGCGG - Intergenic
1168231713 19:55036720-55036742 AAGTTAAAACAGGCTGGGTGCGG + Intronic
1168371798 19:55841570-55841592 ATAGTGCTGCAGGCCGGGTGCGG + Intronic
1168495516 19:56844883-56844905 AAGCAATAGCAGGCCGGGTGCGG - Intergenic
1168566173 19:57425704-57425726 ATGGTAAAACCGGCCGGGTGCGG - Intronic
1202655429 1_KI270708v1_random:16279-16301 AAGAACAAGCAGGCCGGGTGTGG + Intergenic
925236852 2:2286270-2286292 AATGAAGAACAGGCCGGGTGTGG - Intronic
925695647 2:6575310-6575332 AAAATACAGGAGACCGGGTGTGG + Intergenic
926172842 2:10564029-10564051 AAGAAAAAGCAGGCCAGGTGCGG + Intergenic
926185940 2:10690643-10690665 GAAGTACTGTAGGCCGGGTGCGG + Intergenic
926187716 2:10704408-10704430 AATGTACAGCTGGCCCAGTGTGG + Intergenic
926200036 2:10788362-10788384 ATAGCAGAGCAGGCCGGGTGCGG + Intronic
926264717 2:11305083-11305105 AAGATACAGGGGGCCAGGTGTGG + Intronic
926847364 2:17156795-17156817 AAAATACAGCAGGCCAGGCGCGG + Intergenic
927041303 2:19233091-19233113 TAGGAACAGGAGGTCGGGTGTGG - Intergenic
927440986 2:23117605-23117627 AAAGAACAGCTGGTCGGGTGCGG - Intergenic
927557369 2:24045309-24045331 AAGGCAGGGCAGGCTGGGTGTGG + Intronic
927589280 2:24339196-24339218 GAGGTACAAGAGGCCAGGTGTGG + Intronic
927663021 2:25008805-25008827 GAGAGAAAGCAGGCCGGGTGTGG - Intergenic
927822489 2:26280560-26280582 AAGGCATTTCAGGCCGGGTGCGG + Intronic
927877272 2:26666539-26666561 AAGGCACAAAAGGCCAGGTGTGG - Intergenic
928397666 2:30955446-30955468 AAGGTAGAGCAGCCTGTGTGAGG - Intronic
928508728 2:31982006-31982028 AAGATACAACTGGCCGGGCGCGG + Intronic
928670747 2:33600637-33600659 AAGGTACTACTGGCCGGGCGCGG - Intergenic
928999918 2:37337209-37337231 ATGTTGCAGAAGGCCGGGTGCGG + Intergenic
929105053 2:38357037-38357059 AAGGTTTAGCCGGCTGGGTGCGG + Intronic
929246367 2:39707754-39707776 AAGGAACAGAAGGTGGGGTGTGG - Intronic
929431264 2:41888984-41889006 AAGCATCAGGAGGCCGGGTGTGG + Intergenic
929544103 2:42844517-42844539 AGGGCAAAGCAGGCCGGGTGCGG - Intergenic
929596557 2:43179891-43179913 AACTCACATCAGGCCGGGTGCGG - Intergenic
929833184 2:45366769-45366791 AAAGAAGAGCAGGCCGGGTGCGG - Intergenic
929877099 2:45805887-45805909 AAGGTAATGTAGGCTGGGTGCGG - Intronic
930772510 2:55141981-55142003 AAGGTACACCAGGCTGGGCAGGG + Intergenic
930808447 2:55516636-55516658 TATGTATAACAGGCCGGGTGCGG - Intergenic
931257843 2:60589532-60589554 AAGGCATATCAGGCTGGGTGTGG + Intergenic
931284656 2:60821719-60821741 AAGGAAGAGAAGGCCTGGTGGGG - Intergenic
931352775 2:61506937-61506959 AAGGTGAAGAAGGCCGGGCGCGG + Intronic
931360243 2:61571815-61571837 AAGACAAAGCAGGCCGGGCGCGG + Intergenic
931606888 2:64061619-64061641 AAGGGACACAAGGCCGGGCGCGG - Intergenic
932193345 2:69760120-69760142 AAGATAAAACAGGCCGGGCGTGG - Intronic
932224251 2:70026958-70026980 AAGCTATAGCAGGCTGGGTGTGG + Intergenic
932932297 2:76056591-76056613 TAAGTTCAGGAGGCCGGGTGTGG - Intergenic
933087341 2:78072242-78072264 AAGGAAAAGCAGGCCAGGCGCGG + Intergenic
933236818 2:79873606-79873628 AAGGGACAGTAGGCCAGGTGTGG + Intronic
933716633 2:85366259-85366281 AGGGAAGAGTAGGCCGGGTGCGG - Intronic
933905935 2:86892476-86892498 AGTGTACAGAAGGCCGGGTGTGG - Intergenic
934476974 2:94600158-94600180 AAGGCAGACCAGGCTGGGTGCGG - Intronic
935000866 2:99013619-99013641 AAGATACTTCAGGCTGGGTGCGG - Intronic
935690644 2:105728296-105728318 AATGGAAAGCAGCCCGGGTGCGG - Intergenic
935761772 2:106327530-106327552 AATGCACAGGGGGCCGGGTGCGG + Intergenic
935766777 2:106375642-106375664 GTGCTACAGAAGGCCGGGTGTGG - Intergenic
935890818 2:107675942-107675964 AAAGTAATGCAGGCCAGGTGTGG + Intergenic
936058266 2:109277882-109277904 AAGGCATTTCAGGCCGGGTGTGG + Intronic
936366228 2:111859190-111859212 GTGCTACAGAAGGCCGGGTGTGG + Intronic
936456694 2:112680628-112680650 AAATTAAAGCAGGCCAGGTGAGG - Intergenic
936637289 2:114273293-114273315 AAGTCATAGCAGGCCGGGTGTGG + Intergenic
937371455 2:121300482-121300504 AAGGCAAGGCAGGCCAGGTGCGG - Intergenic
937788841 2:125935293-125935315 AAGGCAGGGGAGGCCGGGTGTGG + Intergenic
938125136 2:128665570-128665592 CAGGTGCAGCTGGTCGGGTGGGG + Intergenic
938198867 2:129356686-129356708 AAAGGACAGCAGGTTGGGTGAGG - Intergenic
938375362 2:130801823-130801845 AAGGTACAGCAGGCCGGGCGCGG + Intergenic
938405346 2:131029842-131029864 AAAGTACAACTGGCCGAGTGTGG - Intronic
938720739 2:134064357-134064379 ACGGGGCAGCTGGCCGGGTGGGG - Intergenic
938828839 2:135033345-135033367 ACGGGGCAGCTGGCCGGGTGGGG + Intronic
938871126 2:135477701-135477723 AAAATACAGTAGGCCAGGTGTGG + Intronic
939126996 2:138189522-138189544 AGTGTAGAGCAGGCTGGGTGCGG + Intergenic
939346863 2:140976799-140976821 AAGGTAGTTCAGGCTGGGTGTGG - Intronic
939913804 2:148015602-148015624 AATGTATTCCAGGCCGGGTGTGG - Intronic
940542205 2:155034972-155034994 AAGTAACAGCAGGCCGGGCGCGG - Intergenic
941616641 2:167728094-167728116 AAGCTGCACCAGGCCGGGTATGG + Intergenic
941922696 2:170867707-170867729 TAGGAACAGCAGGCCTGGCGCGG - Intergenic
941934404 2:170971958-170971980 AAAGTAATTCAGGCCGGGTGCGG - Intergenic
942038569 2:172035452-172035474 ACAGTACAGTAGGCCGGGGGTGG - Intronic
942058507 2:172206883-172206905 AAGGGACCCCAGGCCAGGTGTGG - Intergenic
942069926 2:172307031-172307053 GGGGTACAGCGGGTCGGGTGAGG - Intergenic
942110496 2:172677876-172677898 AAGGGAAATTAGGCCGGGTGCGG + Intergenic
942147248 2:173039165-173039187 AAGTTCAAGCAGGCCAGGTGTGG + Intronic
942345419 2:174997739-174997761 AAGATACAAAAGGCCGGGTGTGG + Intronic
942711985 2:178847237-178847259 AAAGCAAAGCAGGCCAGGTGCGG + Intronic
943067892 2:183107872-183107894 AAGATATTTCAGGCCGGGTGCGG + Intergenic
943364246 2:186954289-186954311 AGGATGCAGTAGGCCGGGTGCGG - Intergenic
943579150 2:189663541-189663563 GATATACACCAGGCCGGGTGCGG - Intronic
944238032 2:197457910-197457932 AATGTAATGGAGGCCGGGTGCGG - Intronic
944609720 2:201390252-201390274 CATGTATAGCTGGCCGGGTGCGG + Intronic
944747785 2:202675692-202675714 AGAATACAGCAGGCTGGGTGTGG + Intronic
944782445 2:203033288-203033310 AAGGTACAACTGGCTGGGCGCGG - Intronic
944809346 2:203312486-203312508 AATTTAAAGCCGGCCGGGTGTGG + Intergenic
945055340 2:205863746-205863768 AAAATACTTCAGGCCGGGTGTGG + Intergenic
