ID: 1167509855

View in Genome Browser
Species Human (GRCh38)
Location 19:49890338-49890360
Sequence TCCGCAGCGCCTCCTGCATG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 162}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167509852_1167509855 4 Left 1167509852 19:49890311-49890333 CCTTGGTGGCCGGCACGTAGTGC 0: 1
1: 0
2: 0
3: 7
4: 64
Right 1167509855 19:49890338-49890360 TCCGCAGCGCCTCCTGCATGTGG 0: 1
1: 0
2: 1
3: 15
4: 162
1167509848_1167509855 24 Left 1167509848 19:49890291-49890313 CCTGCGGAAGCTTAGGAACACCT 0: 1
1: 0
2: 0
3: 4
4: 65
Right 1167509855 19:49890338-49890360 TCCGCAGCGCCTCCTGCATGTGG 0: 1
1: 0
2: 1
3: 15
4: 162
1167509853_1167509855 -5 Left 1167509853 19:49890320-49890342 CCGGCACGTAGTGCAGCCTCCGC 0: 1
1: 0
2: 0
3: 9
4: 89
Right 1167509855 19:49890338-49890360 TCCGCAGCGCCTCCTGCATGTGG 0: 1
1: 0
2: 1
3: 15
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167509855 Original CRISPR TCCGCAGCGCCTCCTGCATG TGG Exonic
900143749 1:1149394-1149416 TCCGCAAGGCCTCCTGTTTGGGG - Intergenic
900404015 1:2484588-2484610 CCTGCAGCGCTTCCTGCAGGTGG + Exonic
900511033 1:3061319-3061341 CTTGCAGCGCCTCCTGCATGAGG + Intergenic
900823863 1:4910879-4910901 TCCACAGCTCGACCTGCATGGGG - Intergenic
901162916 1:7193639-7193661 TCCGCACCCCCTTCTGCAGGTGG - Intronic
903287275 1:22285088-22285110 TCCAGACCGCCTCCTCCATGCGG - Intergenic
903786963 1:25867788-25867810 TCCTAAGCTCCTCCTGCATTAGG + Intronic
903888910 1:26556918-26556940 CCAGCACCTCCTCCTGCATGGGG + Intronic
904305449 1:29585829-29585851 TCCTGAGCGCCTGCTGCACGTGG - Intergenic
905205788 1:36342171-36342193 TCCGCAGGGCGGCCTGCAAGGGG - Intronic
905935346 1:41818975-41818997 TCCACACTGCCTCCTTCATGAGG - Intronic
910597103 1:88992468-88992490 CCCGCAGCGACTCCGGCAAGAGG + Intronic
915970425 1:160351313-160351335 TCAGCACTGCCACCTGCATGCGG + Exonic
919742678 1:200990293-200990315 TCCGCAGTGCCTCCTGCAGGAGG + Exonic
919928464 1:202206005-202206027 TCCTGAGCGCCCCCTGCAGGCGG - Intronic
920551443 1:206865101-206865123 TCCACAGCGCCCTCTGCAGGAGG - Intergenic
921219141 1:212960995-212961017 TGAGCAGTGCCTCCTCCATGAGG - Intronic
922460578 1:225811786-225811808 TCCTCAGCGCCTCCTAGGTGTGG - Intronic
1065859360 10:29858621-29858643 TCCACAGTGCCACCTGCAGGGGG + Intergenic
1066019440 10:31283367-31283389 ACAGCAGTGCCTCCTGGATGTGG - Intergenic
1072553386 10:96495808-96495830 TCCCCAGCTGCTCCTGCCTGGGG + Intronic
1072723635 10:97797599-97797621 CCCACAGCTCCTTCTGCATGTGG - Intergenic
1074537304 10:114337695-114337717 CTGGCAGCGCCTCCTACATGTGG - Intronic
1077041889 11:528453-528475 TCCGCAGGGCCTCCAGCAAGGGG + Intergenic
1077600112 11:3568777-3568799 TCCTCAGCTCCTTCTGCAAGGGG - Intergenic
