ID: 1167512111

View in Genome Browser
Species Human (GRCh38)
Location 19:49900881-49900903
Sequence CCTCATCGAAACCATCATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 71}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167512111_1167512121 30 Left 1167512111 19:49900881-49900903 CCACAATGATGGTTTCGATGAGG 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1167512121 19:49900934-49900956 CCTGGCCCTGGCCCCACTGGGGG 0: 1
1: 0
2: 4
3: 68
4: 494
1167512111_1167512118 28 Left 1167512111 19:49900881-49900903 CCACAATGATGGTTTCGATGAGG 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1167512118 19:49900932-49900954 CACCTGGCCCTGGCCCCACTGGG 0: 1
1: 0
2: 7
3: 39
4: 369
1167512111_1167512119 29 Left 1167512111 19:49900881-49900903 CCACAATGATGGTTTCGATGAGG 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1167512119 19:49900933-49900955 ACCTGGCCCTGGCCCCACTGGGG 0: 1
1: 0
2: 6
3: 47
4: 378
1167512111_1167512117 27 Left 1167512111 19:49900881-49900903 CCACAATGATGGTTTCGATGAGG 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1167512117 19:49900931-49900953 ACACCTGGCCCTGGCCCCACTGG 0: 1
1: 0
2: 5
3: 38
4: 354
1167512111_1167512115 18 Left 1167512111 19:49900881-49900903 CCACAATGATGGTTTCGATGAGG 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1167512115 19:49900922-49900944 AGCAGCCAGACACCTGGCCCTGG 0: 1
1: 0
2: 4
3: 46
4: 366
1167512111_1167512114 12 Left 1167512111 19:49900881-49900903 CCACAATGATGGTTTCGATGAGG 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1167512114 19:49900916-49900938 CTATACAGCAGCCAGACACCTGG 0: 1
1: 0
2: 0
3: 7
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167512111 Original CRISPR CCTCATCGAAACCATCATTG TGG (reversed) Intronic
909720922 1:78768120-78768142 CCTCCTCAAAACCACCACTGGGG + Intergenic
910770177 1:90823077-90823099 GCTCATGGAAAGCTTCATTGAGG + Intergenic
919839976 1:201601902-201601924 CCTCCTCGACACCACCACTGAGG - Intergenic
924856541 1:247880058-247880080 CCACATACAAACCAGCATTGGGG - Intergenic
1065539743 10:26750936-26750958 CCTAATTGAAACCTTAATTGAGG + Intronic
1071923160 10:90374412-90374434 GCTCATTGAAGCCATCCTTGGGG + Intergenic
1073735248 10:106337469-106337491 CCTGATAGAAGCCATCCTTGAGG - Intergenic
1075933837 10:126322894-126322916 CCTCATATAACCCATCATTATGG - Intronic
1077887875 11:6399473-6399495 CCACATCGAACCAATCACTGAGG + Intronic
1082100883 11:48172016-48172038 CCTCCTCTAAACCAACACTGTGG - Intergenic
1090116276 11:123977535-123977557 CCTCATCTACAGCATCACTGTGG - Exonic
1092980374 12:13788729-13788751 CCTCAGCAAAACAATCATTTTGG - Intronic
1098689294 12:73466420-73466442 CCTTATCTAAACCAGTATTGTGG + Intergenic
1105006632 12:132725040-132725062 GCTGATGGAAACCCTCATTGGGG - Intergenic
1106985920 13:35349798-35349820 CCTCATCAAAACTAGAATTGTGG - Intronic
1119714941 14:76852531-76852553 CCTCATGGTCACCATCAATGAGG + Intronic
1121696802 14:95920233-95920255 CCTCCTGAAAACCATTATTGTGG - Intergenic
1129075238 15:72989321-72989343 ACACATCAAAACCATGATTGCGG + Intergenic
1131828347 15:96337547-96337569 CCCCATCGAAACCCTCATCCGGG + Exonic
1132406575 15:101544981-101545003 CCTCTTTGAACCTATCATTGTGG + Intergenic
1135283458 16:21172869-21172891 CCTCCCTGAAACCATCACTGTGG + Intronic
1137965559 16:52929179-52929201 CGTCATCGAAACAAGCCTTGGGG + Intergenic
1152371987 17:79894404-79894426 CCTCATCAAAATCATCATCATGG + Intergenic
1156571761 18:38263694-38263716 CCTCATGGTAATCATCTTTGAGG + Intergenic
1163494253 19:17636058-17636080 CCTCATAGTGTCCATCATTGAGG - Exonic