945199227 2:207264704-207264726 AAGCCAAAGTAGGCCGGGTGCGG + Intergenic
945262744 2:207859885-207859907 AATGTACACCAGGCTGGGTGCGG - Intronic
945389581 2:209247665-209247687 AAGCAACAGGAGGCCGGGCGCGG + Intergenic
945754000 2:213823653-213823675 AAAGCTCAACAGGCCGGGTGTGG - Intronic
945892103 2:215441036-215441058 AAGGCACTGCTGGCCGGGCGTGG + Intergenic
945907715 2:215613881-215613903 AAAGTACTCCAGGCTGGGTGTGG + Intergenic
946094251 2:217258947-217258969 AAGGCAAAGGAGGCTGGGTGCGG + Intergenic
946281737 2:218670880-218670902 AATGAAAAGGAGGCCGGGTGTGG + Intronic
946292872 2:218758951-218758973 AAGGAACAGAGGGCCGGGCGTGG + Intergenic
946539112 2:220664150-220664172 AAGAACAAGCAGGCCGGGTGTGG - Intergenic
946953823 2:224906767-224906789 AAGATAAACAAGGCCGGGTGCGG - Intronic
946995737 2:225389140-225389162 AAGGTAATAAAGGCCGGGTGCGG + Intergenic
947059487 2:226146491-226146513 ATAGTACATCAGGCCGGGCGCGG - Intergenic
947505422 2:230704796-230704818 AAGGAAAAGCAGGCCAGGCGCGG - Intergenic
947768613 2:232653578-232653600 AAGCTACCACAGGCCGGGAGCGG - Intronic
947772263 2:232679980-232680002 AACGTACATAAGGCTGGGTGTGG + Intronic
947789519 2:232856220-232856242 AAAGAACTGCAGGCCGGGTGTGG - Intronic
947821316 2:233073029-233073051 AATCTGCAGCAGGCAGGGTGGGG + Intronic
948068500 2:235100875-235100897 AAAGTAATGCAGGCTGGGTGTGG + Intergenic
948473732 2:238203445-238203467 AAGGGAGAGCAGGCGGGATGGGG - Intronic
948706438 2:239796007-239796029 AAGGGGCAGCTGGCCGGGCGGGG - Intronic
948864521 2:240768559-240768581 ATGGCACAGCAGCCCAGGTGGGG - Intronic
1168826131 20:815507-815529 ACAATACCGCAGGCCGGGTGCGG + Intergenic
1169098980 20:2929240-2929262 AAAAAACAGCAGGCCAGGTGTGG - Intronic
1169233049 20:3905635-3905657 AAGAGATAGCAGGCCGGGTGTGG - Intronic
1169873804 20:10274551-10274573 AAAGTAGATCAGGCTGGGTGCGG + Intronic
1170024900 20:11878549-11878571 AAGAAACATCAGGCCGGGCGCGG - Intergenic
1170067194 20:12325893-12325915 TAGTTACAGGAGGCCGGGCGCGG + Intergenic
1170186845 20:13600983-13601005 AAGGTAAGCCTGGCCGGGTGTGG + Intronic
1170191730 20:13651528-13651550 AAAGAAAAGCAGGCCGAGTGTGG + Intergenic
1171059278 20:21940519-21940541 AAGCTAAAACAGGCTGGGTGTGG - Intergenic
1171749565 20:29035684-29035706 AGAGAAAAGCAGGCCGGGTGTGG + Intergenic
1171861504 20:30405670-30405692 ACGGTGCGGCTGGCCGGGTGGGG - Intergenic
1172103712 20:32502618-32502640 AAAATAATGCAGGCCGGGTGTGG + Intronic
1172233837 20:33356033-33356055 AAGGTAAAACAGGCCGGGTGTGG - Intergenic
1172346776 20:34208065-34208087 ATGGTGCTGGAGGCCGGGTGTGG - Intronic
1172559513 20:35874264-35874286 AATTTATAGCAGGCCAGGTGTGG - Intronic
1172817177 20:37696889-37696911 AATGTAAAGTGGGCCGGGTGTGG + Intronic
1172887556 20:38241361-38241383 AAGGTGGAGCAAGCCCGGTGTGG - Exonic
1173528993 20:43754180-43754202 AATGTGTAGCAGGCCGGGTGCGG - Intergenic
1174037999 20:47679875-47679897 AAGATAAAGCAGGGAGGGTGGGG - Intronic
1174341425 20:49899088-49899110 ATGGTACCGCTGGCCGGGTGTGG + Intergenic
1174489931 20:50885662-50885684 AAGGAAAATCCGGCCGGGTGTGG - Intergenic
1174820105 20:53719295-53719317 AAGAGACACCAGGCCTGGTGAGG + Intergenic
1175883844 20:62276956-62276978 AAGATAAATCAGGCCGGGCGTGG + Intronic
1175976655 20:62713807-62713829 AAGTTGCAGAAGGCCGGGCGTGG + Intronic
1176037960 20:63049509-63049531 CAGGTACAAGAGGCCGAGTGCGG + Intergenic
1176134904 20:63518245-63518267 AAGCTATAGCAGGCCGGTTCAGG - Intergenic
1176190224 20:63805207-63805229 AAGGTACTGTAGGTCGGGCGTGG - Intronic
1176248976 20:64111102-64111124 AAAATACAAAAGGCCGGGTGCGG + Intergenic
1176315671 21:5240319-5240341 AGAGAAAAGCAGGCCGGGTGTGG - Intergenic
1177430118 21:20981808-20981830 AAGGCACATCAGGCTGGGCGTGG - Intergenic
1177685211 21:24427393-24427415 AAGTTGCAACAGGCTGGGTGTGG + Intergenic
1177785703 21:25669080-25669102 AAGGTAGGGGAGGCCAGGTGTGG + Intronic
1177842136 21:26246425-26246447 AAGGGAAATCAGGCCAGGTGCGG + Intergenic
1177974274 21:27827674-27827696 AAGGTAAATGAGGCCGGGTGTGG - Intergenic
1178312581 21:31542133-31542155 TGGGTACAGCAGGCCAGGTGCGG + Intronic
1178431505 21:32522211-32522233 AAGGAGCAGCAGGCTGAGTGTGG - Intergenic
1178597468 21:33967773-33967795 AAGCCACTGCAGGCCGGGCGTGG + Intergenic
1178711237 21:34918617-34918639 AAGATACATGAGGCCGGGCGTGG + Intronic
1178857819 21:36265103-36265125 AAAGTGCAGTAGGCCGTGTGCGG + Intronic
1178884693 21:36475963-36475985 AAGTTACATCAGGCCAGGTACGG - Intronic
1178916065 21:36706167-36706189 GAGGAACGGCAGGCAGGGTGTGG + Intronic
1178942891 21:36922468-36922490 CAGGTACAGCATGCCGAGTTTGG - Intronic
1179196873 21:39172204-39172226 AAAGGAGAGCAGGCAGGGTGGGG + Intergenic
1179377941 21:40868140-40868162 AAGCTACAGTAGGCCAGGTGTGG - Intergenic
1179875394 21:44264433-44264455 AAAGAAAAACAGGCCGGGTGCGG - Intergenic
1180350136 22:11794105-11794127 AAGAACAAGCAGGCCGGGTGCGG + Intergenic
1180388074 22:12198147-12198169 AAGAACAAGCAGGCCGGGTGCGG - Intergenic
1180674198 22:17576061-17576083 AAGGTAGAGGAGGCCGGGCATGG + Intronic
1180722773 22:17921777-17921799 AAGGGACAGCTAGCCGGGCGCGG - Intronic
1181129642 22:20723308-20723330 AGGGAACAGTAGGCCGGGCGCGG - Intronic
1181293622 22:21817548-21817570 AAGGTATATTAGGCCTGGTGTGG + Intronic
1181645242 22:24227535-24227557 AACGTACTTTAGGCCGGGTGTGG - Intronic
1182008673 22:26982326-26982348 AAAGGAGAGCTGGCCGGGTGCGG + Intergenic
1182293892 22:29301912-29301934 AAGGTAGAGCAGGGCAGCTGGGG - Intergenic
1182423663 22:30260608-30260630 AAGGAAGAGCAGGGCAGGTGGGG - Intergenic
1182468187 22:30531115-30531137 AAGGAACTGTAGGCCAGGTGCGG + Intronic
1182545872 22:31076114-31076136 AAGGGAAGGCAGGCAGGGTGGGG - Intronic
1182728742 22:32470498-32470520 AATGTTTAGCAGGCCAGGTGCGG + Intergenic
1182731202 22:32496188-32496210 ATGCTAAATCAGGCCGGGTGTGG + Intronic
1182736934 22:32537447-32537469 AAGGAAGTGCCGGCCGGGTGCGG - Intronic
1183149351 22:36025972-36025994 AATGTATAGAAGGCCGGGTGTGG + Intronic
1183160027 22:36106730-36106752 AAGCAAGAGCAGGCCGGGTGCGG - Intergenic
1183335955 22:37246244-37246266 AAAGAACATCAGGCCGGGTGTGG + Intergenic
1183592850 22:38790875-38790897 AAAGTACAGTTGGCCGGGTGCGG + Intronic
1183682472 22:39341098-39341120 AAGTAACTGCAGGCCTGGTGTGG - Intergenic