1078241574 11:9535273-9535295 TCCACAGCGCCTCCTGCTGGTGG - Intergenic
1078432720 11:11300270-11300292 CCTGCTGAGCCTCCTGCATGGGG + Intronic
1079089771 11:17472719-17472741 TCAGCAGCCCCTCCTGTGTGTGG - Intronic
1081420352 11:42868607-42868629 TACGCAAACCCTCCTGCATGGGG - Intergenic
1081748455 11:45489400-45489422 TCCCCAGCTCCCCCTGCATCGGG - Intergenic
1081751200 11:45512449-45512471 TCTGCACTGCCTCTTGCATGGGG - Intergenic
1082002555 11:47401081-47401103 GCAGCAGGCCCTCCTGCATGTGG + Intergenic
1082085158 11:48044077-48044099 TGCGCAGTCCCTCCTGCAGGAGG - Intronic
1083678962 11:64342608-64342630 GCCTCAGCTCCTCCTGCAGGCGG - Exonic
1084063687 11:66691421-66691443 GCTGCAGCGCTTCCTGCACGGGG - Exonic
1084256028 11:67943394-67943416 TCCCCAGCTCCTTCTGCAAGGGG - Intergenic
1084323793 11:68387725-68387747 TCCACTGCGCCTCCTCCATCAGG - Intronic
1084816731 11:71651916-71651938 TCCCCAGCTCCTTCTGCAAGGGG + Intergenic
1084860369 11:72014124-72014146 CCCGCAGTGCCTCCAGCTTGGGG + Exonic
1085273733 11:75285171-75285193 TCTGCAGTGCCTCCCTCATGGGG + Intronic
1085392298 11:76188739-76188761 TCAGCAGGGCCTCCTGGAAGAGG + Intronic
1089460193 11:118648518-118648540 CCTGCTGCCCCTCCTGCATGTGG + Intronic
1090990341 11:131811546-131811568 TCTGCAGCCCTCCCTGCATGCGG - Intronic
1091267522 11:134282434-134282456 GCTACAGCCCCTCCTGCATGGGG - Intronic
1091433059 12:453073-453095 ACCGCAGCGCCCCCTGCGGGCGG - Intergenic
1091433080 12:453144-453166 ACCGCAGCGCCCCCTGCGGGCGG - Intergenic
1091433102 12:453215-453237 ACCGCAGCGCCCCCTGCGGGCGG - Intergenic
1091433124 12:453286-453308 ACCGCAGCGCCCCCTGCGGGCGG - Intergenic
1091433146 12:453357-453379 ACCGCAGCGCCCCCTGCGGGCGG - Intergenic
1091433168 12:453428-453450 ACCGCAGCGCCCCCTGCGGGCGG - Intergenic
1091433190 12:453499-453521 ACCGCAGCGCCCCCTGCGGGCGG - Intergenic
1096529789 12:52235310-52235332 TCCGCAGCTCCGCCTCCAGGCGG - Exonic
1097264581 12:57738015-57738037 TCCACAGCGCATCCTGCCGGTGG + Exonic
1101789222 12:107912496-107912518 TCCACAGCGCCCCCTGCAGGGGG - Intergenic
1103743861 12:123109094-123109116 TACCCAGCCCCTGCTGCATGGGG - Intronic
1105591823 13:21799614-21799636 TCTGCAGCACCTCTTGCTTGCGG + Intergenic
1105699789 13:22927075-22927097 TCCGCAGCTCGTCCTCCGTGCGG - Intergenic
1112185496 13:97124396-97124418 TCCCCACCAACTCCTGCATGTGG + Intergenic
1113144569 13:107193621-107193643 TCAGGGGCCCCTCCTGCATGTGG - Intronic
1116372115 14:44149678-44149700 TCTCCAGGGCCTCCTGCATGAGG + Intergenic
1116453927 14:45095963-45095985 TCGGCAGAGCAGCCTGCATGTGG + Intronic
1122064079 14:99159598-99159620 CCCGCAGAGCTTCCTGCATGTGG + Intergenic
1124247071 15:28079911-28079933 TGCCCAGGGCCTCCTGCCTGTGG + Intronic