1167512111 19:49900881-49900903 CCTCATCGAAACCATCATTGTGG - Intronic
926050727 2:9742916-9742938 CCTCTTGGAAGCCATCATGGAGG - Intergenic
927637691 2:24828029-24828051 CCTCATCGCCACCATCATGCTGG - Exonic
929511584 2:42569056-42569078 CCTCCACGAAACCCTCATCGGGG + Intronic
929807360 2:45158706-45158728 CCTGATGGTAACCATCTTTGAGG - Intergenic
940832540 2:158483543-158483565 CATCATAGAGACCATCAGTGTGG + Intronic
945408155 2:209476166-209476188 CCTTCTCGAGACCATGATTGTGG + Intronic
947457406 2:230267876-230267898 CCTCATCAAAACCTTCATGAGGG - Intronic
1169157334 20:3342863-3342885 CCTCATTGAACCCATCTTCGTGG + Intronic
1177232732 21:18343306-18343328 CCTATTAAAAACCATCATTGAGG - Intronic
1177633654 21:23758286-23758308 CCTCGGGGAACCCATCATTGTGG - Intergenic
1180657756 22:17437559-17437581 CCCCATCCATACCATCACTGAGG + Intronic
1185205745 22:49537065-49537087 CCGCATGGAAACCAGCACTGAGG - Intronic
951636542 3:24784701-24784723 CCTCATTGAGATCATCATAGGGG + Intergenic
958526000 3:95260177-95260199 CCTCATCGAAACCTTCACTTTGG + Intergenic
959863920 3:111244468-111244490 CCTCATCTAAAGCCTCATTTGGG - Intronic
960055278 3:113272594-113272616 CCTCATCGACACCACCAGCGAGG + Exonic
962407309 3:135111171-135111193 CCTAAAGGAAACCATCAGTGGGG - Intronic
963123427 3:141794796-141794818 CCGTATCCAAACCATCACTGAGG - Intronic
966656321 3:182362437-182362459 CCTCATTGAAACCAGCCCTGTGG + Intergenic
966671304 3:182529442-182529464 TGTCATCAAAAGCATCATTGTGG + Intergenic
968074517 3:195809203-195809225 CCTTAAGGAAACCCTCATTGCGG + Intronic
969224060 4:5782907-5782929 TCTCCTCAAAACCATCATTAGGG - Intronic
974167958 4:58228444-58228466 TCTCATCAAAACCATTATAGGGG + Intergenic
983095149 4:163552659-163552681 CCTCGTTGAATCCATCACTGAGG + Intronic
986777996 5:11036719-11036741 CTACATCTAAACCATCTTTGCGG + Intronic
987805962 5:22769083-22769105 CCTCTTAGTAACCATCACTGGGG - Intronic
998892838 5:146764866-146764888 CCCCATCTAAACCATCCTAGTGG + Intronic
1002529737 5:179837097-179837119 TCTCAGTGAAACCAACATTGCGG - Exonic
1004657757 6:17680847-17680869 CATCATGGAGAACATCATTGAGG + Intronic
1007449427 6:41931765-41931787 CCTCCGGGAAGCCATCATTGTGG + Exonic
1007453864 6:41961171-41961193 CTTCATCAAAACAATCCTTGTGG + Intronic
1009548980 6:65061797-65061819 CCTCATAGGAACCATCATGTAGG + Intronic
1011202664 6:84854549-84854571 CCTCATCGAAACCAGCATCTTGG + Intergenic
1012026306 6:93996904-93996926 CCCCATGGCAACCATCATAGAGG - Intergenic
1016743018 6:147548304-147548326 CCTCAGAGAGACCATCATTTCGG + Intronic
1018065514 6:160122745-160122767 CCACCTCAACACCATCATTGAGG - Intronic
1018413321 6:163578739-163578761 CCTCATCCAGAACATCATTCAGG + Intergenic
1023305365 7:38820120-38820142 CCTCATCCAAGCCATCACTAAGG + Intronic
1030472383 7:109981224-109981246 TCTTTTAGAAACCATCATTGTGG + Intergenic
1031726152 7:125242042-125242064 CCTTATGAAAACCATCACTGTGG + Intergenic
1034785727 7:153924406-153924428 CCTCCTCAAAACCCTCAATGAGG - Intronic
1039417646 8:37409401-37409423 CCTCATATTAACCATCATGGAGG - Intergenic
1044924096 8:97195180-97195202 AGTCATCAAAACCATCTTTGTGG + Intergenic
1052021533 9:23531129-23531151 CCTTATAGAAACCATCAGTGAGG + Intergenic
1052351998 9:27467563-27467585 CCTCATCCAAACCACGAGTGGGG - Intronic
1053102203 9:35380575-35380597 CCTTGGCCAAACCATCATTGAGG + Exonic
1185996445 X:4955370-4955392 ACTCATGAAAACCAACATTGTGG - Intergenic
1187267948 X:17754056-17754078 CTTCATCCAAACCACCCTTGCGG - Exonic
1191897293 X:66006498-66006520 TCTCAAAGAAACCTTCATTGAGG + Intergenic