1183852947 22:40607212-40607234 CAGGTACACAAGGCCGGGTGCGG + Intronic
1183933638 22:41249696-41249718 AAGGAACAGCAGGCCCGGGAGGG - Intronic
1184083013 22:42238825-42238847 AAGTAACATCAGGCCGGGCGCGG + Intronic
1184254689 22:43280406-43280428 AAGGGACAGGAGGATGGGTGAGG - Intronic
1184254729 22:43280504-43280526 AAGGGACAGCAGGATGGGTGAGG - Intronic
1184254737 22:43280529-43280551 AAGGGACAGGAGGATGGGTGAGG - Intronic
1184254746 22:43280554-43280576 AAGGGACAGCAGGATGGGTGAGG - Intronic
1184299729 22:43550379-43550401 AATGTTCAGAAGGCCGGGCGCGG + Intronic
1184375288 22:44108165-44108187 CAGGCACAGCAGGCCAGGCGTGG - Intronic
1184501233 22:44874182-44874204 AAGATATAGCTGGCTGGGTGTGG + Intergenic
1184698988 22:46156890-46156912 AACACACAGGAGGCCGGGTGTGG - Intronic
1184987169 22:48143831-48143853 AAGGTTCAACAGGCTGTGTGGGG + Intergenic
1185311864 22:50160540-50160562 AAGAAACAGGAGGCCGGGCGCGG - Intronic
1185379443 22:50501351-50501373 TAGGAACATCAGGCCGGGCGCGG + Intergenic
949184329 3:1171895-1171917 AGTATACAGCAGGCCGAGTGTGG - Intronic
949489193 3:4571622-4571644 AAGTGAAATCAGGCCGGGTGTGG - Intronic
949875095 3:8621355-8621377 GAGGTAAACCAGGCCGGGTGGGG + Intronic
950049521 3:9976397-9976419 AAAGTAAAACAGGCCAGGTGTGG - Intronic
950098915 3:10345585-10345607 CAGGGACAGGAGGCTGGGTGGGG + Intronic
950290142 3:11777501-11777523 ACAGTTCAGCAGGCCGGGTGCGG + Intergenic
950467096 3:13162054-13162076 AGTGAACACCAGGCCGGGTGGGG + Intergenic
950635593 3:14312168-14312190 AAGGAAGAGCAGGCACGGTGTGG + Intergenic
950722388 3:14892525-14892547 ACTGTCCAGCAGGCCGGGCGCGG + Intronic
950811289 3:15652036-15652058 AAGGTACTGCAGACCGGGCACGG + Intergenic
950949081 3:16980119-16980141 ACGGGGCAGCTGGCCGGGTGGGG + Intronic
951467700 3:23020143-23020165 AAGCCACAGCAGGCAGGGAGGGG + Intergenic
951808298 3:26671303-26671325 AAGATACATGAGGCCGGGCGCGG - Intronic
951892303 3:27578775-27578797 AAAGAAAAGCAGGCCAGGTGCGG + Intergenic
951897864 3:27627545-27627567 AAGAAAAAGGAGGCCGGGTGCGG + Intergenic
952083716 3:29792946-29792968 AAGGAAAAGCTGGCCAGGTGTGG + Intronic
952348904 3:32515775-32515797 AAGGTAATGTAGGCCGGGAGCGG + Intergenic
952429117 3:33204609-33204631 AAAATAAAACAGGCCGGGTGTGG - Intronic
952457215 3:33484579-33484601 AAGGTTAAGCAGGCTGGGTGTGG - Intergenic
952761817 3:36921849-36921871 AAAGCACAGCAGGCCAGGTACGG + Intronic
953131130 3:40139868-40139890 AAGGAACTGCTGGCAGGGTGTGG - Intronic
953131338 3:40142341-40142363 AATCAACAGCAGGCCGGGTGCGG - Intronic
953651691 3:44811353-44811375 AAGTTAAAAGAGGCCGGGTGCGG + Intronic
953739362 3:45523801-45523823 AAACTACAGCAAGCCAGGTGTGG - Intronic
953934814 3:47032219-47032241 GAAGTAAAGCAGGCCAGGTGTGG + Intronic
953939309 3:47077371-47077393 AGGGCACAGCAGGCCGGGCGTGG - Intronic
954160065 3:48714711-48714733 AAGGTAGGGCAGGCCAGGCGCGG + Intronic
954173612 3:48825297-48825319 AAAGAAAATCAGGCCGGGTGTGG - Intronic
954310405 3:49762251-49762273 AAGAAAGAACAGGCCGGGTGTGG + Intronic
954481291 3:50803814-50803836 AAGGGGCAGCTGGCCGGGTTGGG + Intronic
954821007 3:53327497-53327519 AAGAAAAAGCTGGCCGGGTGCGG + Intronic
955281454 3:57598185-57598207 AAGGTGTAGCAGGCCGGGCGCGG - Intronic
955299917 3:57768426-57768448 AAAGTCAAGCAGGCCAGGTGTGG + Intronic
955674483 3:61434749-61434771 ATGGGGCAGCTGGCCGGGTGGGG + Intergenic
955677361 3:61462876-61462898 TAGGGACAAGAGGCCGGGTGCGG + Intergenic
955792603 3:62604118-62604140 AACGTATAGCAGGCCGGGTGAGG - Intronic
956443958 3:69307627-69307649 AAGAAATAGTAGGCCGGGTGTGG - Intronic
957450620 3:80377285-80377307 GAAGTACAGTAGGCCAGGTGTGG - Intergenic
957693175 3:83597934-83597956 AATGTACTGTAGGCCGGGCGTGG + Intergenic
957767405 3:84643997-84644019 AGTGTACTTCAGGCCGGGTGCGG + Intergenic
958772512 3:98442589-98442611 CAGGTATAGCCGGCCGGGCGCGG - Intergenic
959286955 3:104427092-104427114 AAGATACTTCAGGCCAGGTGTGG + Intergenic
959666885 3:108932629-108932651 AAAGTCCAGCAGGCCGGGCACGG + Intronic
960088914 3:113619113-113619135 AAAGGACAATAGGCCGGGTGTGG - Intronic
960399383 3:117177571-117177593 AAAAAATAGCAGGCCGGGTGCGG - Intergenic
960562558 3:119101217-119101239 AAAGTAAAGCAGGCCGGGTGCGG + Intronic
960692202 3:120358489-120358511 CAGGAACAAGAGGCCGGGTGTGG - Intergenic
960816172 3:121675124-121675146 AAGGCACCTCAGGCCGGGCGCGG - Intronic
961178469 3:124856174-124856196 GAGTTAGAGAAGGCCGGGTGTGG - Intronic
961783112 3:129333098-129333120 AAAAAAAAGCAGGCCGGGTGTGG + Intergenic
962115826 3:132506340-132506362 AATGTACAGAAGGCCGGGCGCGG - Intronic
962172520 3:133117058-133117080 CAGGTAAATCAGGCCGGGTGCGG - Intronic
962184267 3:133241902-133241924 AAGCCACAGGAGGCCGGGGGTGG - Intronic
962970878 3:140400830-140400852 AAGGGACCGCAGGCCCAGTGTGG - Intronic
963051335 3:141146484-141146506 AAGACACACCAGGCCGGGCGCGG + Intronic
963235211 3:142948807-142948829 AAGGAAAAGCTGGCCGGGCGTGG - Intergenic
963819033 3:149867553-149867575 AAGAGACAAGAGGCCGGGTGCGG - Intronic
964077461 3:152708796-152708818 AAAACACAGTAGGCCGGGTGTGG - Intergenic
964709369 3:159655597-159655619 AAGAAACAGCAGGCCGAGCGTGG + Intronic
964754627 3:160082382-160082404 AAGGTTAAGCAGGTCAGGTGGGG - Intergenic
965841192 3:172907516-172907538 AAGGAACAGCAAGCAGGGTAGGG - Intronic
965850740 3:173020003-173020025 AAGGAACTGGAGGCTGGGTGCGG + Intronic
966229157 3:177631809-177631831 AAGCAACAACAGGCTGGGTGCGG - Intergenic
966683157 3:182664823-182664845 TAGGTACCTCAGGCCGAGTGCGG - Intergenic
966719996 3:183053178-183053200 AAGTTAAAACAGGCCGGGTGTGG + Intronic
966757169 3:183382348-183382370 AAGGTAAAATTGGCCGGGTGTGG - Intronic
966844688 3:184119343-184119365 AACGTACTGCAGGCCAGGCGCGG + Intergenic
966873412 3:184307231-184307253 AAGGCACAGCAGGCTGGGCATGG - Intronic
967318666 3:188174480-188174502 AAGGCACAGCATGCTGGGTGAGG + Intronic
967592227 3:191291740-191291762 AAAGTAGATCAGGCCGGGCGCGG - Intronic
967738918 3:192983832-192983854 AAGTGACAATAGGCCGGGTGCGG + Intergenic
967964132 3:194947313-194947335 AACATTCTGCAGGCCGGGTGTGG - Intergenic
968016206 3:195336192-195336214 AAGCTAACGAAGGCCGGGTGTGG - Intronic
968035717 3:195545761-195545783 AAGGAAAAGCAGGCCATGTGTGG - Intergenic
968159647 3:196415484-196415506 CAAGTTCAGCAGGCTGGGTGCGG + Intronic