1124338553 15:28875377-28875399 TCCCCAGCGCCTCCTGCCAGAGG + Intergenic
1125833180 15:42730349-42730371 CCAGCCCCGCCTCCTGCATGGGG + Intronic
1127807383 15:62533822-62533844 TCCACAGGGCTTGCTGCATGGGG - Intronic
1129330290 15:74823652-74823674 CCCGAAGCTCCTCCTGCAGGAGG - Exonic
1129769626 15:78194712-78194734 TCCACAGCGCCTCCTCTGTGGGG + Exonic
1131269842 15:90940416-90940438 TACGCAGAGCCGCCAGCATGAGG - Exonic
1131302883 15:91215039-91215061 TCCGGAGCGCTGCCTGCAGGAGG + Intronic
1132229494 15:100171136-100171158 ACTGCAGCCCCTCCTGCAGGTGG - Intronic
1132954685 16:2585442-2585464 GCCGCACCCCCTCCTTCATGGGG + Intronic
1133372073 16:5252779-5252801 TCCCCAGCTCCTTCTGCAAGGGG + Intergenic
1135177061 16:20239737-20239759 TCAGCAGCACCTCTTGCAAGTGG - Intergenic
1136144820 16:28310320-28310342 TCCACAGCTGCTCCTGCAAGTGG + Intronic
1141863995 16:86737201-86737223 TCCCCACCACCCCCTGCATGCGG - Intergenic
1143471154 17:7177050-7177072 CCCGCAGCTCCTCCTGCAGCTGG + Exonic
1143604814 17:7976753-7976775 TCCCCAGGGACTCCTGCAGGAGG + Intergenic
1144339064 17:14297804-14297826 TCCGCAGCTGCTCCAGCCTGCGG - Intergenic
1147193356 17:38749380-38749402 TCCGCAGTGGCTCCGGCAGGAGG + Exonic
1147195193 17:38761821-38761843 ACCTCAGCGCCTCCTGCAGGCGG - Intronic
1148091804 17:45026901-45026923 ACCACAGAGCCTCCTGGATGTGG + Intronic
1149567693 17:57651655-57651677 TCCCAAGTGCCTCCTGCCTGTGG + Intronic
1150394209 17:64808859-64808881 TCCCCAGAGACTCCTCCATGGGG + Intergenic
1150942479 17:69707652-69707674 TCTGCACCGCTTCCTGCCTGTGG - Intergenic
1151216236 17:72578522-72578544 TCCTCAGCGCTTCCTCCTTGGGG - Intergenic
1151400651 17:73853754-73853776 TCCACAGGGCCTCCTTCAGGAGG + Intergenic
1152145660 17:78567242-78567264 TCCCCAGCTCCTCCTGCCTGGGG - Intronic
1152528101 17:80901085-80901107 TCCGCAGTCCCTCTTGCCTGTGG - Intronic
1153675740 18:7454594-7454616 TCTGCAGCACCTCCTCAATGTGG + Intergenic
1160983398 19:1826934-1826956 TCCGCAGGCACTCCTCCATGGGG + Exonic
1161218072 19:3104674-3104696 TACACAGCGCCTTCTGCATAGGG + Intronic
1162043339 19:7983588-7983610 TGCTCAGCGCCTTCTGCATCCGG + Intronic
1162056769 19:8069180-8069202 TCCGCTGTGCTTCCTGCATCTGG + Intronic
1162738084 19:12757726-12757748 CCTGCAGCGCCTCCTGCCGGCGG + Exonic
1166986141 19:46660926-46660948 GCCGCAGCGCCTGCTGCACGCGG + Exonic
1167509855 19:49890338-49890360 TCCGCAGCGCCTCCTGCATGTGG + Exonic
925317987 2:2939932-2939954 TCCGCAGGGCTGGCTGCATGGGG + Intergenic
932688395 2:73892619-73892641 TCCTCAGGCCCTGCTGCATGCGG - Intronic
934690157 2:96352402-96352424 TCCTCAGGGCCCCCTGGATGGGG - Intronic
934950040 2:98570018-98570040 TCCCCAGCGCCAGCTGCACGTGG - Intronic
937019339 2:118635817-118635839 ACCGCAGTGCCTCATGCAGGGGG - Intergenic