968202172 3:196764090-196764112 AAGCAGCAGCAGGCCGGGCGCGG - Intronic
968268747 3:197383183-197383205 AGGGAACAGAAGGCCGGGTGCGG - Intergenic
968838855 4:2985706-2985728 CAGATACAGAAGGCCGGGTGTGG + Intronic
968924143 4:3538551-3538573 ATGGGGCAGCTGGCCGGGTGGGG + Intergenic
969351600 4:6601211-6601233 AAGTTACAACTGGCTGGGTGTGG + Intronic
969370125 4:6726711-6726733 ATGGTACAGGAGGCTGGATGTGG - Intergenic
969391124 4:6892063-6892085 AGGGTGCAGCAGGCAGGCTGGGG - Intergenic
969557629 4:7923753-7923775 AAGAGAAACCAGGCCGGGTGCGG - Intronic
970476615 4:16430246-16430268 AGGGTAAAGAGGGCCGGGTGTGG + Intergenic
970551028 4:17181268-17181290 AAAGTATAACAGGCCGGGTGTGG - Intergenic
971455753 4:26842209-26842231 AAGATACAGCAGGTCTGGAGAGG - Intergenic
971644606 4:29182966-29182988 AAAACAAAGCAGGCCGGGTGCGG + Intergenic
971707527 4:30065202-30065224 AAGATGCAGTAGGCTGGGTGTGG - Intergenic
971892191 4:32538981-32539003 AAGATAGACCAGGCCGGGCGCGG + Intergenic
972364753 4:38364012-38364034 AAAGTAATGCAGGCCGGGTGTGG + Intergenic
972392023 4:38622779-38622801 AAGGTAAGGAAGGCTGGGTGTGG - Intergenic
972633199 4:40859493-40859515 ACACTACTGCAGGCCGGGTGCGG - Intronic
973033215 4:45371692-45371714 AAGGGAAAATAGGCCGGGTGCGG + Intergenic
973559233 4:52117874-52117896 AAGGGAGAGGAGGCCGAGTGCGG + Intergenic
973603568 4:52565080-52565102 AAGATACAATAGGCCGGGTGTGG - Intergenic
973618212 4:52701930-52701952 ATGTTCCAGCAGGCCAGGTGCGG + Intergenic
973673046 4:53238282-53238304 ACGGGGCAGCTGGCCGGGTGGGG + Intronic
975164582 4:71163953-71163975 AAGGAAAAGCAGCCCGAGTGTGG + Intergenic
975582259 4:75917754-75917776 AAGTGAAAGCAGGCCAGGTGCGG - Intronic
976193167 4:82508431-82508453 AAGATACAACAAGCCAGGTGTGG - Intronic
976340701 4:83943434-83943456 ACGGGGCAGCTGGCCGGGTGGGG + Intergenic
976656239 4:87491812-87491834 AAGGGAAACCAGGCTGGGTGTGG + Intronic
976857975 4:89627453-89627475 AAAATAAATCAGGCCGGGTGCGG - Intergenic
978133831 4:105233091-105233113 AAGCTACTGCAGGTGGGGTGCGG + Intronic
978212828 4:106158257-106158279 ATTGTACAACAGGCCGGGCGTGG + Intronic
978519481 4:109601081-109601103 AAGATACAATAGGCCGGGTGCGG - Intronic
978561762 4:110041368-110041390 TACCTACTGCAGGCCGGGTGTGG - Intergenic
978665491 4:111176709-111176731 GAGATACAACAGGCCGGGCGTGG + Intergenic
979283990 4:118900050-118900072 AAAGTACAGCAGGCCGGGTGCGG - Intronic
979474961 4:121144690-121144712 AAGCAAAAACAGGCCGGGTGCGG - Intronic
979491334 4:121331472-121331494 AAGATATATCAGGCCGGGTGTGG - Intronic
980764793 4:137287697-137287719 AATGTATTGCAGGCCGGGTGCGG - Intergenic
980932181 4:139192518-139192540 AAGGGAGAGTAGGCCGGGCGCGG - Intergenic
980979889 4:139645577-139645599 ATGGTAAAACAGGCCGGGCGCGG - Intergenic
981700616 4:147603332-147603354 AAATTAAAACAGGCCGGGTGCGG + Intergenic
981716007 4:147752815-147752837 ATAGTAAAGCAGGCCAGGTGCGG - Intronic
982136912 4:152280983-152281005 AAGGGACAGCAGGCAGAGGGTGG - Intergenic
982773915 4:159422957-159422979 AAGGATTAGCAGGCCAGGTGCGG + Intergenic
983069072 4:163247790-163247812 AGGCTAAAGCAGGCTGGGTGTGG - Intergenic
983113472 4:163782378-163782400 AAGGTCCAGCAGGCCGGGTGTGG + Intronic
983299149 4:165903046-165903068 AAGTGACAATAGGCCGGGTGCGG + Intronic
983503032 4:168521892-168521914 AAGGAACAGAAGGCCAAGTGAGG - Intronic
984004775 4:174294780-174294802 ACGGTGCGGCTGGCCGGGTGGGG + Intronic
984004849 4:174294956-174294978 ACGGGACGGCTGGCCGGGTGGGG + Intronic
984023254 4:174511934-174511956 AATGTTCAGCAGGCCGGGAGCGG - Intronic
984049516 4:174846301-174846323 AATGTAAAGGAGGCCGGGCGCGG - Intronic
984672407 4:182505744-182505766 AAAGAAAAGCAGGCCGGGTGTGG - Intronic
984682209 4:182623618-182623640 AAAATAAAACAGGCCGGGTGCGG - Intronic
985504420 5:271000-271022 AAGCAAAAGCAGGCCGGGCGCGG - Intergenic
985743680 5:1634535-1634557 AAAAAAAAGCAGGCCGGGTGCGG + Intergenic
986116007 5:4775309-4775331 AAAGTAAACCAGGCCGGGCGCGG - Intergenic
986772228 5:10984781-10984803 AAGGCATAAGAGGCCGGGTGTGG + Intronic
987133588 5:14881308-14881330 AAGGTAAAGCAGGCCGGGCACGG + Intergenic
987139209 5:14928452-14928474 AAAGTAGATGAGGCCGGGTGTGG + Intergenic
987160402 5:15135502-15135524 TAGTTTGAGCAGGCCGGGTGCGG - Intergenic
987343668 5:16959941-16959963 TAGGTAAATTAGGCCGGGTGCGG + Intergenic
987613380 5:20239162-20239184 ATGCTCCAGTAGGCCGGGTGTGG + Intronic
987704199 5:21442765-21442787 AAGATACTCCAGGCCGGGTGCGG - Intergenic
987729407 5:21749144-21749166 AAAATACACCAGGCCGGGCGCGG - Intergenic
988760300 5:34306023-34306045 ACGGGACAGCTGGCCGGGCGGGG + Intergenic
988903192 5:35755898-35755920 AACTTACAGTAGGCTGGGTGTGG - Intronic
988960446 5:36365523-36365545 AACCTAAAGCAGGCCAGGTGTGG - Intergenic
989206479 5:38814329-38814351 AAGCTACAGATGGCTGGGTGTGG + Intergenic
989231802 5:39095572-39095594 AATGTATAAGAGGCCGGGTGTGG + Intergenic
989372344 5:40722828-40722850 ACGGGGCAGCTGGCCGGGTGGGG - Intronic
989378533 5:40790827-40790849 ATGCTACTGAAGGCCGGGTGTGG - Intronic
989548062 5:42697600-42697622 AATGAACAGCAGGCCGGCGGTGG + Intronic
989828948 5:45890913-45890935 ATGGGGCAGCTGGCCGGGTGGGG - Intergenic
990259537 5:54006798-54006820 TAGGTAAAACAGGCGGGGTGCGG + Intronic
990293190 5:54375777-54375799 AAGATACAGCAGGCTGGGAATGG + Intergenic
990936662 5:61157586-61157608 TAAGCACAGGAGGCCGGGTGCGG - Intergenic
991142578 5:63261710-63261732 AAGGTACAGTAGGCCAGATGTGG - Intergenic
991361770 5:65828187-65828209 ATGGTACAGCACACCGGGGGAGG + Exonic
991456187 5:66807204-66807226 AATGTACAATTGGCCGGGTGCGG + Intronic
991717149 5:69461673-69461695 AAAGTTGAGCTGGCCGGGTGTGG - Intergenic
992449698 5:76864995-76865017 AAAGTATAGTAGGCCGGGCGTGG - Intronic
992669160 5:79041702-79041724 AAGCTCCAGGAGGCCGGGTGCGG + Intronic
992900151 5:81286628-81286650 AAGGTAGAGCGGGCCAGGTGTGG - Intergenic
993294250 5:86114350-86114372 AAGATACAAGAGGCTGGGTGTGG - Intergenic
993723011 5:91340322-91340344 TGGGTACAGGAGGCCTGGTGCGG - Intergenic
993858307 5:93102504-93102526 AAGGACCATCAGGCCAGGTGCGG - Intergenic
994594292 5:101810981-101811003 AACATACACCAGGCTGGGTGTGG - Intergenic
995076710 5:107993183-107993205 AAAGAAAAACAGGCCGGGTGCGG - Intronic
996965798 5:129306184-129306206 AAGTTCCCACAGGCCGGGTGCGG - Intergenic
997650506 5:135514074-135514096 AATGTACAGTAAGCCCGGTGTGG - Intergenic
997924808 5:138019967-138019989 AATGTATTACAGGCCGGGTGCGG - Intronic
997937285 5:138124291-138124313 AAGGTGCTTAAGGCCGGGTGTGG - Intronic
997991269 5:138546048-138546070 AAGGAAGAGGAGGCCAGGTGTGG - Intergenic
998018242 5:138750089-138750111 AAGAAAAAACAGGCCGGGTGCGG + Intronic
998086864 5:139333401-139333423 AATGCAAATCAGGCCGGGTGCGG - Intergenic
998223489 5:140307179-140307201 AATGTACATCAGGCCAGGTGTGG + Intergenic
998380562 5:141722092-141722114 ATGGAAAAGCAGGCCAGGTGTGG - Intergenic
998437542 5:142125102-142125124 ACAGTACAAGAGGCCGGGTGTGG - Intronic
998471794 5:142389477-142389499 AAAGCACTGCAGGCCGGGTGCGG - Intergenic
999094468 5:148965656-148965678 GAAGTAAAGCAGGCTGGGTGGGG + Intronic
999299820 5:150484485-150484507 AAAGTATACAAGGCCGGGTGTGG - Intergenic
999413840 5:151377635-151377657 AAGAGACAGCAGGCCGGGCGCGG - Intergenic
999538752 5:152548862-152548884 AAGATACTGAAGGCCGGGCGCGG + Intergenic
999604054 5:153296676-153296698 ACGGGGCAGCTGGCCGGGTGGGG + Intergenic
1000050623 5:157559973-157559995 GAGGTAGTGCAGGCCGGGCGCGG + Intronic
1000502504 5:162068684-162068706 CAGGGACAGCAGTCCTGGTGAGG + Intronic
1000665731 5:163993840-163993862 AGGTTAAAGCAGGCCAGGTGGGG + Intergenic
1000897348 5:166871883-166871905 GAGGTAAAGCTGGCCAGGTGCGG + Intergenic
1000902066 5:166923227-166923249 ACGGGGAAGCAGGCCGGGTGCGG + Intergenic
1001036874 5:168303304-168303326 AAGGCACAGGAGGCCAGGTGTGG + Intronic
1001296543 5:170503097-170503119 ATGAGAGAGCAGGCCGGGTGGGG + Intronic
1001590507 5:172861295-172861317 AGGGCACTGCAGGCTGGGTGAGG - Intronic
1001779231 5:174353579-174353601 AAACTAGAGCAGGCCGGGCGCGG - Intergenic
1001787784 5:174428339-174428361 AATTTACAGCAGGCTGGGCGCGG - Intergenic
1002161446 5:177316052-177316074 AATGCAAATCAGGCCGGGTGCGG - Intergenic
1002206833 5:177568774-177568796 GAGGCACATCAGGCCAGGTGCGG + Intergenic
1002270163 5:178066517-178066539 AAGGTGAAACAGGCCGGGTGCGG + Intergenic
1002374459 5:178778409-178778431 AATGTACAGAAGGCCCAGTGCGG + Intergenic
1002386426 5:178870568-178870590 AAAACAAAGCAGGCCGGGTGTGG - Intronic
1002475085 5:179460521-179460543 ATGGAAAAACAGGCCGGGTGCGG + Intergenic
1002501173 5:179648616-179648638 AAGGTAGAGCCGGCTGGATGAGG - Intergenic
1002567373 5:180119515-180119537 AAGGTGAAGCGGGCCAGGTGAGG - Intronic
1002816543 6:686250-686272 GAGGTCCAGGAGGCCGGGCGCGG - Intronic
1003002557 6:2349771-2349793 AAGTGAGAACAGGCCGGGTGTGG + Intergenic
1003021133 6:2510590-2510612 ATGATACAGCAGGCTGGGAGGGG - Intergenic
1003085838 6:3060713-3060735 AAATGACAACAGGCCGGGTGTGG + Intergenic
1003480697 6:6529889-6529911 AAGCTACTACAGGCCAGGTGTGG - Intergenic
1003517286 6:6827599-6827621 AAGAAAAAGGAGGCCGGGTGTGG + Intergenic
1003597726 6:7489055-7489077 AAGGTACAGCATGGTGGGTTTGG - Intergenic
1003823330 6:9924860-9924882 AAGGCAGAGCAGGCCAGGAGGGG + Intronic
1003897741 6:10623578-10623600 AAGGTAGTACAGGCCGGGTGCGG - Intronic
1004035996 6:11924768-11924790 AATGTACAATGGGCCGGGTGCGG + Intergenic
1004413902 6:15406967-15406989 AAGGTACATGAGGCCATGTGCGG + Intronic
1004997415 6:21207201-21207223 AATTTAAAGTAGGCCGGGTGTGG - Intronic
1005282004 6:24284315-24284337 AATGTAAAGCAGGCCAGGCGTGG + Intronic
1005725339 6:28642294-28642316 ATGAAACAGCAGGCCGGGCGCGG + Intergenic
1005749232 6:28867831-28867853 AGGGAAAAGCAGGCCGGGTGGGG - Intergenic
1005756057 6:28925802-28925824 AAGGTAGAACAGGCAGGGTGTGG + Intergenic
1006065036 6:31455568-31455590 ACGGGGCAGCTGGCCGGGTGGGG + Intergenic
1006195158 6:32235799-32235821 AAATGAAAGCAGGCCGGGTGTGG + Intergenic
1006319335 6:33311024-33311046 AGAGCACAGCAGGCCGGGCGTGG + Intronic
1006346258 6:33485670-33485692 ACGGGGCAGCTGGCCGGGTGGGG + Intergenic
1006405874 6:33844550-33844572 AAGATGGAGCAGGCTGGGTGTGG - Intergenic
1006577259 6:35055616-35055638 AAGGAACACAGGGCCGGGTGTGG - Intronic
1006745822 6:36341299-36341321 AAGATAAAATAGGCCGGGTGCGG + Intergenic
1006823386 6:36916112-36916134 AAGTAACAGCAGGCCAGGCGGGG - Intronic
1006851229 6:37100216-37100238 AAGGAAAAACAGGCCAGGTGTGG + Intergenic
1006863320 6:37188234-37188256 AGGAAACAGCAGGCCGGGCGCGG + Intergenic
1007658849 6:43469756-43469778 AATGTCAAGCAGGCGGGGTGCGG + Intergenic
1008646719 6:53521681-53521703 AAAACACACCAGGCCGGGTGCGG + Intronic
1008841519 6:55909971-55909993 AAGGGACGGCTGGCCGGGCGGGG + Intergenic
1008940089 6:57037610-57037632 AAGGAAAAACAGGCTGGGTGTGG - Intergenic
1009762056 6:68020272-68020294 AAGCTTCAGTAGGCCGGGCGCGG + Intergenic
1009958411 6:70486636-70486658 AAACTAAACCAGGCCGGGTGCGG + Intronic
1010467732 6:76188869-76188891 AAGGTAAAGTAGGCCAGGTGTGG + Intergenic
1011037178 6:82990566-82990588 AAGGAAAGGCAGGCCAGGTGTGG - Intronic
1011084272 6:83521790-83521812 AATATTAAGCAGGCCGGGTGTGG - Intronic
1011293980 6:85807584-85807606 AAGGAACATGGGGCCGGGTGTGG - Intergenic
1011448726 6:87471110-87471132 AAGCTAGTGCAGGCCAGGTGTGG + Intronic
1011755149 6:90491203-90491225 AAGGAAAACCAGGCCAGGTGCGG - Intergenic
1011893948 6:92200938-92200960 AAGTTAGAGCAGGCCGGGCGCGG + Intergenic
1012362502 6:98400607-98400629 AAGTTAAACCAGGCCAGGTGCGG + Intergenic
1012888099 6:104867776-104867798 AAAGTAAACAAGGCCGGGTGCGG + Intergenic
1013118491 6:107121127-107121149 AAGGTCCGGGAGGCCAGGTGTGG + Intergenic
1013316341 6:108946872-108946894 AAGGTACGGGAGGAAGGGTGTGG + Intronic
1013590597 6:111616573-111616595 AAGGCACAGCAGACTTGGTGGGG - Intergenic
1014742600 6:125163633-125163655 TAAGTACAACAGGCCGGGCGTGG + Intronic
1014820089 6:125979461-125979483 TAGGTAAAGTAGGCCGGGTGTGG + Exonic
1015128233 6:129778367-129778389 AATGTACAGCAAGCCAGGTGTGG + Intergenic
1015339306 6:132079617-132079639 TAGGTGCTGCAGGCCGGGCGCGG + Intergenic
1015754659 6:136595394-136595416 AAAATCAAGCAGGCCGGGTGCGG - Intronic
1015890255 6:137963341-137963363 AAAGAACAACTGGCCGGGTGTGG - Intergenic
1016146188 6:140676888-140676910 AAAGTACAGCAGGCCAGGTGCGG - Intergenic
1016854601 6:148654584-148654606 AAGGTTCTGCAGGCTGGGTGTGG + Intergenic
1016976607 6:149815170-149815192 AAAGGAAATCAGGCCGGGTGGGG + Intergenic