938337315 2:130511379-130511401 TCCTCAGCACCCCCTGCACGTGG + Intergenic
938352523 2:130609356-130609378 TCCTCAGCACCCCCTGCACGTGG - Intergenic
948124420 2:235554478-235554500 TCAGAAGCCCCTGCTGCATGTGG + Intronic
1169214652 20:3786165-3786187 TGCGCAGCGCCTTCTCCTTGAGG + Exonic
1172117429 20:32581288-32581310 TCCACAGGGCCTCCTGCAGCTGG - Intronic
1175339564 20:58219548-58219570 TCCCCACCGCCTCCTGCAGATGG + Intronic
1179465051 21:41566488-41566510 CTCGCAGTGCCTCCTGCCTGGGG + Intergenic
1179603392 21:42496211-42496233 GCCGCAGCGCCTCTAGCAGGTGG + Exonic
1179791018 21:43755979-43756001 TCCGCAGCTCCAGCTGCATGGGG - Exonic
1179921571 21:44510343-44510365 TCCGGAGGGCCTTCTGCCTGAGG + Intronic
1180022600 21:45137864-45137886 TCCAGAGCCCCTCCTGCCTGGGG - Intronic
1180782655 22:18529596-18529618 TCTGCAGCGCGTCCTGGGTGTGG - Exonic
1181126215 22:20703623-20703645 TCTGCAGCGCGTCCTGGGTGTGG - Intergenic
1181239545 22:21468934-21468956 TCTGCAGCGCGTCCTGGGTGTGG - Intergenic
1183270086 22:36856508-36856530 TCCGCAGCGCCACCTAGAGGAGG - Intergenic
1184654141 22:45932676-45932698 TCCCCAGCGCCTGGTCCATGTGG + Intronic
1184773157 22:46609772-46609794 TAAGCACCGCCTCCTGCCTGGGG - Intronic
1184782939 22:46658179-46658201 TCCGGAGCTCCTCCTCTATGGGG - Exonic
1185086010 22:48741367-48741389 TCCCCAGCACCTCCTGCGTCGGG + Intronic
1185337274 22:50276280-50276302 TCCACAGCGCCCCCTCCCTGCGG - Intronic
950590661 3:13934045-13934067 TCTGCAGCGTCCCCTGCAAGTGG + Intergenic
952342565 3:32458152-32458174 TCCGCAGCTGCTCCTCCCTGGGG - Intronic
954108193 3:48420223-48420245 TCCCCAGACCCTCCTGCAAGAGG - Exonic
954861596 3:53695171-53695193 TCCCCAGCACCTCCTCCACGGGG - Intronic
961283181 3:125779296-125779318 TCCCCAGCTCCTTCTGCAAGGGG + Intergenic
962325558 3:134429079-134429101 ACAGCAGCCCCTCCAGCATGAGG + Intergenic
969739409 4:9013321-9013343 TCCCCAGCTCCTTCTGCAAGGGG + Intergenic
969798590 4:9544836-9544858 TCCCCAGCTCCTTCTGCAAGGGG + Intergenic
976297247 4:83484863-83484885 GCCGCCGCGCCTCCTCCCTGCGG - Intronic
978885585 4:113762419-113762441 CCCGCAGCCCCTTCTGCAAGGGG + Intergenic
983930741 4:173450649-173450671 TCTGCAGTTCCTCCTGCAGGAGG - Intergenic
984766731 4:183405591-183405613 CCCACAGCCCCTCCTGCACGCGG - Intergenic
986097599 5:4574955-4574977 TCTTCAGGGCCTCCTGTATGGGG - Intergenic
991227774 5:64292754-64292776 TCAGCAGCCCCTCCCCCATGGGG + Intronic
993020728 5:82587147-82587169 TCCACAGCTGCTTCTGCATGAGG - Intergenic
997215873 5:132110358-132110380 TCAGCAGGGCCTCCTGCAGAGGG - Intergenic
997367226 5:133333767-133333789 TGCGCAGGGCCTCCTGCATCAGG + Intronic
999140399 5:149357835-149357857 TCCGCCCCGCCCCCCGCATGCGG - Intergenic
1002648374 5:180673694-180673716 ACCACTGCGCCTCCTGCCTGAGG + Intergenic