1017121359 6:151027117-151027139 AAAGGACAGGAGGCCTGGTGCGG - Intronic
1017607868 6:156152743-156152765 AAGGCACAATGGGCCGGGTGCGG + Intergenic
1017926768 6:158917431-158917453 AAGGAAGCGCAGGCCGGGTGCGG - Intergenic
1018048639 6:159988223-159988245 AAAGCATAGCAGGCCGGGCGCGG + Intronic
1018195004 6:161347904-161347926 AAGTTAGAGCAGGCCGGGCGCGG - Exonic
1018619024 6:165712928-165712950 AAGTTAAAACGGGCCGGGTGCGG - Intronic
1019386004 7:756602-756624 AAGGTACAAGGGTCCGGGTGTGG - Intronic
1019631579 7:2052475-2052497 CAGGCACAGCAGGCAGGGAGGGG + Intronic
1019979536 7:4611127-4611149 AATTAACAGCAGGCCAGGTGTGG + Intergenic
1020019739 7:4856398-4856420 AAAGATCAACAGGCCGGGTGCGG - Intronic
1020046202 7:5042477-5042499 AATGCATAGCAGGCCAGGTGCGG + Intronic
1020091067 7:5341471-5341493 ATGGAACAGCAGACCAGGTGTGG + Intronic
1020388626 7:7634458-7634480 AAGGTACAGTAGGGCAGGTGCGG + Intergenic
1020669105 7:11083748-11083770 TAGGGAAAGCAGGCCAGGTGTGG - Intronic
1020770083 7:12379802-12379824 AAAGTACTTAAGGCCGGGTGCGG + Intronic
1020937451 7:14485606-14485628 TAGGGACACCTGGCCGGGTGCGG + Intronic
1021073712 7:16274335-16274357 CAGCCACAACAGGCCGGGTGTGG - Intronic
1021098272 7:16558316-16558338 AAAGTAAAACAGGCCGGGCGCGG + Intronic
1021109155 7:16674188-16674210 AAGTTACTGTAGGCCGGGCGCGG - Intronic
1021440472 7:20669116-20669138 ATGGGGCAGCTGGCCGGGTGGGG - Intronic
1021665309 7:22971387-22971409 AAGGGGAAACAGGCCGGGTGTGG + Intronic
1021970127 7:25957581-25957603 ATGGTACTCCAGGCCAGGTGCGG - Intergenic
1021979499 7:26040585-26040607 TAGGTACTGTTGGCCGGGTGTGG + Intergenic
1022072127 7:26926581-26926603 AATGTACAATTGGCCGGGTGCGG - Intronic
1022083413 7:27045185-27045207 AAGGGGCAGCTGGCCGGGCGGGG - Intergenic
1022256512 7:28663494-28663516 AGGGGACAGCTGGCCGAGTGCGG - Intronic
1022344263 7:29499048-29499070 AAGGCACAGTTGGCCGGGCGTGG - Intronic
1022502012 7:30887649-30887671 GAGGAACAGCTGGCCTGGTGGGG + Intronic
1022563021 7:31369480-31369502 CAGGCACAGGATGCCGGGTGGGG + Intergenic
1023109352 7:36794118-36794140 AGGGTACAGGAGGCCGGGCTTGG - Intergenic
1023281166 7:38572193-38572215 ATGGTACACCTGGCCAGGTGTGG - Intronic
1023404642 7:39820007-39820029 AAGATAAAGCAGGCCGGGTGTGG + Intergenic
1024493753 7:50017843-50017865 TAGGTACAGGATGCCGGGTATGG + Intronic
1024539286 7:50463056-50463078 AAGGAAGAGAAGGCCGGGTGCGG - Intronic
1025011129 7:55399631-55399653 ATGGTACTGCAGGCCGGGCACGG - Intronic
1025016457 7:55442824-55442846 AATAAAAAGCAGGCCGGGTGCGG + Intronic
1025086048 7:56024203-56024225 AAAGTAAAGTAGGCCGGGCGCGG - Intronic
1025213156 7:57032859-57032881 ATGCCACAGCTGGCCGGGTGTGG - Intergenic
1026054920 7:66975611-66975633 AAGTTGAAGCAGGCCGGGCGCGG + Intergenic
1026213231 7:68325146-68325168 AAAGGAATGCAGGCCGGGTGTGG + Intergenic
1026293091 7:69026405-69026427 AAAGTTTAACAGGCCGGGTGCGG + Intergenic
1026484556 7:70807010-70807032 AAGTTTCAGCAGGCCGGGCGCGG + Intergenic
1026630556 7:72034061-72034083 TAGGAACAACAGGCCAGGTGCGG + Intronic
1026745682 7:73009969-73009991 AAAATAAAGCAGGCCGGGTGTGG + Intergenic
1026749336 7:73037911-73037933 AAAATAAAGCAGGCCGGGTGTGG + Intergenic
1026752984 7:73066056-73066078 AAAATAAAGCAGGCCGGGTGTGG + Intergenic
1026756634 7:73094182-73094204 AAAATAAAGCAGGCCGGGTGTGG + Intergenic
1026800857 7:73398952-73398974 AAACAACAACAGGCCGGGTGCGG - Intergenic
1026812919 7:73483975-73483997 AAGAAAAATCAGGCCGGGTGTGG + Intronic
1026867307 7:73831707-73831729 AAGGAGCAGCAGGCCGGAGGCGG - Exonic
1026905143 7:74058644-74058666 GAAGTACTGCAGGCCGGGTGTGG - Intronic
1026927068 7:74201808-74201830 AAAGTAGAGCCGGCCGGGTGCGG - Intronic
1026986958 7:74560869-74560891 AAGGGTCAGGAGGTCGGGTGTGG - Intronic
1027031788 7:74894643-74894665 AAAATAAAGCAGGCCGGGTGTGG + Intergenic
1027090771 7:75299246-75299268 AAAATAAAGCAGGCCGGGTGTGG - Intergenic
1027094416 7:75327216-75327238 AAAATAAAGCAGGCCGGGTGTGG - Intergenic
1027098059 7:75355141-75355163 AAAATAAAGCAGGCCGGGTGTGG - Intergenic
1027117071 7:75489676-75489698 AATGTATAGCAGGCCAGGCGCGG - Intergenic
1027120374 7:75514237-75514259 AAAATAAAGCAGGCCGGGTGTGG - Intergenic
1027179953 7:75931657-75931679 AAGGAAAAACAGGCCAGGTGCGG - Intronic
1027271523 7:76522463-76522485 AAAATAAAGCAGGCCGGGTGTGG + Intergenic
1027321289 7:77012405-77012427 AAAATAAAGCAGGCCGGGTGTGG + Intergenic
1027324922 7:77040470-77040492 AAAATAAAGCAGGCCGGGTGTGG + Intergenic
1027373725 7:77533504-77533526 AAGGGACGGCTGGCCGGGCGGGG + Intergenic
1027403606 7:77834980-77835002 AAAGGAAAGCTGGCCGGGTGCGG + Intronic
1027470284 7:78565080-78565102 AAGGTCAAGGAGGCCGGGCGCGG - Intronic
1028112625 7:86960539-86960561 AAGAAACAGCAGGCTGGGTGTGG - Intronic
1028130033 7:87160565-87160587 AAGAAACTACAGGCCGGGTGTGG - Intronic
1028334803 7:89638555-89638577 AATGTAAAGTAGGCCGGGCGCGG - Intergenic
1029228676 7:99048095-99048117 GAGGTACCCCAGGCCGGGCGTGG + Intronic
1029399167 7:100332034-100332056 AAAATAAAGTAGGCCGGGTGTGG - Intergenic
1029734854 7:102459861-102459883 AAGTTAAAACAGGCCAGGTGCGG + Intronic
1029820131 7:103138758-103138780 AGGCTACAGAAGGCTGGGTGTGG - Intronic
1030285039 7:107817211-107817233 ATGGCAGAGCTGGCCGGGTGCGG - Intergenic
1030354958 7:108531605-108531627 AAAGTAAAAGAGGCCGGGTGTGG - Intronic
1030760054 7:113339080-113339102 AAGTTAATGCAGGCCGGGAGCGG - Intergenic
1032300271 7:130680214-130680236 AAGGAAAAGCAGGCCAGGTGCGG + Intronic
1032532065 7:132630138-132630160 AAGAGACACCAGGCCGGGTGAGG - Intronic
1032924211 7:136584305-136584327 AAGGTACAATGGGCCAGGTGCGG - Intergenic
1033113368 7:138603391-138603413 CAGCTAAAGCAGGCCGGGTGCGG + Intronic
1033987419 7:147243284-147243306 AAAGCAAAGCAGGCCGGGTGCGG - Intronic
1034058944 7:148068109-148068131 AAGCTACAGCAGGTGGGGAGAGG - Intronic
1034179456 7:149126304-149126326 AAGGCAGAGCCGGCCGGGCGCGG + Exonic
1034247276 7:149656544-149656566 AGTTTATAGCAGGCCGGGTGTGG + Intergenic
1034389282 7:150771521-150771543 AAAATACAAAAGGCCGGGTGTGG + Intergenic
1034438992 7:151077081-151077103 GAGGTAAAGGAGGCAGGGTGGGG - Exonic
1034624851 7:152484776-152484798 AAAGCAGAGTAGGCCGGGTGCGG - Intergenic
1036061352 8:5324974-5324996 TAGGCAGAGCAGGCCGGGCGCGG + Intergenic
1036168659 8:6461628-6461650 AAGTCTCACCAGGCCGGGTGTGG - Intronic
1036589084 8:10151351-10151373 AGAGAACAGCAGGCCGGGCGTGG + Intronic
1036737304 8:11330304-11330326 ACGGGGCAGCTGGCCGGGTGGGG - Intergenic
1037404256 8:18524491-18524513 TACATACATCAGGCCGGGTGTGG + Intergenic
1037642089 8:20754510-20754532 AAGGTAAAACGGGTCGGGTGCGG - Intergenic
1037852405 8:22342976-22342998 TAGGTAGATAAGGCCGGGTGTGG + Intronic
1037898856 8:22675936-22675958 GAGGTACAGCAGGCCAGGGCTGG - Intergenic
1038277734 8:26135818-26135840 AAGGTACAAGAGGCTGGGCGTGG + Intergenic
1038364655 8:26918922-26918944 AAGGAAAGGCAGGCCGGGCGTGG + Intergenic
1038765308 8:30422558-30422580 AAATAACAGCAGGCCAGGTGAGG - Intronic
1038769281 8:30461683-30461705 ACTGTACATGAGGCCGGGTGCGG - Intronic
1039069592 8:33637333-33637355 AAGGGTTAACAGGCCGGGTGCGG - Intergenic
1039446505 8:37637465-37637487 AGAGTTCAGCAGGGCGGGTGTGG - Intergenic
1039586465 8:38711489-38711511 AAGGTGGACTAGGCCGGGTGTGG + Intergenic
1039595021 8:38784280-38784302 AAGTTGCTGCAGGCCGGGTGCGG + Intronic
1039869366 8:41532542-41532564 AATATAGGGCAGGCCGGGTGCGG + Intronic
1039880654 8:41623471-41623493 AAGGTGCAGCAGGCTTGGAGGGG - Exonic
1040028706 8:42804774-42804796 AAATTATTGCAGGCCGGGTGCGG - Intergenic
1040093239 8:43419403-43419425 ATGGGGCAGCTGGCCGGGTGGGG + Intergenic
1040416437 8:47199761-47199783 ATGGTACAACAGGCCAGGTGTGG - Intergenic
1040418033 8:47213471-47213493 AAGTCACAGAAGGCTGGGTGTGG + Intergenic
1040601105 8:48884573-48884595 AAGAAACAGGGGGCCGGGTGCGG + Intergenic
1040824714 8:51608545-51608567 AAAGTATTGCAGGCCGGGCGCGG + Intronic
1040858022 8:51970362-51970384 AAGGGACAGGGGGCAGGGTGGGG - Intergenic
1041073930 8:54151845-54151867 AAAGTAAAGGAGGCTGGGTGCGG - Intergenic
1041680939 8:60590248-60590270 AAGAAACAATAGGCCGGGTGCGG - Intronic
1041836097 8:62217222-62217244 CAGGGGCAGCAGGCTGGGTGGGG - Intergenic
1041930451 8:63280736-63280758 AACATACAGCAAGCTGGGTGTGG + Intergenic
1042277986 8:67025712-67025734 AAAGGACAGTAGGCCGGGTGCGG + Intronic
1042409298 8:68443694-68443716 AAGATGCACCAGGCTGGGTGTGG - Intronic
1042688255 8:71465330-71465352 AAGGAAGAAGAGGCCGGGTGTGG + Intronic
1042703478 8:71642429-71642451 ATGGTACAGCAGGCTGGGCGCGG - Intergenic
1042823862 8:72960581-72960603 AAGGTGAAGAAGACCGGGTGTGG + Intergenic
1042912890 8:73845061-73845083 ATGGTGCAGCTGGCCGGGCGGGG - Intronic
1043528332 8:81120849-81120871 AAGATGTAGGAGGCCGGGTGCGG - Intergenic
1043779187 8:84310755-84310777 AATGTATATTAGGCCGGGTGCGG + Intronic
1044177369 8:89144659-89144681 AAGGTAACACAGGCCGGGCGTGG - Intergenic
1044715100 8:95092871-95092893 AGGCTTCAGCAGGCCGGGAGCGG - Intronic
1045504616 8:102769640-102769662 GAGGTCAAGTAGGCCGGGTGCGG + Intergenic
1045526410 8:102944363-102944385 AATGGAGAACAGGCCGGGTGTGG + Intronic
1045584932 8:103523583-103523605 AATGTAAAGCAGGCAGGTTGAGG + Intronic
1045792962 8:106007271-106007293 AAAATACAGCAGGCCGGGCGCGG - Intergenic
1045867300 8:106882506-106882528 AAAGGAGACCAGGCCGGGTGCGG - Intergenic
1046267534 8:111849462-111849484 AAGTTAAAGAAGGCCGGGCGCGG - Intergenic
1046984014 8:120367643-120367665 AAGGCACATCGGGCTGGGTGCGG + Intronic
1047600255 8:126419055-126419077 AAGAAACAGCTGGCCGGGTGCGG + Intergenic
1047737768 8:127781443-127781465 AAGCTAAATCAGGCTGGGTGCGG - Intergenic
1047964279 8:130034177-130034199 AAGGAAAAACAGGCCGGGTGTGG + Intergenic
1048020797 8:130537307-130537329 AAGGAAGAGCTGGCAGGGTGTGG + Intergenic
1048665939 8:136661560-136661582 AAGAAATAGCAGGCCGGGCGCGG + Intergenic
1049244111 8:141552362-141552384 AAGGCACAGCAGGAGGGGAGGGG - Intergenic
1049579557 8:143405117-143405139 CAGGAGCAGCAGGCAGGGTGGGG - Intergenic
1050150836 9:2618066-2618088 AAAGTAGAGGAGGCTGGGTGTGG - Intergenic
1050236947 9:3591953-3591975 GAGGTACAGTTGGCCGGGCGCGG + Intergenic
1050679589 9:8095142-8095164 AAGATACTTCTGGCCGGGTGCGG + Intergenic
1051107604 9:13597718-13597740 AAGATTTTGCAGGCCGGGTGCGG + Intergenic
1051306068 9:15710885-15710907 AAGAGACAGAAGGCCGGGTACGG - Intronic
1052789004 9:32856664-32856686 AAGGAAAATCTGGCCGGGTGTGG - Intergenic
1052853054 9:33389744-33389766 AAGGCAGACCAGGCCGGATGCGG + Intronic
1053018971 9:34681518-34681540 AAGTTAAATGAGGCCGGGTGTGG + Intergenic
1053191065 9:36069247-36069269 TATGAAGAGCAGGCCGGGTGCGG + Intronic
1053368637 9:37542117-37542139 AAGGGACTGGAGGCCGGGTGTGG - Intronic
1053579550 9:39390180-39390202 AACTTTCAGCAGGCTGGGTGTGG - Intergenic
1053681094 9:40485934-40485956 AAGGCAGACCAGGCTGGGTGCGG + Intergenic
1053720614 9:40943278-40943300 GAGCAAAAGCAGGCCGGGTGTGG + Intergenic
1053844063 9:42218260-42218282 AACTTTCAGCAGGCTGGGTGTGG - Intergenic
1054101137 9:60948989-60949011 AACTTTCAGCAGGCTGGGTGTGG - Intergenic
1054282619 9:63139000-63139022 AAGGCAGACCAGGCTGGGTGCGG - Intergenic
1054294180 9:63321449-63321471 AAGGCAGACCAGGCCGGGTGCGG + Intergenic
1054392201 9:64625938-64625960 AAGGCAGACCAGGCCAGGTGCGG + Intergenic
1054426849 9:65131149-65131171 AAGGCAGACCAGGCCGGGTGCGG + Intergenic
1054503526 9:65890391-65890413 AAGGCAGACCAGGCCGGGTGCGG - Intronic
1054585216 9:66957891-66957913 AACTTTCAGCAGGCTGGGTGTGG + Intergenic
1054835459 9:69671816-69671838 AAGGTACAGCAGAGGGGATGGGG - Intronic
1054876255 9:70099682-70099704 AAGGTAGGGCAGGCCAGGCGCGG + Intronic
1055128118 9:72743075-72743097 AAAGTACAAAAGGCCGGGCGCGG + Intronic
1055151389 9:73004685-73004707 AATGTACAACCGGCCGGGCGCGG - Intronic
1055295859 9:74832758-74832780 AAGTTAAAACAGGCTGGGTGTGG + Intronic
1055948332 9:81710476-81710498 ATGGCACAGCTGGCCGGGCGGGG - Intergenic
1056176469 9:84041485-84041507 AAAGAACAGGAGGCCGGGCGCGG + Intergenic
1056633277 9:88311146-88311168 AAGATTCAGGAGGCCGGGTGTGG + Intergenic
1056925508 9:90830873-90830895 AAGAAAGAGGAGGCCGGGTGTGG - Intronic
1056944335 9:90981243-90981265 AAGGAAAATAAGGCCGGGTGCGG + Intergenic
1056954382 9:91070828-91070850 AAGAGAATGCAGGCCGGGTGCGG - Intergenic
1058483025 9:105416185-105416207 AAAGTTCAGTAGGCTGGGTGCGG - Intronic
1059096759 9:111424877-111424899 AAGATACAGCAGGCTGGGCATGG + Intronic
1059230411 9:112716330-112716352 AATGAATAGCAGGCCGGGAGCGG - Intronic