1002958717 6:1893910-1893932 TCAGGAGCGCCTCCTGCCAGCGG - Intronic
1003872577 6:10413986-10414008 TTCCCAGCGCCTCCTGCGGGTGG + Intronic
1004113702 6:12747065-12747087 TCCGCTGCGCCTCTTGGAAGAGG + Intronic
1006793337 6:36717494-36717516 TCCCCAGCTCCTCCTGCAGCTGG + Intronic
1018994378 6:168700101-168700123 TCCAGGACGCCTCCTGCATGTGG - Intergenic
1019703827 7:2488093-2488115 TCTGCAGGGCCTCCTGGCTGGGG - Intergenic
1020023646 7:4883679-4883701 GCCGCGGCGCCTCCTGCCGGCGG + Exonic
1022972297 7:35529408-35529430 TCCGCAGGGCCTTGTCCATGCGG + Intergenic
1026275484 7:68872252-68872274 TACACACCTCCTCCTGCATGTGG + Intergenic
1026665443 7:72336778-72336800 TCCGCACCGCCCCCTCCCTGCGG - Intronic
1028828260 7:95299348-95299370 TGAGCAGCGCATCCTGGATGTGG + Intronic
1029496343 7:100897078-100897100 CCCGCAGCGCCTCGGGCACGCGG + Intergenic
1032383600 7:131506710-131506732 TCCGAAGCGCCCCCTGCCTATGG + Exonic
1034317000 7:150142302-150142324 ACCGCAACAACTCCTGCATGGGG + Intergenic
1034789865 7:153958382-153958404 ACCGCAACAGCTCCTGCATGGGG - Intronic
1035485291 7:159218743-159218765 TCTGCATCGCTTCCTGCCTGAGG - Intergenic
1036308317 8:7667779-7667801 TCCCCAGCTCCTTCTGCAAGGGG - Intergenic
1036361218 8:8078299-8078321 TCCCCAGCTCCTTCTGCAAGGGG + Intergenic
1036889758 8:12588704-12588726 TCCCCAGCTCCTTCTGCAAGGGG - Intergenic
1036897360 8:12646856-12646878 TCCCCAGCTCCTTCTGCACGGGG - Intergenic
1048463402 8:134641455-134641477 ACCTCAGTGCCTCCTCCATGAGG + Intronic
1049393054 8:142381871-142381893 GCCGCAGCTCATCCTGCGTGTGG + Intronic
1049681967 8:143923124-143923146 TACGCAGCGCTTCCTGCAGGAGG - Exonic
1051599871 9:18862055-18862077 TCAGCAGCGGCTCCTTCCTGTGG + Intronic
1056949947 9:91033952-91033974 TCAGCAGCGCCTCCTGTTGGTGG - Intergenic
1057904644 9:98974543-98974565 TCCTCTGCGCCTGCAGCATGGGG - Intronic
1058637135 9:107048046-107048068 TCCCCAACCCCTCCTGCATCAGG + Intergenic
1058739929 9:107932803-107932825 CTCCCACCGCCTCCTGCATGTGG + Intergenic
1059760848 9:117336143-117336165 TCCCCAGCACCTCCTGTCTGAGG - Intronic
1061822262 9:133235244-133235266 TCCGCAGCGTGGCCAGCATGGGG + Intergenic
1062141799 9:134963268-134963290 ACCGCAGCGGCTCCAGCACGCGG + Intergenic
1062596148 9:137300703-137300725 TCCCCCGCCCCTCCTGGATGAGG - Exonic
1187473752 X:19591482-19591504 TCCCCAGCGTCTCCTGAAGGTGG - Intronic
1190980861 X:55455733-55455755 CCTGCAGAGCCTCCTGCCTGAGG - Intergenic
1190987836 X:55517447-55517469 CCTGCAGAGCCTCCTGCCTGAGG + Intergenic
1196730667 X:118938269-118938291 CCCTCAGCGCCTCCTTCATGAGG - Intergenic
1197776323 X:130120863-130120885 TCTGCAGCGCCACCTGCACGCGG + Intergenic
1199860674 X:151798175-151798197 TCCCCAAGGCCTCCTGGATGAGG - Intergenic