1059572924 9:115459871-115459893 ATGGTATGGCAGGCCGGGCGCGG + Intergenic
1060093463 9:120765383-120765405 AACTTTCATCAGGCCGGGTGCGG - Intronic
1060499511 9:124142332-124142354 AAGGCAAAGTAGGCCGGGTACGG + Intergenic
1060559860 9:124533937-124533959 AAGGTGCCCCTGGCCGGGTGCGG - Intronic
1060654290 9:125358394-125358416 AAAATACAGAAGGCCGGGCGGGG - Intronic
1060677109 9:125525381-125525403 AAGTAACAGGAGGCCGGGCGCGG + Intronic
1060823734 9:126675757-126675779 AATGTTCAGTAGGCCGGGCGCGG + Intronic
1061141418 9:128769696-128769718 AAAATACAGCAGGCTGGGTGTGG - Intronic
1061217347 9:129229436-129229458 AAGGCCCGGCAGGCCGGGCGAGG - Intergenic
1061314323 9:129785051-129785073 AAAATGCAGCATGCCGGGTGCGG - Intergenic
1061405864 9:130392705-130392727 GAGTTTAAGCAGGCCGGGTGCGG + Intronic
1061626440 9:131843260-131843282 AAGGCACACCAGGCCAGGTGCGG - Intergenic
1061784870 9:133021593-133021615 AAGAGACAGCAGGCTGGCTGTGG + Intergenic
1062189636 9:135241311-135241333 AAGGACCAGCAGGCTGGGGGAGG + Intergenic
1062329337 9:136030317-136030339 AGGGTACTGGAGGCCGGGCGCGG + Intronic
1062588264 9:137260768-137260790 AAGCTAAATTAGGCCGGGTGCGG + Intronic
1185585325 X:1238601-1238623 AAAATAAAACAGGCCGGGTGCGG + Intergenic
1185636203 X:1553955-1553977 AAGGGACCCCAGGCCGGGTGCGG + Intergenic
1185705556 X:2263799-2263821 AAAATCCAGCAGTCCGGGTGTGG - Intronic
1185959394 X:4532255-4532277 AAGAAACATCAGGCCTGGTGTGG + Intergenic
1186552670 X:10522784-10522806 AAGGTATTGTAGGCCGGGCGTGG - Intronic
1186882492 X:13880383-13880405 AAGGCAAATCAGGCCGGGCGCGG + Intronic
1187054563 X:15730469-15730491 GAGGTAGAGGAGGCTGGGTGCGG + Intronic
1187107650 X:16260787-16260809 AAAGTACTACAGGCCGGGCGCGG + Intergenic
1187137683 X:16563976-16563998 TATGTATAACAGGCCGGGTGTGG - Intergenic
1187339229 X:18406462-18406484 AAGCAACTACAGGCCGGGTGCGG - Intergenic
1187345824 X:18462731-18462753 AAGATACTGGAGGCCGGGCGTGG + Intronic
1187417812 X:19108174-19108196 AAGTTACAGAAAGCCAGGTGCGG + Intronic
1187739608 X:22341374-22341396 AAGTGACAGGAGGCCGAGTGGGG + Intergenic
1187899251 X:24011857-24011879 ACGGTAGAGTAGGCCAGGTGCGG + Intronic
1187989542 X:24854538-24854560 AATGTACCCCAGGCCGGGTGTGG + Intronic
1188257778 X:27983020-27983042 AAGGAACAACAGGCCGGGCGCGG - Intergenic
1188501636 X:30833257-30833279 ATGGCATAGTAGGCCGGGTGCGG - Intronic
1188652489 X:32649262-32649284 AAGGTGGAAGAGGCCGGGTGCGG + Intronic
1188875156 X:35420305-35420327 AAAGTAAAGCAGGCCGGGTGTGG - Intergenic
1189282452 X:39828349-39828371 CAGGCACGGCAGGCCGGGTGCGG + Intergenic
1189385322 X:40532214-40532236 AAAGTAATTCAGGCCGGGTGCGG + Intergenic
1189393803 X:40602358-40602380 AAAGAAGAGGAGGCCGGGTGCGG + Intronic
1189923986 X:45933795-45933817 AAGATACATAAGGCCGGGCGCGG + Intergenic
1190098900 X:47505087-47505109 AATGGAATGCAGGCCGGGTGTGG + Intergenic
1190109452 X:47580643-47580665 AAGATTTAGAAGGCCGGGTGTGG + Intronic
1190159976 X:48024835-48024857 AAAGTAAAGAAGGCCAGGTGTGG - Intronic
1190546153 X:51529860-51529882 AAGGAACTGTAGGCCGGGCGCGG + Intergenic
1190738870 X:53274749-53274771 CAGCTAAAGCAGGCCGGGTGCGG - Intronic
1190752347 X:53373242-53373264 AATGTACTTCAGGCTGGGTGCGG - Intergenic
1190805712 X:53834400-53834422 AAGCTTCTGCAGGCCAGGTGCGG - Intergenic
1190815392 X:53924739-53924761 AGGGAAAGGCAGGCCGGGTGCGG - Intergenic
1190836341 X:54104515-54104537 AAAACACAGGAGGCCGGGTGTGG + Intronic
1190841286 X:54147023-54147045 AAAGAAAAGCAGGCCGGGCGTGG + Intronic
1190958795 X:55224909-55224931 AATGCAAAGAAGGCCGGGTGCGG - Intronic
1191857168 X:65636444-65636466 AATGAAAAGCAGGCTGGGTGTGG + Intronic
1191865035 X:65697187-65697209 GGGGAACAGCAGGCTGGGTGGGG + Intronic
1192385748 X:70667635-70667657 AAGAAACAGTAGGCCGGGCGCGG + Intronic
1192440666 X:71171284-71171306 AAGATACAGGAGGCAGGGGGAGG - Intergenic
1192736993 X:73858866-73858888 AATGCACATCAGGCTGGGTGTGG - Intergenic
1192861738 X:75080592-75080614 ATGATACAGCAGGCCAGGCGTGG - Intronic
1193087859 X:77463415-77463437 AATATACAATAGGCCGGGTGTGG + Intergenic
1193328976 X:80215178-80215200 ACGGGGCAGCTGGCCGGGTGGGG - Intergenic
1193379563 X:80802813-80802835 AATGTCAAGCAGGCCAGGTGCGG + Intronic
1194148461 X:90291955-90291977 AATGAACTTCAGGCCGGGTGTGG - Intergenic
1194190071 X:90824671-90824693 AAGATACACACGGCCGGGTGCGG + Intergenic
1194817746 X:98464802-98464824 AATGAAAAGCAGGCCGGGCGTGG - Intergenic
1194884432 X:99295458-99295480 AAGGTACAGCAAGCCAAATGGGG + Intergenic
1194918077 X:99729287-99729309 AAGTTTATGCAGGCCGGGTGAGG + Intergenic
1194990670 X:100543602-100543624 AGGGAAAAGTAGGCCGGGTGCGG + Intergenic
1195495019 X:105521232-105521254 TAGCTATAGCAGGCCGGGCGCGG - Intronic
1195640614 X:107170700-107170722 AAGTTAAAATAGGCCGGGTGTGG - Intronic
1195645792 X:107229414-107229436 AGGAGAGAGCAGGCCGGGTGCGG - Intronic
1196083513 X:111659210-111659232 AAATTAGATCAGGCCGGGTGTGG + Intergenic
1196971128 X:121109841-121109863 AAGCCACAGCAGGCAGGGAGGGG + Intergenic
1197025238 X:121740042-121740064 AAGATAAAACAGGCCAGGTGCGG - Intergenic
1197171420 X:123438793-123438815 AAGTTATAGCAGATCGGGTGCGG - Intronic
1197225542 X:123952815-123952837 AAGATAGAGCGGGCCGGGCGCGG + Intergenic
1197806909 X:130406143-130406165 AAGGCAAAGCAGGCCGGGCGCGG - Intronic
1198105289 X:133455813-133455835 AAGGGACATCAGGCTGGATGGGG + Intergenic
1198171901 X:134115133-134115155 AAGCCAGAGAAGGCCGGGTGTGG - Intergenic
1198259212 X:134951159-134951181 GAGCTCCTGCAGGCCGGGTGCGG - Intergenic
1198386424 X:136133476-136133498 AAGATACAGGAGGCTGAGTGTGG + Intergenic
1198537452 X:137600665-137600687 TAGGTACTGTGGGCCGGGTGTGG - Intergenic
1199312418 X:146336837-146336859 AACTTACTGCAGGCCGGGCGCGG - Intergenic
1199438468 X:147841359-147841381 AATGTTAAGAAGGCCGGGTGTGG + Intergenic
1200209331 X:154339714-154339736 AAAGTACATCAGGCCGGGCGCGG + Intergenic
1200221545 X:154392413-154392435 AAAGTACATCAGGCCGGGCGCGG - Intronic
1200282346 X:154787760-154787782 AAGGGAAAGCTGGCCAGGTGTGG - Intronic
1200756027 Y:6990845-6990867 AAAATAAAGCAGGCCGGGCGCGG - Intronic
1200868435 Y:8071132-8071154 AACATATAACAGGCCGGGTGCGG + Intergenic
1201237553 Y:11925787-11925809 AAGGTACAGCAGGGGGGGATCGG - Intergenic